BMRB Entry 18035
Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR18035
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: UNAC Tetraloops: To What Extent Can They Mimic GNRA Tetraloops PubMed: 22605553
Deposition date: 2011-11-01 Original release date: 2012-05-22
Authors: Zhao, Q.; Huang, H.; Nagaswamy, U.; Xia, Y.; Gao, X.; Fox, George
Citation: Zhao, Qin; Huang, Hung-Chung; Nagaswamy, Uma; Xia, Youlin; Gao, Xiaolian; Fox, George. "UNAC tetraloops: to what extent do they mimic GNRA tetraloops?" Biopolymers 97, 617-628 (2012).
Assembly members:
UGAC, polymer, 22 residues, 7132.18842 Da.
Natural source: Common Name: Haloarcula marismortui Taxonomy ID: 2238 Superkingdom: Archaea Kingdom: not available Genus/species: Haloarcula marismortui
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
UGAC: GGACCCGGCUGACGCUGGGU
CC
- assigned_chemical_shifts
Data type | Count |
1H chemical shifts | 88 |
Additional metadata:
Assembly:
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | UGAC | 1 |
Entities:
Entity 1, UGAC 22 residues - 7132.18842 Da.
1 | G | G | A | C | C | C | G | G | C | U | ||||
2 | G | A | C | G | C | U | G | G | G | U | ||||
3 | C | C |
Samples:
sample_1: UGAC, [U-13C; U-15N], 0.3 mM; D2O 99.96%
sample_conditions_1: pH: 7.000; pressure: 1 atm; temperature: 298.000 K
Experiments:
Name | Sample | Sample state | Sample conditions |
---|---|---|---|
experiment_1 | sample_1 | solution | sample_conditions_1 |
Software:
AutoDep v4.3, AutoDep - chemical shift assignment
CNS vany, BRUNGER,ADAMS,CLORE,DELANO,GROS,GROSSE- - chemical shift assignment
NMR spectrometers:
- Bruker Avance 600 MHz
Related Database Links:
PDB |