BMRB Entry 26568
Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR26568
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: The structure of the SOLE element of oskar mRNA PubMed: 26089324
Deposition date: 2015-04-28 Original release date: 2015-05-04
Authors: Simon, Bernd; Masiewicz, P.; Ephrussi, A.; Carlomagno, T.
Citation: Simon, Bernd; Masiewicz, P.; Ephrussi, A.; Carlomagno, T.. "The structure of the SOLE element of oskar mRNA" RNA 21, 1444-1453 (2015).
Assembly members:
OSKAR_MRNA, polymer, 32 residues, 10376.25762 Da.
Natural source: Common Name: fruit fly Taxonomy ID: 7227 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Drosophila melanogaster
Experimental source: Production method: recombinant technology Host organism: in vitro transcription
Entity Sequences (FASTA):
OSKAR_MRNA: GACGAUAUCGAGCAUCAAGA
GUGAAUAUCGUC
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 213 |
| 15N chemical shifts | 38 |
| 1H chemical shifts | 251 |
| 31P chemical shifts | 30 |
Additional metadata:
Assembly:
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | OSKAR MRNA | 1 |
Entities:
Entity 1, OSKAR MRNA 32 residues - 10376.25762 Da.
| 1 | G | A | C | G | A | U | A | U | C | G | ||||
| 2 | A | G | C | A | U | C | A | A | G | A | ||||
| 3 | G | U | G | A | A | U | A | U | C | G | ||||
| 4 | U | C |
Samples:
sample_1: OSKAR MRNA, [U-13C; U-15N], 0.35 ± 0.05 mM
sample_conditions_1: ionic strength: 0.0 mM; pH: 6.400; pressure: 1 atm; temperature: 308.000 K
Experiments:
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| HBCNB/HSCNB | sample_1 | solution | sample_conditions_1 |
| HCCH-COSY-TOCSY | sample_1 | solution | sample_conditions_1 |
| 3D EDITED NOESY | sample_1 | solution | sample_conditions_1 |
| HBCNB/HSCNB | sample_1 | solution | sample_conditions_1 |
| HCCH-COSY-TOCSY | sample_1 | solution | sample_conditions_1 |
| 3D 13C EDITED NOESY | sample_1 | solution | sample_conditions_1 |
| 2D NOESY | sample_1 | solution | sample_conditions_1 |
| 2D HNN-COSY | sample_1 | solution | sample_conditions_1 |
Software:
AutoDep v4.3, PDBe - chemical shift assignment
CNS v1.1, Brunger, Adams, Clore, Gros, Nilges and Read - chemical shift assignment
FELIX vany, Accelrys Software Inc. - chemical shift assignment
NMR spectrometers:
- Bruker Avance 600 MHz
- Bruker Avance 800 MHz