BMRB Entry 25534
Click here to enlarge.
            
                PDB ID: 
                
                
                Entry in NMR Restraints Grid
                Validation report in NRG-CING
            Chem Shift validation:  AVS_full
BMRB Entry DOI: doi:10.13018/BMR25534
MolProbity Validation Chart            
                    NMR-STAR file interactive viewer.
                    NMR-STAR v3 text file.
                    NMR-STAR v2.1 text file (deprecated)
                    XML gzip file.
                    RDF gzip file.
                    All files associated with the entry
                
Title: RNA structure determination by solid-state NMR spectroscopy PubMed: 25960310
Deposition date: 2015-03-12 Original release date: 2015-05-08
Authors: Marchanka, Alexander; Simon, Bernd; Althoff-Ospelt, Gerhard; Carlomagno, Teresa
Citation: Marchanka, Alexander; Simon, Bernd; Althoff-Ospelt, Gerhard; Carlomagno, Teresa. "RNA structure determination by solid-state NMR spectroscopy" Nat. Commun. 6, 7024-7024 (2015).
Assembly members:
26mer Box C/D RNA, polymer, 26 residues,   7450.573 Da.
Natural source: Common Name: E. coli Taxonomy ID: 562 Superkingdom: Bacteria Kingdom: not available Genus/species: Escherichia coli
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
26mer Box C/D RNA: GCUGAGCUCGAAAGAGCAAU
GAUGUC
- assigned_chemical_shifts
 
| Data type | Count | 
| 13C chemical shifts | 173 | 
| 15N chemical shifts | 49 | 
| 31P chemical shifts | 9 | 
Additional metadata:
Assembly:
| Entity Assembly ID | Entity Name | Entity ID | 
|---|---|---|
| 1 | entity | 1 | 
Entities:
Entity 1, entity 26 residues - 7450.573 Da.
| 1 | G | C | U | G | A | G | C | U | C | G | ||||
| 2 | A | A | A | G | A | G | C | A | A | U | ||||
| 3 | G | A | U | G | U | C | 
Samples:
sample_1: entity, nucleotide-type-selective [U-99% 13C; U-99% 15N], 20 mg/mL; H2O 100%
sample_conditions_1: pH: 7.5; temperature: 260 K
Experiments:
| Name | Sample | Sample state | Sample conditions | 
|---|---|---|---|
| (13C,15N-TEDOR)-13C,13C PDSD | sample_1 | solid | sample_conditions_1 | 
| 13C-31P TEDOR | sample_1 | solid | sample_conditions_1 | 
| CHHC | sample_1 | solid | sample_conditions_1 | 
| NHHC | sample_1 | solid | sample_conditions_1 | 
| CN-TEDOR | sample_1 | solid | sample_conditions_1 | 
Software:
CNS v1.2 - data analysis
NMR spectrometers:
- Bruker Avance 700 MHz
 - Bruker Avance 600 MHz