BMRB Entry 18209
Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR18209
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Solution-state structure of an intramolecular G-quadruplex w th propeller, diagonal and edgewise loops PubMed: 22532609
Deposition date: 2012-01-23 Original release date: 2012-05-08
Authors: Marusic, Maja; Sket, Primoz; Bauer, Lubos; Viglasky, Viktor; Plavec, Janez
Citation: Marusic, Maja; Sket, Primoz; Bauer, Lubos; Viglasky, Viktor; Plavec, Janez. "Solution-state structure of an intramolecular G-quadruplex with propeller, diagonal and edgewise loops." Nucleic Acids Res. 40, 6946-6956 (2012).
Assembly members:
DNA_molecule_G3ATG3ACACAG4ACG3, polymer, 22 residues, 6972.544 Da.
Natural source: Common Name: not available Taxonomy ID: not available Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
DNA_molecule_G3ATG3ACACAG4ACG3: GGGATGGGACACAGGGGACG
GG
- assigned_chemical_shifts
| Data type | Count |
| 1H chemical shifts | 153 |
Additional metadata:
Assembly:
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | DNA_molecule_G3ATG3ACACAG4ACG3 | 1 |
Entities:
Entity 1, DNA_molecule_G3ATG3ACACAG4ACG3 22 residues - 6972.544 Da.
| 1 | DG | DG | DG | DA | DT | DG | DG | DG | DA | DC | ||||
| 2 | DA | DC | DA | DG | DG | DG | DG | DA | DC | DG | ||||
| 3 | DG | DG |
Samples:
sample_1: potassium phosphate 10 mM; potassium chloride 40 mM; H2O 90%; D2O 10%; DNA_molecule_G3ATG3ACACAG4ACG3 1.7 mM
sample_2: potassium phosphate 10 mM; potassium chloride 40 mM; D2O 100%; DNA_molecule_G3ATG3ACACAG4ACG3 2.3 mM
sample_conditions_1: ionic strength: 50 mM; pH: 6.8; pressure: 1 atm; temperature: 273 K
Experiments:
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_2 | isotropic | sample_conditions_1 |
| 2D DQF-COSY | sample_2 | isotropic | sample_conditions_1 |
Software:
VNMRJ, Varian - processing
NMRPipe, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax - processing
SPARKY, Goddard - chemical shift assignment, peak picking
AMBER v9, Case, Darden, Cheatham, III, Simmerling, Wang, Duke, Luo, ... and Kollm - refinement, structure solution
NMR spectrometers:
- Varian Uniform NMR System 800 MHz