BMRB Entry 6062
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR6062
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Assignments for the Negative Regulator of Splicing from Rous Sarcoma Virus residues 907 to 929 PubMed: 15317975
Deposition date: 2004-01-06 Original release date: 2004-10-29
Authors: Cabello-Villegas, Javier; Guiles, Keith; Soto, Ana; Yu, Ping; Beemon, Karen; Wang, Yun-Xing
Citation: Cabello-Villegas, Javier; Giles, Keith; Soto, Ana; Yu, Ping; Mougin, A.; Beemon, Karen; Wang, Yun-Xing. "Solution structure of the pseudo-5' splice site of a retroviral splicing suppressor" RNA 10, 1388-1398 (2004).
Assembly members:
RNA stem-loop, polymer, 23 residues, Formula weight is not available
Natural source: Common Name: Rous sarcoma virus Taxonomy ID: 11886 Superkingdom: Viruses Kingdom: not available Genus/species: alpharetrovirus Rous sarcoma virus
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
RNA stem-loop: GGGGAGUGGUUUGUAUCCUU
CCC
- assigned_chemical_shifts
Data type | Count |
13C chemical shifts | 153 |
15N chemical shifts | 15 |
31P chemical shifts | 17 |
Additional metadata:
Assembly:
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | NRS23 | 1 |
Entities:
Entity 1, NRS23 23 residues - Formula weight is not available
1 | G | G | G | G | A | G | U | G | G | U | ||||
2 | U | U | G | U | A | U | C | C | U | U | ||||
3 | C | C | C |
Samples:
Sample_1: RNA stem-loop, [U-13C; U-15N], 1.2 mM; sodium phosphate buffer 10 mM; NaCl 25 mM
condition_1: pH: 6.5; temperature: 298 K
Experiments:
Name | Sample | Sample state | Sample conditions |
---|---|---|---|
1H-13C NOESY-HSQC | not available | not available | not available |
2D NOESY | not available | not available | not available |
15N/1H HMQC | not available | not available | not available |
HCCH-TOCSY | not available | not available | not available |
HCCH-COSY | not available | not available | not available |
HNCCCH | not available | not available | not available |
HCP | not available | not available | not available |
Software:
NMRDraw - Spectra analysis
NMRView - Spectra analysis
NMRPipe - Spectra processing
NMR spectrometers:
- Varian INOVA 800 MHz
- Varian INOVA 600 MHz
- Varian INOVA 500 MHz
- Bruker DRX 500 MHz