BMRB Entry 19159
Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR19159
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Solution NMR structure of the d(GGGGTTGGGGTTTTGGGGAAGGGG) quadruplex in sodium conditions PubMed: 23791747
Deposition date: 2013-04-10 Original release date: 2014-04-16
Authors: Karsisiotis, Andreas Ioannis; Webba da Silva, Mateus
Citation: Karsisiotis, Andreas Ioannis; Webba da Silva, Christopher. "DNA quadruplex folding formalism--a tutorial on quadruplex topologies." Methods 64, 28-35 (2013).
Assembly members:
DNA_(5'-D(*GP*GP*GP*GP*TP*TP*GP*GP*GP*GP*TP*TP*TP*TP*GP*GP*GP*GP*AP*AP*GP*GP*GP*G)-3'), polymer, 24 residues, 7673.969 Da.
Natural source: Common Name: not available Taxonomy ID: not available Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: obtained from a vendor
Entity Sequences (FASTA):
DNA_(5'-D(*GP*GP*GP*GP*TP*TP*GP*GP*GP*GP*TP*TP*TP*TP*GP*GP*GP*GP*AP*AP*GP*GP*GP*G)-3'): GGGGTTGGGGTTTTGGGGAA
GGGG
| Data type | Count |
| 1H chemical shifts | 428 |
| 31P chemical shifts | 22 |