BMRB Entry 19277
Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR19277
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Structure of d[GGTTGGCGCGAAGCATTCGCGGGTTGG] duplex-quadruplex hybrid PubMed: 23794476
Deposition date: 2013-05-30 Original release date: 2013-07-08
Authors: Lim, Kah Wai; Phan, Anh Tuan
Citation: Lim, Kah Wai; Phan, Anh Tuan. "Structural basis of DNA quadruplex-duplex junction formation." Angew. Chem. Int. Ed. Engl. 52, 8566-8569 (2013).
Assembly members:
DNA_(27-MER), polymer, 27 residues, 8445.473 Da.
Natural source: Common Name: not available Taxonomy ID: not available Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
DNA_(27-MER): GGTTGGCGCGAAGCATTCGC
GGGTTGG
- assigned_chemical_shifts
| Data type | Count |
| 1H chemical shifts | 240 |
Additional metadata:
Assembly:
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | DNA (27-MER) | 1 |
Entities:
Entity 1, DNA (27-MER) 27 residues - 8445.473 Da.
| 1 | DG | DG | DT | DT | DG | DG | DC | DG | DC | DG | ||||
| 2 | DA | DA | DG | DC | DA | DT | DT | DC | DG | DC | ||||
| 3 | DG | DG | DG | DT | DT | DG | DG |
Samples:
DNA-1: DNA (27-MER) 0.5-2.0 mM; H2O 90%; D2O 10%
DNA-2: DNA (27-MER) 0.5-2.0 mM; D2O 100%
DNA-3: DNA (27-MER), [U-2% 15N], 0.5-2.0 mM; H2O 90%; D2O 10%
DNA-4: DNA (27-MER), [U-100% 2H], 0.5-2.0 mM; D2O 100%
sample_conditions_1: ionic strength: 40 mM; pH: 7; pressure: 1 atm; temperature: 298 K
sample_conditions_2: ionic strength: 40 mM; pH: 7; pressure: 1 atm; temperature: 278 K
Experiments:
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-1H NOESY | DNA-2 | isotropic | sample_conditions_1 |
| 2D 1H-1H JR NOESY | DNA-1 | isotropic | sample_conditions_1 |
| 2D 1H-1H JR NOESY | DNA-1 | isotropic | sample_conditions_2 |
| 2D 1H-1H COSY | DNA-2 | isotropic | sample_conditions_1 |
| 2D 1H-1H TOCSY | DNA-2 | isotropic | sample_conditions_1 |
| 2D 1H-13C HSQC | DNA-2 | isotropic | sample_conditions_1 |
| 2D 1H-13C JR HMBC | DNA-1 | isotropic | sample_conditions_1 |
| 2D 1H-31P HSQC | DNA-2 | isotropic | sample_conditions_1 |
| H-D EXCHANGE | DNA-2 | isotropic | sample_conditions_1 |
| 15N-FILTERED | DNA-3 | isotropic | sample_conditions_1 |
| D-LABELED | DNA-4 | isotropic | sample_conditions_1 |
Software:
TOPSPIN v2.1, Bruker Biospin - processing
FELIX v2007, Felix NMR, Inc. - peak picking
X-PLOR NIH v2.29, Schwieters, Kuszewski, Tjandra and Clore - refinement
NMR spectrometers:
- Bruker Avance 400 MHz
- Bruker Avance 600 MHz
- Bruker Avance 700 MHz