BMRB Entry 5655
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR5655
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: U80G U6 ISL RNA Chemical Shifts PubMed: 12578359
Deposition date: 2002-12-05 Original release date: 2009-06-02
Authors: Sashital, Dipali; Allmann, Anne; Van Doren, Steve; Butcher, Samuel
Citation: Sashital, D.; Allmann, A.; Van Doren, S.; Butcher, S.. "Structural basis for a lethal mutation in U6 RNA" Biochemistry 42, 1470-1477 (2003).
Assembly members:
U6 ISL RNA, polymer, 24 residues, Formula weight is not available
Natural source: Common Name: Baker Taxonomy ID: 4932 Superkingdom: not available Kingdom: not available Genus/species: Eukaryota Fungi
Experimental source: Production method: recombinant technology
Entity Sequences (FASTA):
U6 ISL RNA: GGUUCCCCUGCAUAAGGAGG
AACC
- assigned_chemical_shifts
Data type | Count |
13C chemical shifts | 138 |
15N chemical shifts | 15 |
1H chemical shifts | 203 |
Additional metadata:
Assembly:
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | U80G U6 ISL RNA | 1 |
Entities:
Entity 1, U80G U6 ISL RNA 24 residues - Formula weight is not available
1 | G | G | U | U | C | C | C | C | U | G | ||||
2 | C | A | U | A | A | G | G | A | G | G | ||||
3 | A | A | C | C |
Samples:
sample_1: U6 ISL RNA, [U-13C; U-15N], 1.5 mM
cond_1: pH: 6.5; temperature: 303 K
Experiments:
Name | Sample | Sample state | Sample conditions |
---|---|---|---|
not available | sample_1 | not available | cond_1 |
Software:
CNS v1.1 -
NMR spectrometers:
- Bruker DMX 400 MHz
- Bruker DMX 500 MHz
- Bruker DMX 600 MHz
- Bruker DMX 750 MHz