BMRB Entry 34221
Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR34221
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: The 1,8-bis(aminomethyl)anthracene and Quadruplex-duplex junction complex
Deposition date: 2017-12-20 Original release date: 2019-04-03
Authors: Santana, A.; Serrano, I.; Montalvillo-Jimenez, L.; Corzana, F.; Bastida, A.; Jimenez-Barbero, J.; Gonzalez, C.; Asensio, J.
Citation: Santana, A.; Serrano, I.; Montalvillo-Jimenez, L.; Corzana, F.; Bastida, A.; Jimenez-Barbero, J.; Gonzalez, C.; Asensio, J.. "Minimalistic scaffolds for the selective recognition of Quad-ruplex-Duplex Junctions: Targeting the G4 Hot-Spot" . ., .-..
Assembly members:
entity_1, polymer, 27 residues, 8445.403 Da.
entity_D5B, non-polymer, 236.312 Da.
Natural source: Common Name: not available Taxonomy ID: 32630 Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: GGTTGGCGCGAAGCATTCGC
GGGTTGG
- assigned_chemical_shifts
| Data type | Count |
| 1H chemical shifts | 233 |
Additional metadata:
Assembly:
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | entity_1 | 1 |
| 2 | entity_2 | 2 |
Entities:
Entity 1, entity_1 27 residues - 8445.403 Da.
| 1 | DG | DG | DT | DT | DG | DG | DC | DG | DC | DG | ||||
| 2 | DA | DA | DG | DC | DA | DT | DT | DC | DG | DC | ||||
| 3 | DG | DG | DG | DT | DT | DG | DG |
Entity 2, entity_2 - C16 H16 N2 - 236.312 Da.
| 1 | D5B |
Samples:
sample_1: JQ2 0.5 mM; KPi 20 mM; KCl 20 mM
sample_conditions_1: ionic strength: 40 mM; pH: 6.9; pressure: 1 atm; temperature: 278 K
sample_conditions_2: ionic strength: 40 mM; pH: 6.9; pressure: 1 atm; temperature: 293 K
Experiments:
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-1H TOCSY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_2 |
| 2D 1H-1H TOCSY | sample_1 | isotropic | sample_conditions_2 |
Software:
TOPSPIN, Bruker Biospin - collection, processing
SPARKY, Goddard - chemical shift assignment
CYANA, Guntert, Mumenthaler and Wuthrich - structure calculation
AMBER, Case, Darden, Cheatham III, Simmerling, Wang, Duke, Luo, ... and Kollman - refinement
NMR spectrometers:
- Bruker Avance 600 MHz