BMRB Entry 6042

Name: NMR structure of the 30mer stemloop-D of coxsackieviral RNA
Published: 2004-11-30

Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR6042

NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry

Nicholas Rego and David Koes
3Dmol.js: molecular visualization with WebGL
Bioinformatics (2015) 31 (8): 1322-1324 doi:10.1093/bioinformatics/btu829

Select model:

I am color blind

Download raw data. Direct link to this display. Help

Title: NMR structure of the 30mer stemloop-D of coxsackieviral RNA PubMed: 14962384

Deposition date: 2003-12-11 Original release date: 2004-11-30

Authors: Ohlenschlager, O.; Wohnert, J.; Bucci, E.; Seitz, S.; Hafner, S.; Ramachandran, R.; Zell, R.; Gorlach, M.

Citation: Ohlenschlager, O.; Wohnert, J.; Bucci, E.; Seitz, S.; Hafner, S.; Ramachandran, R.; Zell, R.; Gorlach, M.. "The Structure of the Stemloop D Subdomain of Coxsackievirus B3 Cloverleaf RNA and its Interaction with the Proteinase 3C" Stucture 12, 237-248 (2004).

Assembly members:
SLD-RNA, polymer, 30 residues, Formula weight is not available

Natural source: Common Name: COXSACKIEVIRUS B3 Taxonomy ID: 12072 Superkingdom: Viruses Kingdom: not available Genus/species: Enterovirus Human enterovirus B

Experimental source: Production method: recombinant technology

Entity Sequences (FASTA):
SLD-RNA: GGCACUCUGGUAUCACGGUA CCUUUGUGUC

Data sets:

assigned_chemical_shifts
coupling_constants

Data type	Count
coupling constants	14

Additional metadata:

Assembly
Samples and Experiments
Software
Spectrometers
Hide all

Assembly:

Entity Assembly ID	Entity Name	Entity ID
1	SLD-RNA	1

Entities:

Entity 1, SLD-RNA 30 residues - Formula weight is not available

1	G	G	C	A	C	U	C	U	G	G
2	U	A	U	C	A	C	G	G	U	A
3	C	C	U	U	U	G	U	G	U	C

Samples:

sample_1: SLD-RNA, [U-13C; U-15N], 0.9 mM; KH2PO4/K2HPO4 10 mM; KCl 40 mM; EDTA 0.2 mM; H2O 95%; D2O 5%

sample_2: SLD-RNA, [U-13C; U-15N], 0.9 mM; KH2PO4/K2HPO4 10 mM; KCl 40 mM; EDTA 0.2 mM; D2O 99.99%

sample_3: SLD-RNA, [U-13C; U-15N]-G, C, 1.2 mM; KH2PO4/K2HPO4 10 mM; KCl 40 mM; EDTA 0.2 mM; H2O 95%; D2O 5%

sample_4: SLD-RNA, [U-13C; U-15N]-G, C, 1.2 mM; KH2PO4/K2HPO4 10 mM; KCl 40 mM; EDTA 0.2 mM; D2O 99.99%

sample_5: SLD-RNA, [U-13C; U-15N]-A, U, 1.2 mM; KH2PO4/K2HPO4 10 mM; KCl 40 mM; EDTA 0.2 mM; H2O 95%; D2O 5%

sample_6: SLD-RNA, [U-13C; U-15N]-A, U, 1.2 mM; KH2PO4/K2HPO4 10 mM; KCl 40 mM; EDTA 0.2 mM; D2O 99.99%

sample_7: SLD-RNA, [U-15N], 1.4 mM; KH2PO4/K2HPO4 10 mM; KCl 40 mM; EDTA 0.2 mM; H2O 95%; D2O 5%

sample_8: SLD-RNA, [U-15N], 1.2 mM; KH2PO4/K2HPO4 10 mM; KCl 40 mM; EDTA 0.2 mM; D2O 99.99%

sample_cond_1: ionic strength: 50 mM; pH: 6.2; pressure: 1 atm; temperature: 298 K

sample_cond_2: ionic strength: 50 mM; pH: 6.2; pressure: 1 atm; temperature: 283 K

Experiments:

Name	Sample	Sample state	Sample conditions
not available	not available	not available	not available

Software:

VNMR v6.1, rev. c - collection, processing

XEASY v1.3.9 - data analysis

FOUND vimplemented in CYANA-1.0.6 - structure solution

CYANA v1.0.6 - structure solution

OPAL v2.6 - refinement

NMR spectrometers:

Varian INOVA 750 MHz