BMRB Entry 30051
Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR30051
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Intermediate state lying on the pathway of release of Tat from HIV-1 TAR. PubMed: 7286828
Deposition date: 2016-03-30 Original release date: 2016-06-06
Authors: Borkar, A.; Bardaro Jr., M.F.; Varani, G.; Vendrucolo, M.
Citation: Borkar, A.; Bardaro, M.; Camilloni, C.; Aprile, F.; Varani, G.; Vendrucolo, M.. "Structure of a low-population binding intermediate in protein-RNA recognition" Proc. Natl. Acad. Sci. U. S. A. 113, 7171-7176 (2016).
Assembly members:
Cyclic peptide mimetic of HIV-1 Tat, polymer, 14 residues, 1768.189 Da.
Apical region (29mer) of the HIV-1 TAR RNA element, polymer, 29 residues, 9307.555 Da.
Natural source: Common Name: HIV-1 Taxonomy ID: 11676 Superkingdom: Viruses Kingdom: not available Genus/species: Lentivirus HIV-1
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
Cyclic peptide mimetic of HIV-1 Tat: RVRTRKGRRIRIXP
Apical region (29mer) of the HIV-1 TAR RNA element: GGCAGAUCUGAGCCUGGGAG
CUCUCUGCC
- assigned_chemical_shifts
Data type | Count |
13C chemical shifts | 162 |
1H chemical shifts | 389 |
Additional metadata:
Assembly:
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | entity_1 | 1 |
2 | entity_2 | 2 |
Entities:
Entity 1, entity_1 14 residues - 1768.189 Da.
1 | ARG | VAL | ARG | THR | ARG | LYS | GLY | ARG | ARG | ILE | ||||
2 | ARG | ILE | DPR | PRO |
Entity 2, entity_2 29 residues - 9307.555 Da.
1 | G | G | C | A | G | A | U | C | U | G | ||||
2 | A | G | C | C | U | G | G | G | A | G | ||||
3 | C | U | C | U | C | U | G | C | C |
Samples:
sample_1: TAR and Tatp, [U-99% 13C; U-99% 15N], 2 uM; D2O 100%
sample_conditions_1: ionic strength: 10 mM; pH: 6.6; pressure: 1 atm; temperature: 298 K
Experiments:
Name | Sample | Sample state | Sample conditions |
---|---|---|---|
RDC | sample_1 | anisotropic | sample_conditions_1 |
Software:
Gromacs and Plumed, Vendruscolo, Camilloni, Borkar and others - structure calculation
NMR spectrometers:
- Varian INOVA 800 MHz