BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 19081

Title: NMR structure of the P4 hairpin of the CPEB3 ribozyme   PubMed: 24652468

Deposition date: 2013-03-08 Original release date: 2014-03-31

Authors: Skilandat, Miriam; Rowinska-Zyrek, Magdalena; Sigel, Roland

Citation: Skilandat, Miriam; Rowinska-Zyrek, Magdalena; Sigel, Roland. "Solution structure and metal ion binding sites of the human CPEB3 ribozyme's P4 domain."  J. Biol. Inorg. Chem. ., .-. (2014).

Assembly members:
P4_CPEB3, polymer, 22 residues, 7051.259 Da.

Natural source:   Common Name: Human   Taxonomy ID: 9606   Superkingdom: Eukaryota   Kingdom: Metazoa   Genus/species: Homo sapiens

Experimental source:   Production method: cell free synthesis

Entity Sequences (FASTA):
P4_CPEB3: GGCAGAUUCUGGUGAAUCUG CC

Data sets:
Data typeCount
1H chemical shifts179

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1P4_CPEB31

Entities:

Entity 1, P4_CPEB3 22 residues - 7051.259 Da.

sequence corresponds to residue 39 to 56 of the CPEB3 ribozyme

1   GGCAGAUUCU
2   GGUGAAUCUG
3   CC

Samples:

sample_1: D2O 100%; P4_CPEB30.7 – 0.8 mM; KCl 50 mM; EDTA 10 uM

sample_2: D2O 10%; P4_CPEB30.7 – 0.8 mM; H2O 90%; KCl 50 mM; EDTA 10 uM

sample_conditions_1: ionic strength: 50 mM; pH: 6.8; pressure: 1 atm; temperature: 298 K

sample_conditions_2: ionic strength: 50 mM; pH: 6.8; pressure: 1 atm; temperature: 278 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H NOESYsample_2isotropicsample_conditions_1
2D 1H-1H NOESYsample_2isotropicsample_conditions_1
2D 1H-1H TOCSYsample_2isotropicsample_conditions_1
2D 1H-1H NOESYsample_1isotropicsample_conditions_2
2D 1H-1H NOESYsample_1isotropicsample_conditions_2
1D 31Psample_2isotropicsample_conditions_1

Software:

TOPSPIN v3.0 -

NMR spectrometers:

  • Bruker Avance 700 MHz
  • Bruker Avance 600 MHz
  • Bruker Avance 500 MHz