BMRB Entry 5243
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR5243
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Solution Structure of the 17mer TF1 Binding Site PubMed: 11955617
Deposition date: 2001-12-21 Original release date: 2002-06-13
Authors: Liu, W.; Vu, H.; Kearns, D.
Citation: Liu, W.; Vu, H.; Kearns, D.. "1H NMR Study of a 17-mer DNA Duplex" Biochim. Biophys. Acta 1574, 93-99 (2002).
Assembly members:
17mer TF1 Binding Site, polymer, 34 residues, Formula weight is not available
Natural source: Common Name: Bacillus subtilis Taxonomy ID: 1423 Superkingdom: Eubacteria Kingdom: not available Genus/species: Bacillus subtilis
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
17mer TF1 Binding Site: CACTACTCTTTGTAGTGCAC
TACAAAGAGTAGTG
- assigned_chemical_shifts
| Data type | Count |
| 1H chemical shifts | 363 |
Additional metadata:
Assembly:
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | 17mer TF1 Binding Site | 1 |
Entities:
Entity 1, 17mer TF1 Binding Site 34 residues - Formula weight is not available
| 1 | DC | DA | DC | DT | DA | DC | DT | DC | DT | DT | ||||
| 2 | DT | DG | DT | DA | DG | DT | DG | DC | DA | DC | ||||
| 3 | DT | DA | DC | DA | DA | DA | DG | DA | DG | DT | ||||
| 4 | DA | DG | DT | DG |
Samples:
sample_1: 17mer TF1 Binding Site 2 mM; phosphate buffer 100 mM; H2O 90%; D2O 10%
sample_cond_1: ionic strength: 0.1 M; pH: 7.0; pressure: 1 atm; temperature: 298 K
Experiments:
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D NOESY | sample_1 | not available | sample_cond_1 |
| DQF-COSY | sample_1 | not available | sample_cond_1 |
| 2D TOCSY | sample_1 | not available | sample_cond_1 |
Software:
DISCOVER v3.1 - refinement
NMR spectrometers:
- Bruker DRX 600 MHz