BMRB Entry 30533
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR30533
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Solution structure of a c-JUN 5' UTR stem-loop associated with specialized cap-dependent translation initiation
Deposition date: 2018-10-31 Original release date: 2020-05-04
Authors: Walker, M.; Shortridge, M.; Varani, G.
Citation: Walker, M.; Shortridge, M.; Albin, D.; Cominsky, L.; Varani, G.. "Solution structure of a c-JUN 5' UTR stem-loop associated with specialized cap-dependent translation initiation" . ., .-..
Assembly members:
entity_1, polymer, 49 residues, 15523.181 Da.
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: GGCAGUAUAGUCCGAACUGC
AACUUCGGUUCACCUUCUCU
CUAACUGCC
- assigned_chemical_shifts
Data type | Count |
13C chemical shifts | 332 |
15N chemical shifts | 14 |
1H chemical shifts | 419 |
Additional metadata:
Assembly:
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | entity_1 | 1 |
Entities:
Entity 1, entity_1 49 residues - 15523.181 Da.
1 | G | G | C | A | G | U | A | U | A | G | ||||
2 | U | C | C | G | A | A | C | U | G | C | ||||
3 | A | A | C | U | U | C | G | G | U | U | ||||
4 | C | A | C | C | U | U | C | U | C | U | ||||
5 | C | U | A | A | C | U | G | C | C |
Samples:
sample_1: RNA 1.0 mM; Sodium Phosphate 20 mM
sample_2: RNA 1.0 mM; Sodium Phosphate 20 mM
sample_3: RNA, [A,G-98% D3',4',5',5, 1 ± 1.0 ; ., 30533, ; ., 30533,
sample_4: RNA, [A,C,G,U-98% 13C, A,C,G,U-98% 15N], 1.0 mM; Sodium Phosphate 20 mM
sample_5: RNA, [A,C,G,U-98% 13C, A,C,G,U-98% 15N], 1.0 mM; Sodium Phosphate 20 mM
sample_conditions_1: ionic strength: 20 mM; pH: 6.1; pressure: 1 atm; temperature: 298 K
sample_conditions_2: ionic strength: 20 mM; pH: 6.1; pressure: 1 atm; temperature: 278 K
Experiments:
Name | Sample | Sample state | Sample conditions |
---|---|---|---|
2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
2D 1H-1H NOESY | sample_2 | isotropic | sample_conditions_2 |
2D 1H-1H NOESY | sample_3 | isotropic | sample_conditions_1 |
3D 1H-13C NOESY | sample_4 | isotropic | sample_conditions_1 |
2D 1H-15N HSQC | sample_5 | isotropic | sample_conditions_2 |
2D 1H-13C HSQC | sample_4 | isotropic | sample_conditions_1 |
2D 1H-1H TOCSY | sample_1 | isotropic | sample_conditions_1 |
Software:
TOPSPIN, Bruker Biospin - collection
NMRPipe, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax - processing
SPARKY, Goddard - peak picking
CcpNMR, CCPN - peak picking
X-PLOR NIH, Schwieters, Kuszewski, Tjandra and Clore - refinement, structure calculation
NMR spectrometers:
- Bruker AvanceIII 800 MHz
- Bruker AvanceII 600 MHz