BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 17397

Title: Solution structure of all parallel G-quadruplex formed by the oncogene RET promoter sequence   PubMed: 21540209

Deposition date: 2011-01-06 Original release date: 2011-05-12

Authors: Tong, Xiaotian; Cao, Chunyang

Citation: Tong, Xiaotian; Lan, Wenxian; Zhang, Xu; Wu, Houming; Liu, Maili; Cao, Chunyang. "Solution structure of all parallel G-quadruplex formed by the oncogene RET promoter sequence."  Nucleic Acids Res. 39, 6753-6763 (2011).

Assembly members:
RET_oncogene, polymer, 20 residues, Formula weight is not available

Natural source:   Common Name: not available   Taxonomy ID: not available   Superkingdom: not available   Kingdom: not available   Genus/species: not available not available

Experimental source:   Production method: chemical synthesis   Host organism: Escherichia coli

Entity Sequences (FASTA):
RET_oncogene: GGGGCGGGGCGGGGCGGGGT

Data sets:
Data typeCount
1H chemical shifts209

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1RET_oncogene1

Entities:

Entity 1, RET_oncogene 20 residues - Formula weight is not available

1   DGDGDGDGDCDGDGDGDGDC
2   DGDGDGDGDCDGDGDGDGDT

Samples:

sample_1: RET_oncogene0.2 – 3 mM; potassium phosphate0.2 – 0.3 mM; H2O 90%; D2O 10%

sample_2: RET_oncogene0.2 – 3 mM; potassium phosphate0.2 – 0.3 mM; D2O 100%

sample_conditions_1: ionic strength: 0.1 M; pH: 6.8; pressure: 1 atm; temperature: 298 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H NOESYsample_1isotropicsample_conditions_1
2D 1H-1H TOCSYsample_2isotropicsample_conditions_1
2D 1H-13C HSQCsample_2isotropicsample_conditions_1
2D DQF-COSYsample_2isotropicsample_conditions_1

Software:

X-PLOR NIH v2.17, Schwieters, Kuszewski, Tjandra and Clore - structure solution

NMRPipe, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax - processing

SPARKY, Goddard - data analysis

NMR spectrometers:

  • Varian INOVA 600 MHz