BMRB Entry 15856
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR15856
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: NMR solution structure of the d3'-hairpin including the exon binding site 1 (EBS1) of the group II intron Sc.ai5(gamma)
Deposition date: 2008-07-04 Original release date: 2009-10-13
Authors: Kruschel, Daniela; Sigel, Roland
Citation: Kruschel, Daniela; Sigel, Roland. "Solution structure of the 5'-splice site of a group II intron ribozyme" Not known ., .-..
Assembly members:
RNA_(29-MER), polymer, 29 residues, Formula weight is not available
Natural source: Common Name: baker Taxonomy ID: 4932 Superkingdom: not available Kingdom: not available Genus/species: Eukaryota Fungi
Experimental source: Production method: in vitro transcription Host organism: Saccharomyces cerevisiae
Entity Sequences (FASTA):
RNA_(29-MER): GGAGUAUGUAUUGGCACUGA
GCAUACUCC
- assigned_chemical_shifts
Data type | Count |
13C chemical shifts | 77 |
15N chemical shifts | 10 |
1H chemical shifts | 221 |
Additional metadata:
Assembly:
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | RNA (29-MER) | 1 |
Entities:
Entity 1, RNA (29-MER) 29 residues - Formula weight is not available
1 | G | G | A | G | U | A | U | G | U | A | ||||
2 | U | U | G | G | C | A | C | U | G | A | ||||
3 | G | C | A | U | A | C | U | C | C |
Samples:
sample_1: RNA (29-MER) 0.4-1.2 mM; potassium chloride 10 mM; EDTA 10 uM; MgCl2 0-7 mM; D2O, [U-100% 2H], 100%
sample_2: RNA (29-MER) 0.4-1.2 mM; potassium chloride 10 mM; EDTA 10 uM; MgCl2 0-8 mM; H2O 90%; D2O, [U-100% 2H], 10%
sample_3: RNA (29-MER), [selectively deuterated at 3, ; 2, potassium chloride, ; 3, EDTA, ; 4, D2O, ;
sample_4: RNA (29-MER), [U-100% 13C; U-100% 15N], 0.7 mM; potassium chloride 10 mM; EDTA 10 uM; H2O 90%; D2O, [U-100% 2H], 10%
sample_5: RNA (29-MER), [U-100% 13C; U-100% 15N], 0.7 mM; potassium chloride 10 mM; EDTA 10 uM; Pf1 phage 25.6 mg/ml; H2O 90%; D2O, [U-100% 2H], 10%
sample_6: RNA (29-MER), [U-100% 13C; U-100% 15N], 1.0 mM; potassium chloride 10 mM; EDTA 10 uM; H2O 90%; D2O, [U-100% 2H], 10%
sample_conditions_1: ionic strength: 13.5 mM; pD: 6.8; pressure: 1 atm; temperature: 293 K
sample_conditions_6: ionic strength: 13.5 mM; pD: 6.8; pressure: 1 atm; temperature: 298 K
sample_conditions_7: ionic strength: 13.5 mM; pD: 6.8; pressure: 1 atm; temperature: 303 K
sample_conditions_2: ionic strength: 14 mM; pD: 6.65; pressure: 1 atm; temperature: 278 K
sample_conditions_8: ionic strength: 14 mM; pD: 6.65; pressure: 1 atm; temperature: 283 K
sample_conditions_9: ionic strength: 14 mM; pD: 6.65; pressure: 1 atm; temperature: 293 K
sample_conditions_3: ionic strength: 10 mM; pD: 6.7; pressure: 1 atm; temperature: 293 K
sample_conditions_10: ionic strength: 10 mM; pD: 6.7; pressure: 1 atm; temperature: 298 K
sample_conditions_11: ionic strength: 10 mM; pD: 6.7; pressure: 1 atm; temperature: 303 K
sample_conditions_4: ionic strength: 10 mM; pH: 6.8; pressure: 1 atm; temperature: 298 K
sample_conditions_5: ionic strength: 10 mM; pH: 6.8; pressure: 1 atm; temperature: 278 K
Experiments:
Name | Sample | Sample state | Sample conditions |
---|---|---|---|
2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
2D 1H-1H TOCSY | sample_1 | isotropic | sample_conditions_1 |
2D 1H-1H NOESY | sample_2 | isotropic | sample_conditions_2 |
2D 1H-1H NOESY | sample_3 | isotropic | sample_conditions_3 |
2D 1H-13C HSQC | sample_4 | isotropic | sample_conditions_4 |
2D 1H-15N HSQC | sample_4 | isotropic | sample_conditions_5 |
2D 1H-13C HSQC | sample_5 | anisotropic | sample_conditions_4 |
2D 1H-15N HSQC | sample_5 | anisotropic | sample_conditions_5 |
2D JNN HNN-COSY | sample_6 | isotropic | sample_conditions_5 |
Software:
TOPSPIN v1.3, 2.0, 2.1, Bruker Biospin - processing
SPARKY v3.1, Goddard - chemical shift assignment, data analysis, peak picking
DYANA v1.5, Guntert, Braun and Wuthrich - structure solution
CNSSOLVE v1.2, Brunger, Adams, Clore, Gros, Nilges and Read - structure solution
X-PLOR NIH v2.16, Schwieters, Kuszewski, Tjandra and Clore - refinement
NMR spectrometers:
- Bruker Avance 700 MHz