BMRB Entry 15538
Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR15538
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Structure of a high affinity anti-NFkB RNA aptamer PubMed: 18160411
Deposition date: 2007-10-25 Original release date: 2007-12-18
Authors: Reiter, Nicholas; Maher, L. James; Butcher, Samuel
Citation: Reiter, Nicholas; Maher, L. James; Butcher, Samuel. "DNA mimicry by a high affinity anti-NF-kB RNA apatamer" Nucleic Acids Res. 36, 1227-1236 (2008).
Assembly members:
RNA, polymer, 29 residues, 132.116 Da.
Natural source: Common Name: not available Taxonomy ID: not available Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: recombinant technology Host organism: not applicable
Entity Sequences (FASTA):
RNA: GAUACUUGAAACUGUAAGGU
UGGCGUAUC
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 193 |
| 15N chemical shifts | 31 |
| 1H chemical shifts | 256 |
Additional metadata:
Assembly:
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | RNA | 1 |
Entities:
Entity 1, RNA 29 residues - 132.116 Da.
| 1 | G | A | U | A | C | U | U | G | A | A | ||||
| 2 | A | C | U | G | U | A | A | G | G | U | ||||
| 3 | U | G | G | C | G | U | A | U | C |
Samples:
sample_1: RNA, [U-99% 13C; U-99% 15N], 1 ± 0.2 mM; KCl 50 mM; H20 90%; D2O 10%
Sample_D2O: RNA 1 ± 0.2 mM; D2O 100%
sample_conditions_1: ionic strength: 0.05 M; pH: 7.0; pressure: 1 atm; temperature: 298 K
Experiments:
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-1H NOESY | Sample_D2O | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-1H TOCSY | Sample_D2O | isotropic | sample_conditions_1 |
| 2D 1H-13C HSQC | sample_1 | isotropic | sample_conditions_1 |
| 3D 1H-13C NOESY | sample_1 | isotropic | sample_conditions_1 |
| 3D HCCH-TOCSY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-1H COSY | sample_1 | isotropic | sample_conditions_1 |
Software:
CNS v1.1, Brunger, Adams, Clore, Gros, Nilges and Read - structure solution
X-PLOR NIH, Schwieters, Kuszewski, Tjandra and Clore - refinement
NMR spectrometers:
- Varian INOVA 900 MHz
- Bruker DMX 750 MHz
Related Database Links:
| PDB |