BMRB Entry 18633
Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR18633
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: solution structure of small molecule-influenza RNA complex, Seattle Structural Genomics Center for Infectious Disease (SSGCID) PubMed: 24247110
Deposition date: 2012-08-01 Original release date: 2013-02-14
Authors: Lee, M.; Varani, G.; Choi, B.; Pellecchia, M.
Citation: Lee, Mi-Kyung; Bottini, Angel; Kim, Meehyein; Bardaro, Michael; Zhang, Ziming; Pellecchia, Maurizio; Choi, Byong-Seok; Varani, Gabriele. "A novel small-molecule binds to the influenza A virus RNA promoter and inhibits viral replication." Chem. Commun. (Camb.) 50, 368-370 (2014).
Assembly members:
influenza_A_virus_RNA_promoter, polymer, 32 residues, 10258.172 Da.
6,7-dimethoxy-2-(piperazin-1-yl)quinazolin-4-amine, non-polymer, 289.333 Da.
Natural source: Common Name: influenza A virus Taxonomy ID: 11320 Superkingdom: not available Kingdom: Viruses Genus/species: not available Influenzavirus A
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
influenza_A_virus_RNA_promoter: GAGUAGAAACAAGGCUUCGG
CCUGCUUUUGCU
- assigned_chemical_shifts
Data type | Count |
1H chemical shifts | 186 |
Additional metadata:
Assembly:
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | influenza A virus RNA promoter | 1 |
2 | 6,7-dimethoxy-2-(piperazin-1-yl)quinazolin-4-amine | 2 |
Entities:
Entity 1, influenza A virus RNA promoter 32 residues - 10258.172 Da.
1 | G | A | G | U | A | G | A | A | A | C | ||||
2 | A | A | G | G | C | U | U | C | G | G | ||||
3 | C | C | U | G | C | U | U | U | U | G | ||||
4 | C | U |
Entity 2, 6,7-dimethoxy-2-(piperazin-1-yl)quinazolin-4-amine - C14 H19 N5 O2 - 289.333 Da.
1 | 0EC |
Samples:
sample_1: influenza A virus RNA promoter 1 mM; sodium chloride 50 mM; phosphate buffer 20 mM; D2O 10%; H2O 90%
sample_2: influenza A virus RNA promoter 1 mM; sodium chloride 50 mM; phosphate buffer 20 mM; D2O 100%
sample_conditions_1: ionic strength: 50 mM; pH: 6.0; pressure: 1 atm; temperature: 283 K
Experiments:
Name | Sample | Sample state | Sample conditions |
---|---|---|---|
H2O NOESY | sample_1 | isotropic | sample_conditions_1 |
D2O NOESY | sample_2 | isotropic | sample_conditions_1 |
Software:
X-PLOR NIH, Brunger - refinement
NMR spectrometers:
- Bruker DRX 500 MHz
- Bruker DRX 600 MHz