BMRB Entry 25534
Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR25534
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: RNA structure determination by solid-state NMR spectroscopy PubMed: 25960310
Deposition date: 2015-03-12 Original release date: 2015-05-08
Authors: Marchanka, Alexander; Simon, Bernd; Althoff-Ospelt, Gerhard; Carlomagno, Teresa
Citation: Marchanka, Alexander; Simon, Bernd; Althoff-Ospelt, Gerhard; Carlomagno, Teresa. "RNA structure determination by solid-state NMR spectroscopy" Nat. Commun. 6, 7024-7024 (2015).
Assembly members:
26mer Box C/D RNA, polymer, 26 residues, 7450.573 Da.
Natural source: Common Name: E. coli Taxonomy ID: 562 Superkingdom: Bacteria Kingdom: not available Genus/species: Escherichia coli
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
26mer Box C/D RNA: GCUGAGCUCGAAAGAGCAAU
GAUGUC
- assigned_chemical_shifts
Data type | Count |
13C chemical shifts | 173 |
15N chemical shifts | 49 |
31P chemical shifts | 9 |
Additional metadata:
Assembly:
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | entity | 1 |
Entities:
Entity 1, entity 26 residues - 7450.573 Da.
1 | G | C | U | G | A | G | C | U | C | G | ||||
2 | A | A | A | G | A | G | C | A | A | U | ||||
3 | G | A | U | G | U | C |
Samples:
sample_1: entity, nucleotide-type-selective [U-99% 13C; U-99% 15N], 20 mg/mL; H2O 100%
sample_conditions_1: pH: 7.5; temperature: 260 K
Experiments:
Name | Sample | Sample state | Sample conditions |
---|---|---|---|
(13C,15N-TEDOR)-13C,13C PDSD | sample_1 | solid | sample_conditions_1 |
13C-31P TEDOR | sample_1 | solid | sample_conditions_1 |
CHHC | sample_1 | solid | sample_conditions_1 |
NHHC | sample_1 | solid | sample_conditions_1 |
CN-TEDOR | sample_1 | solid | sample_conditions_1 |
Software:
CNS v1.2 - data analysis
NMR spectrometers:
- Bruker Avance 700 MHz
- Bruker Avance 600 MHz