BMRB Entry 19540
Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full, LACS
BMRB Entry DOI: doi:10.13018/BMR19540
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: haddock model of MyT1 F4F5 - DNA complex PubMed: 24097990
Deposition date: 2013-10-08 Original release date: 2013-11-04
Authors: Gamsjaeger, Roland; O'Connell, Mitchell; Cubeddu, Liza; Shepherd, Nicholas; Lowry, Jason; Kwan, Ann; Vandevenne, Marylene; Swanton, Michael; Matthews, Jacqueline; Mackay, Joel
Citation: Gamsjaeger, Roland; Cubeddu, Mitchell; Shepherd, Liza; Lowry, Nicholas; Kwan, Jason; Vandevenne, Ann; Swanton, Marylene; Matthews, Michael; Mackay, Jacqueline. "A structural analysis of DNA binding by myelin transcription factor 1 double zinc fingers." J. Biol. Chem. 288, 35180-35191 (2013).
Assembly members:
entity_1, polymer, 93 residues, 65.380 Da.
DNA_26_mer, polymer, 26 residues, Formula weight is not available
entity_ZN, non-polymer, 65.409 Da.
Natural source: Common Name: E. coli Taxonomy ID: 562 Superkingdom: Bacteria Kingdom: not available Genus/species: Escherichia coli
Experimental source: Production method: recombinant technology Host organism: Escherichia coli
Entity Sequences (FASTA):
entity_1: GPLGSFDIKKELLTCPTPGC
DGSGHITGNYASHRSLSGCP
LADKSLRNLMAAHSADLKCP
TPGCDGSGHITGNYASHRSL
SGCPRAKKSGLRV
DNA_26_mer: ACCGAAAGTTCACGTGAACT
TTCGGT
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 115 |
| 15N chemical shifts | 51 |
| 1H chemical shifts | 51 |
Additional metadata:
Assembly:
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | Myelin transcription factor 1 | 1 |
| 2 | DNA (26-MER) | 2 |
| 3 | ZINC ION_1 | 3 |
| 4 | ZINC ION_2 | 3 |
Entities:
Entity 1, Myelin transcription factor 1 93 residues - 65.380 Da.
| 1 | GLY | PRO | LEU | GLY | SER | PHE | ASP | ILE | LYS | LYS | ||||
| 2 | GLU | LEU | LEU | THR | CYS | PRO | THR | PRO | GLY | CYS | ||||
| 3 | ASP | GLY | SER | GLY | HIS | ILE | THR | GLY | ASN | TYR | ||||
| 4 | ALA | SER | HIS | ARG | SER | LEU | SER | GLY | CYS | PRO | ||||
| 5 | LEU | ALA | ASP | LYS | SER | LEU | ARG | ASN | LEU | MET | ||||
| 6 | ALA | ALA | HIS | SER | ALA | ASP | LEU | LYS | CYS | PRO | ||||
| 7 | THR | PRO | GLY | CYS | ASP | GLY | SER | GLY | HIS | ILE | ||||
| 8 | THR | GLY | ASN | TYR | ALA | SER | HIS | ARG | SER | LEU | ||||
| 9 | SER | GLY | CYS | PRO | ARG | ALA | LYS | LYS | SER | GLY | ||||
| 10 | LEU | ARG | VAL |
Entity 2, DNA (26-MER) 26 residues - Formula weight is not available
| 1 | DA | DC | DC | DG | DA | DA | DA | DG | DT | DT | ||||
| 2 | DC | DA | DC | DG | DT | DG | DA | DA | DC | DT | ||||
| 3 | DT | DT | DC | DG | DG | DT |
Entity 3, ZINC ION_1 - Zn - 65.409 Da.
| 1 | ZN |
Samples:
sample_1: Myelin transcription factor 1, [U-13C; U-15N], 0.2 – 1.0 mM; DNA (26-MER)0.2 – 1.0 mM; phosphate 10 mM; NaCl 50 mM; DTT 1 mM
sample_conditions_1: ionic strength: 60 mM; pH: 7.2; pressure: 1 atm; temperature: 298 K
Experiments:
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-15N HSQC | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-15N HSQC | sample_1 | isotropic | sample_conditions_1 |
| 3D CBCA(CO)NH | sample_1 | isotropic | sample_conditions_1 |
| 3D HNCACB | sample_1 | isotropic | sample_conditions_1 |
| 3D HNCO | sample_1 | isotropic | sample_conditions_1 |
| 3D HN(CA)CO | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
Software:
HADDOCK, Alexandre Bonvin - refinement
NMR spectrometers:
- Bruker Avance 600 MHz
- Bruker Avance 800 MHz
Related Database Links:
| PDB |
Download simulated HSQC data in one of the following formats:
CSV: Backbone
or all simulated shifts
SPARKY: Backbone
or all simulated shifts