BMRB Entry 25998
Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR25998
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Solution structure of the K domain of EMCV IRES PubMed: 27525590
Deposition date: 2016-03-16 Original release date: 2016-08-08
Authors: Imai, Shunsuke; D'Souza, Victoria; Wagner, Gerhard
Citation: Imai, Shunsuke; Hellen, Christopher; D'Souza, Victoria; Wagner, Gerhard. "An accurately preorganized IRES RNA structure enables eIF4G capture for initiation of viral translation" Nat. Struct. Mol. Biol. 23, 859-864 (2016).
Assembly members:
RNA_(40-MER), polymer, 40 residues, 12798.640 Da.
Natural source: Common Name: Encephalomyocarditis virus Taxonomy ID: 12104 Superkingdom: Viruses Kingdom: not available Genus/species: Cardiovirus not available
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
RNA_(40-MER): GGGCUCGGUGCACAUGCUUU
ACAUGUGUUUAGUCGAGCCC
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 167 |
| 1H chemical shifts | 176 |
Additional metadata:
Assembly:
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | RNA (40-MER) | 1 |
Entities:
Entity 1, RNA (40-MER) 40 residues - 12798.640 Da.
| 1 | G | G | G | C | U | C | G | G | U | G | |
| 2 | C | A | C | A | U | G | C | U | U | U | |
| 3 | A | C | A | U | G | U | G | U | U | U | |
| 4 | A | G | U | C | G | A | G | C | C | C |
Samples:
sample_1: RNA (40-MER) 0.5 mM; potassium phosphate 10 mM; sodium chloride 10 mM; D2O, [U-2H], 100%
sample_2: RNA (40-MER) 0.5 mM; potassium phosphate 10 mM; sodium chloride 10 mM; H2O 90%; D2O, [U-2H], 10%
sample_3: RNA (40-MER), [U-13C; U-15N]-Ade, [U-13C; U-15N]-Cyt, 0.5 mM; potassium phosphate 10 mM; sodium chloride 10 mM; D2O, [U-2H], 100%
sample_4: RNA (40-MER), [U-13C; U-15N]-Gua, [U-13C; U-15N]-Ura, 0.5 mM; potassium phosphate 10 mM; sodium chloride 10 mM; D2O, [U-2H], 100%
sample_5: RNA (40-MER), [U-13C; U-15N]-Ade, [U-13C; U-15N]-Cyt, 0.5 mM; potassium phosphate 10 mM; sodium chloride 10 mM; H2O 90%; D2O, [U-2H], 10%
sample_6: RNA (40-MER), [U-13C; U-15N]-Gua, [U-13C; U-15N]-Ura, 0.5 mM; potassium phosphate 10 mM; sodium chloride 10 mM; H2O 90%; D2O, [U-2H], 10%
sample_conditions_1: ionic strength: 20 mM; pH: 6.5; pressure: 1 atm; temperature: 308 K
sample_conditions_2: ionic strength: 20 mM; pH: 6.5; pressure: 1 atm; temperature: 283 K
sample_conditions_3: ionic strength: 20 mM; pH: 5.5; pressure: 1 atm; temperature: 283 K
Experiments:
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_2 | isotropic | sample_conditions_2 |
| 2D 1H-1H NOESY | sample_2 | isotropic | sample_conditions_3 |
| 2D 1H-13C HSQC | sample_3 | isotropic | sample_conditions_1 |
| 3D 1H-13C NOESY | sample_3 | isotropic | sample_conditions_1 |
| 2D 1H-13C HSQC | sample_4 | isotropic | sample_conditions_1 |
| 3D 1H-13C NOESY | sample_4 | isotropic | sample_conditions_1 |
| 2D 1H-15N HSQC | sample_5 | isotropic | sample_conditions_2 |
| 2D 1H-15N HSQC | sample_5 | isotropic | sample_conditions_3 |
| 2D 1H-15N HSQC | sample_6 | isotropic | sample_conditions_2 |
| 2D 1H-15N HSQC | sample_6 | isotropic | sample_conditions_3 |
Software:
CARA, Keller and Wuthrich - chemical shift assignment
CYANA, Guntert, Mumenthaler and Wuthrich - structure solution
X-PLOR_NIH, Schwieters, Kuszewski, Tjandra and Clore - refinement
NMR spectrometers:
- Bruker Avance 800 MHz
- Bruker Avance 700 MHz