BMRB Entry 16485
Click here to enlarge.
PDB ID: 2ko0
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_anomalous, AVS_full, LACS
BMRB Entry DOI: doi:10.13018/BMR16485
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Solution structure of the THAP zinc finger of THAP1 in complex with its DNA target PubMed: 20144952
Deposition date: 2009-09-08 Original release date: 2010-02-17
Authors: Campagne, Sebastien; Gervais, Virginie; Saurel, Olivier; Milon, Alain
Citation: Campagne, Sebastien; Saurel, Olivier; Gervais, Virginie; Milon, Alain. "Structural determinants of specific DNA-recognition by the THAP zinc finger." Nucleic Acids Res. 38, 3466-3476 (2010).
Assembly members:
THAP_domain, polymer, 87 residues, Formula weight is not available
RRM1, polymer, 32 residues, Formula weight is not available
ZN, non-polymer, 65.409 Da.
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: recombinant technology Host organism: Escherichia coli
Entity Sequences (FASTA):
THAP_domain: MVQSCSAYGCKNRYDKDKPV
SFHKFPLTRPSLCKEWEAAV
RRKNFKPTKYSSICSEHFTP
DSFKRESNNKLLKENAVPTI
FLELVPR
RRM1: GCTTGTGTGGGCAGCGCGCT
GCCCACACAAGC
- assigned_chemical_shifts
- RDCs
- assigned_chemical_shifts
- heteronucl_NOEs
- heteronucl_T1_relaxation
- heteronucl_T2_relaxation
| Data type | Count |
| 13C chemical shifts | 351 |
| 15N chemical shifts | 84 |
| 1H chemical shifts | 892 |
| T1 relaxation values | 73 |
| T2 relaxation values | 73 |
| heteronuclear NOE values | 73 |
| residual dipolar couplings | 53 |
Additional metadata:
Download simulated HSQC data in one of the following formats:
CSV: Backbone
or all simulated shifts
SPARKY: Backbone
or all simulated shifts