data_30056 ####################### # Entry information # ####################### save_entry_information _Entry.Sf_category entry_information _Entry.Sf_framecode entry_information _Entry.ID 30056 _Entry.Title ; DIY G-Quadruplexes: Solution structure of d(GGTTTGGTTTTGGTTGG) in sodium ; _Entry.Type macromolecule _Entry.Version_type original _Entry.Submission_date 2016-04-01 _Entry.Accession_date 2016-04-01 _Entry.Last_release_date 2016-04-04 _Entry.Original_release_date 2016-04-04 _Entry.Origination author _Entry.Format_name . _Entry.NMR_STAR_version 3.2.1.32 _Entry.NMR_STAR_dict_location . _Entry.Original_NMR_STAR_version 3.1.2.6 _Entry.Experimental_method NMR _Entry.Experimental_method_subtype SOLUTION _Entry.Source_data_format . _Entry.Source_data_format_version . _Entry.Generated_software_name . _Entry.Generated_software_version . _Entry.Generated_software_ID . _Entry.Generated_software_label . _Entry.Generated_date . _Entry.DOI . _Entry.UUID . _Entry.Related_coordinate_file_name . _Entry.Details . _Entry.BMRB_internal_directory_name . loop_ _Entry_author.Ordinal _Entry_author.Given_name _Entry_author.Family_name _Entry_author.First_initial _Entry_author.Middle_initials _Entry_author.Family_title _Entry_author.ORCID _Entry_author.Entry_ID 1 S. Dvorkin S. A. . . 30056 2 M. 'Webba da Silva' . . . . 30056 stop_ loop_ _Struct_keywords.Keywords _Struct_keywords.Text _Struct_keywords.Entry_ID DNA . 30056 'Structure from MOLMOL' . 30056 'Structure from programmed design' . 30056 stop_ loop_ _Data_set.Type _Data_set.Count _Data_set.Entry_ID assigned_chemical_shifts 1 30056 stop_ loop_ _Datum.Type _Datum.Count _Datum.Entry_ID '1H chemical shifts' 161 30056 stop_ loop_ _Release.Release_number _Release.Format_type _Release.Format_version _Release.Date _Release.Submission_date _Release.Type _Release.Author _Release.Detail _Release.Entry_ID 2 . . 2019-07-19 2016-04-01 update BMRB 'update entry citation' 30056 1 . . 2017-04-06 2016-04-01 original author 'original release' 30056 stop_ loop_ _Related_entries.Database_name _Related_entries.Database_accession_code _Related_entries.Relationship _Related_entries.Entry_ID BMRB 30045 'DIY G-Quadruplexes: d(GGGTTTGGGTTTTGGGAGGG)' 30056 BMRB 30055 'DIY G-Quadruplexes: d(GGTTTGGTTTTGGTTTGG)' 30056 BMRB 30058 'DIY G-Quadruplexes: d(GGGGTTTGGGGTTTTGGGGAAGGGG)' 30056 PDB 5J4W 'BMRB Entry Tracking System' 30056 stop_ save_ ############### # Citations # ############### save_citation_1 _Citation.Sf_category citations _Citation.Sf_framecode citation_1 _Citation.Entry_ID 30056 _Citation.ID 1 _Citation.Name . _Citation.Class 'entry citation' _Citation.CAS_abstract_code . _Citation.MEDLINE_UI_code . _Citation.DOI . _Citation.PubMed_ID 30182059 _Citation.Full_citation . _Citation.Title ; Encoding canonical DNA quadruplex structure. ; _Citation.Status published _Citation.Type journal _Citation.Journal_abbrev 'Sci Adv' _Citation.Journal_name_full 'Science advances' _Citation.Journal_volume 4 _Citation.Journal_issue 8 _Citation.Journal_ASTM . _Citation.Journal_ISSN 2375-2548 _Citation.Journal_CSD 0353 _Citation.Book_title . _Citation.Book_chapter_title . _Citation.Book_volume . _Citation.Book_series . _Citation.Book_publisher . _Citation.Book_publisher_city . _Citation.Book_ISBN . _Citation.Conference_title . _Citation.Conference_site . _Citation.Conference_state_province . _Citation.Conference_country . _Citation.Conference_start_date . _Citation.Conference_end_date . _Citation.Conference_abstract_number . _Citation.Thesis_institution . _Citation.Thesis_institution_city . _Citation.Thesis_institution_country . _Citation.WWW_URL . _Citation.Page_first eaat3007 _Citation.Page_last eaat3007 _Citation.Year 2018 _Citation.Details . loop_ _Citation_author.Ordinal _Citation_author.Given_name _Citation_author.Family_name _Citation_author.First_initial _Citation_author.Middle_initials _Citation_author.Family_title _Citation_author.ORCID _Citation_author.Entry_ID _Citation_author.Citation_ID 1 Scarlett Dvorkin S. A. . . 30056 1 2 Andreas Karsisiotis A. I. . . 30056 1 3 Mateus 'Webba da Silva' M. . . . 30056 1 stop_ save_ ############################################# # Molecular system (assembly) description # ############################################# save_assembly _Assembly.Sf_category assembly _Assembly.Sf_framecode assembly _Assembly.Entry_ID 30056 _Assembly.ID 1 _Assembly.Name "DNA (5'-D(*GP*GP*TP*TP*TP*GP*GP*TP*TP*TP*TP*GP*GP*TP*TP*GP*G)-3')" _Assembly.BMRB_code . _Assembly.Number_of_components . _Assembly.Organic_ligands . _Assembly.Metal_ions . _Assembly.Non_standard_bonds . _Assembly.Ambiguous_conformational_states . _Assembly.Ambiguous_chem_comp_sites . _Assembly.Molecules_in_chemical_exchange . _Assembly.Paramagnetic no _Assembly.Thiol_state . _Assembly.Molecular_mass . _Assembly.Enzyme_commission_number . _Assembly.Details . _Assembly.DB_query_date . _Assembly.DB_query_revised_last_date . loop_ _Entity_assembly.ID _Entity_assembly.Entity_assembly_name _Entity_assembly.Entity_ID _Entity_assembly.Entity_label _Entity_assembly.Asym_ID _Entity_assembly.PDB_chain_ID _Entity_assembly.Experimental_data_reported _Entity_assembly.Physical_state _Entity_assembly.Conformational_isomer _Entity_assembly.Chemical_exchange_state _Entity_assembly.Magnetic_equivalence_group_code _Entity_assembly.Role _Entity_assembly.Details _Entity_assembly.Entry_ID _Entity_assembly.Assembly_ID 1 entity_1 1 $entity_1 A A yes . . . . . . 30056 1 stop_ save_ #################################### # Biological polymers and ligands # #################################### save_entity_1 _Entity.Sf_category entity _Entity.Sf_framecode entity_1 _Entity.Entry_ID 30056 _Entity.ID 1 _Entity.BMRB_code . _Entity.Name "DNA (5'-D(*GP*GP*TP*TP*TP*GP*GP*TP*TP*TP*TP*GP*GP*TP*TP*GP*G)-3')" _Entity.Type polymer _Entity.Polymer_common_type . _Entity.Polymer_type polydeoxyribonucleotide _Entity.Polymer_type_details . _Entity.Polymer_strand_ID A _Entity.Polymer_seq_one_letter_code_can . _Entity.Polymer_seq_one_letter_code ; GGTTTGGTTTTGGTTGG ; _Entity.Target_identifier . _Entity.Polymer_author_defined_seq . _Entity.Polymer_author_seq_details . _Entity.Ambiguous_conformational_states . _Entity.Ambiguous_chem_comp_sites . _Entity.Nstd_monomer no _Entity.Nstd_chirality . _Entity.Nstd_linkage no _Entity.Nonpolymer_comp_ID . _Entity.Nonpolymer_comp_label . _Entity.Number_of_monomers 17 _Entity.Number_of_nonpolymer_components . _Entity.Paramagnetic no _Entity.Thiol_state 'not present' _Entity.Src_method syn _Entity.Parent_entity_ID 1 _Entity.Fragment . _Entity.Mutation . _Entity.EC_number . _Entity.Calc_isoelectric_point . _Entity.Formula_weight 5326.425 _Entity.Formula_weight_exptl . _Entity.Formula_weight_exptl_meth . _Entity.Details . _Entity.DB_query_date . _Entity.DB_query_revised_last_date . loop_ _Entity_comp_index.ID _Entity_comp_index.Auth_seq_ID _Entity_comp_index.Comp_ID _Entity_comp_index.Comp_label _Entity_comp_index.Entry_ID _Entity_comp_index.Entity_ID 1 1 DG . 30056 1 2 2 DG . 30056 1 3 3 DT . 30056 1 4 4 DT . 30056 1 5 5 DT . 30056 1 6 6 DG . 30056 1 7 7 DG . 30056 1 8 8 DT . 30056 1 9 9 DT . 30056 1 10 10 DT . 30056 1 11 11 DT . 30056 1 12 12 DG . 30056 1 13 13 DG . 30056 1 14 14 DT . 30056 1 15 15 DT . 30056 1 16 16 DG . 30056 1 17 17 DG . 30056 1 stop_ loop_ _Entity_poly_seq.Hetero _Entity_poly_seq.Mon_ID _Entity_poly_seq.Num _Entity_poly_seq.Comp_index_ID _Entity_poly_seq.Entry_ID _Entity_poly_seq.Entity_ID . DG 1 1 30056 1 . DG 2 2 30056 1 . DT 3 3 30056 1 . DT 4 4 30056 1 . DT 5 5 30056 1 . DG 6 6 30056 1 . DG 7 7 30056 1 . DT 8 8 30056 1 . DT 9 9 30056 1 . DT 10 10 30056 1 . DT 11 11 30056 1 . DG 12 12 30056 1 . DG 13 13 30056 1 . DT 14 14 30056 1 . DT 15 15 30056 1 . DG 16 16 30056 1 . DG 17 17 30056 1 stop_ save_ #################### # Natural source # #################### save_natural_source _Entity_natural_src_list.Sf_category natural_source _Entity_natural_src_list.Sf_framecode natural_source _Entity_natural_src_list.Entry_ID 30056 _Entity_natural_src_list.ID 1 loop_ _Entity_natural_src.ID _Entity_natural_src.Entity_ID _Entity_natural_src.Entity_label _Entity_natural_src.Entity_chimera_segment_ID _Entity_natural_src.NCBI_taxonomy_ID _Entity_natural_src.Type _Entity_natural_src.Common _Entity_natural_src.Organism_name_scientific _Entity_natural_src.Organism_name_common _Entity_natural_src.Organism_acronym _Entity_natural_src.ICTVdb_decimal_code _Entity_natural_src.Superkingdom _Entity_natural_src.Kingdom _Entity_natural_src.Genus _Entity_natural_src.Species _Entity_natural_src.Strain _Entity_natural_src.Variant _Entity_natural_src.Organ _Entity_natural_src.Tissue _Entity_natural_src.Tissue_fraction _Entity_natural_src.Cell_line _Entity_natural_src.Cell_type _Entity_natural_src.ATCC_number _Entity_natural_src.Organelle _Entity_natural_src.Secretion _Entity_natural_src.Plasmid _Entity_natural_src.Gene_mnemonic _Entity_natural_src.Details _Entity_natural_src.Entry_ID _Entity_natural_src.Entity_natural_src_list_ID 1 1 $entity_1 . 32644 'no natural source' . unclassified . . . . . . . . . . . . . . . . . . . . 30056 1 stop_ save_ ######################### # Experimental source # ######################### save_experimental_source _Entity_experimental_src_list.Sf_category experimental_source _Entity_experimental_src_list.Sf_framecode experimental_source _Entity_experimental_src_list.Entry_ID 30056 _Entity_experimental_src_list.ID 1 loop_ _Entity_experimental_src.ID _Entity_experimental_src.Entity_ID _Entity_experimental_src.Entity_label _Entity_experimental_src.Entity_chimera_segment_ID _Entity_experimental_src.Production_method _Entity_experimental_src.Host_org_scientific_name _Entity_experimental_src.Host_org_name_common _Entity_experimental_src.Host_org_details _Entity_experimental_src.Host_org_NCBI_taxonomy_ID _Entity_experimental_src.Host_org_genus _Entity_experimental_src.Host_org_species _Entity_experimental_src.Host_org_strain _Entity_experimental_src.Host_org_variant _Entity_experimental_src.Host_org_ATCC_number _Entity_experimental_src.Vector_type _Entity_experimental_src.PDBview_host_org_vector_name _Entity_experimental_src.PDBview_plasmid_name _Entity_experimental_src.Vector_name _Entity_experimental_src.Vector_details _Entity_experimental_src.Vendor_name _Entity_experimental_src.Details _Entity_experimental_src.Entry_ID _Entity_experimental_src.Entity_experimental_src_list_ID 1 1 $entity_1 . 'chemical synthesis' . . . . . . . . . . . . . . . . 30056 1 stop_ save_ ##################################### # Sample contents and methodology # ##################################### ######################## # Sample description # ######################## save_sample_1 _Sample.Sf_category sample _Sample.Sf_framecode sample_1 _Sample.Entry_ID 30056 _Sample.ID 1 _Sample.Name . _Sample.Type solution _Sample.Sub_type . _Sample.Details '2 mM dna, 90% H2O/10% D2O' _Sample.Aggregate_sample_number . _Sample.Solvent_system '90% H2O/10% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 DNA 'natural abundance' . . 1 $entity_1 . . 2 . . mM 0.5 . . . 30056 1 2 NaPi 'natural abundance' . . . . . . 100 . . mM . . . . 30056 1 3 H2O 'natural abundance' . . . . . . 90 . . % . . . . 30056 1 4 D2O 'natural abundance' . . . . . . 10 . . % . . . . 30056 1 stop_ save_ ####################### # Sample conditions # ####################### save_sample_conditions_1 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_1 _Sample_condition_list.Entry_ID 30056 _Sample_condition_list.ID 1 _Sample_condition_list.Name . _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 100 0.1 mM 30056 1 pH 6.8 . pH 30056 1 pressure 1 . atm 30056 1 temperature 278.15 . K 30056 1 stop_ save_ ############################ # Computer software used # ############################ save_software_1 _Software.Sf_category software _Software.Sf_framecode software_1 _Software.Entry_ID 30056 _Software.ID 1 _Software.Type . _Software.Name Felix _Software.Version . _Software.DOI . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Accelrys Software Inc.' . . 30056 1 stop_ loop_ _Task.Software_module _Task.Task _Task.Entry_ID _Task.Software_ID . 'chemical shift assignment' 30056 1 stop_ save_ save_software_2 _Software.Sf_category software _Software.Sf_framecode software_2 _Software.Entry_ID 30056 _Software.ID 2 _Software.Type . _Software.Name 'X-PLOR NIH' _Software.Version . _Software.DOI . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Schwieters, Kuszewski, Tjandra and Clore' . . 30056 2 stop_ loop_ _Task.Software_module _Task.Task _Task.Entry_ID _Task.Software_ID . 'structure calculation' 30056 2 stop_ save_ ######################### # Experimental detail # ######################### ################################## # NMR Spectrometer definitions # ################################## save_NMR_spectrometer_1 _NMR_spectrometer.Sf_category NMR_spectrometer _NMR_spectrometer.Sf_framecode NMR_spectrometer_1 _NMR_spectrometer.Entry_ID 30056 _NMR_spectrometer.ID 1 _NMR_spectrometer.Name . _NMR_spectrometer.Details . _NMR_spectrometer.Manufacturer Varian _NMR_spectrometer.Model VXRS _NMR_spectrometer.Serial_number . _NMR_spectrometer.Field_strength 500 save_ save_NMR_spectrometer_list _NMR_spectrometer_list.Sf_category NMR_spectrometer_list _NMR_spectrometer_list.Sf_framecode NMR_spectrometer_list _NMR_spectrometer_list.Entry_ID 30056 _NMR_spectrometer_list.ID 1 _NMR_spectrometer_list.Name . loop_ _NMR_spectrometer_view.ID _NMR_spectrometer_view.Name _NMR_spectrometer_view.Manufacturer _NMR_spectrometer_view.Model _NMR_spectrometer_view.Serial_number _NMR_spectrometer_view.Field_strength _NMR_spectrometer_view.Details _NMR_spectrometer_view.Citation_ID _NMR_spectrometer_view.Citation_label _NMR_spectrometer_view.Entry_ID _NMR_spectrometer_view.NMR_spectrometer_list_ID 1 NMR_spectrometer_1 Varian VXRS . 500 . . . 30056 1 stop_ save_ ############################# # NMR applied experiments # ############################# save_experiment_list _Experiment_list.Sf_category experiment_list _Experiment_list.Sf_framecode experiment_list _Experiment_list.Entry_ID 30056 _Experiment_list.ID 1 _Experiment_list.Details . loop_ _Experiment.ID _Experiment.Name _Experiment.Raw_data_flag _Experiment.NMR_spec_expt_ID _Experiment.NMR_spec_expt_label _Experiment.MS_expt_ID _Experiment.MS_expt_label _Experiment.SAXS_expt_ID _Experiment.SAXS_expt_label _Experiment.FRET_expt_ID _Experiment.FRET_expt_label _Experiment.EMR_expt_ID _Experiment.EMR_expt_label _Experiment.Sample_ID _Experiment.Sample_label _Experiment.Sample_state _Experiment.Sample_volume _Experiment.Sample_volume_units _Experiment.Sample_condition_list_ID _Experiment.Sample_condition_list_label _Experiment.Sample_spinning_rate _Experiment.Sample_angle _Experiment.NMR_tube_type _Experiment.NMR_spectrometer_ID _Experiment.NMR_spectrometer_label _Experiment.NMR_spectrometer_probe_ID _Experiment.NMR_spectrometer_probe_label _Experiment.NMR_spectral_processing_ID _Experiment.NMR_spectral_processing_label _Experiment.Mass_spectrometer_ID _Experiment.Mass_spectrometer_label _Experiment.Xray_instrument_ID _Experiment.Xray_instrument_label _Experiment.Fluorescence_instrument_ID _Experiment.Fluorescence_instrument_label _Experiment.EMR_instrument_ID _Experiment.EMR_instrument_label _Experiment.Chromatographic_system_ID _Experiment.Chromatographic_system_label _Experiment.Chromatographic_column_ID _Experiment.Chromatographic_column_label _Experiment.Entry_ID _Experiment.Experiment_list_ID 1 '2D 1H-1H NOESY' no . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . 30056 1 2 '2D DQF-COSY' no . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . 30056 1 stop_ save_ #################### # NMR parameters # #################### ############################## # Assigned chemical shifts # ############################## ################################ # Chemical shift referencing # ################################ save_chem_shift_reference_1 _Chem_shift_reference.Sf_category chem_shift_reference _Chem_shift_reference.Sf_framecode chem_shift_reference_1 _Chem_shift_reference.Entry_ID 30056 _Chem_shift_reference.ID 1 _Chem_shift_reference.Name . _Chem_shift_reference.Details . loop_ _Chem_shift_ref.Atom_type _Chem_shift_ref.Atom_isotope_number _Chem_shift_ref.Mol_common_name _Chem_shift_ref.Atom_group _Chem_shift_ref.Concentration_val _Chem_shift_ref.Concentration_units _Chem_shift_ref.Solvent _Chem_shift_ref.Rank _Chem_shift_ref.Chem_shift_units _Chem_shift_ref.Chem_shift_val _Chem_shift_ref.Ref_method _Chem_shift_ref.Ref_type _Chem_shift_ref.Indirect_shift_ratio _Chem_shift_ref.External_ref_loc _Chem_shift_ref.External_ref_sample_geometry _Chem_shift_ref.External_ref_axis _Chem_shift_ref.Ref_correction_type _Chem_shift_ref.Correction_val _Chem_shift_ref.Entry_ID _Chem_shift_ref.Chem_shift_reference_ID H 1 DSS 'methyl protons' . . . . ppm 0 external indirect 1.0 . . . . . 30056 1 stop_ save_ ################################### # Assigned chemical shift lists # ################################### ################################################################### # Chemical Shift Ambiguity Index Value Definitions # # # # The values other than 1 are used for those atoms with different # # chemical shifts that cannot be assigned to stereospecific atoms # # or to specific residues or chains. # # # # Index Value Definition # # # # 1 Unique (including isolated methyl protons, # # geminal atoms, and geminal methyl # # groups with identical chemical shifts) # # (e.g. ILE HD11, HD12, HD13 protons) # # 2 Ambiguity of geminal atoms or geminal methyl # # proton groups (e.g. ASP HB2 and HB3 # # protons, LEU CD1 and CD2 carbons, or # # LEU HD11, HD12, HD13 and HD21, HD22, # # HD23 methyl protons) # # 3 Aromatic atoms on opposite sides of # # symmetrical rings (e.g. TYR HE1 and HE2 # # protons) # # 4 Intraresidue ambiguities (e.g. LYS HG and # # HD protons or TRP HZ2 and HZ3 protons) # # 5 Interresidue ambiguities (LYS 12 vs. LYS 27) # # 6 Intermolecular ambiguities (e.g. ASP 31 CA # # in monomer 1 and ASP 31 CA in monomer 2 # # of an asymmetrical homodimer, duplex # # DNA assignments, or other assignments # # that may apply to atoms in one or more # # molecule in the molecular assembly) # # 9 Ambiguous, specific ambiguity not defined # # # ################################################################### save_assigned_chemical_shifts_1 _Assigned_chem_shift_list.Sf_category assigned_chemical_shifts _Assigned_chem_shift_list.Sf_framecode assigned_chemical_shifts_1 _Assigned_chem_shift_list.Entry_ID 30056 _Assigned_chem_shift_list.ID 1 _Assigned_chem_shift_list.Name . _Assigned_chem_shift_list.Sample_condition_list_ID 1 _Assigned_chem_shift_list.Sample_condition_list_label $sample_conditions_1 _Assigned_chem_shift_list.Chem_shift_reference_ID 1 _Assigned_chem_shift_list.Chem_shift_reference_label $chem_shift_reference_1 _Assigned_chem_shift_list.Chem_shift_1H_err . _Assigned_chem_shift_list.Chem_shift_13C_err . _Assigned_chem_shift_list.Chem_shift_15N_err . _Assigned_chem_shift_list.Chem_shift_31P_err . _Assigned_chem_shift_list.Chem_shift_2H_err . _Assigned_chem_shift_list.Chem_shift_19F_err . _Assigned_chem_shift_list.Error_derivation_method . _Assigned_chem_shift_list.Details . _Assigned_chem_shift_list.Text_data_format . _Assigned_chem_shift_list.Text_data . loop_ _Chem_shift_experiment.Experiment_ID _Chem_shift_experiment.Experiment_name _Chem_shift_experiment.Sample_ID _Chem_shift_experiment.Sample_label _Chem_shift_experiment.Sample_state _Chem_shift_experiment.Entry_ID _Chem_shift_experiment.Assigned_chem_shift_list_ID 1 '2D 1H-1H NOESY' . . . 30056 1 2 '2D DQF-COSY' . . . 30056 1 stop_ loop_ _Chem_shift_software.Software_ID _Chem_shift_software.Software_label _Chem_shift_software.Method_ID _Chem_shift_software.Method_label _Chem_shift_software.Entry_ID _Chem_shift_software.Assigned_chem_shift_list_ID 1 $software_1 . . 30056 1 stop_ loop_ _Atom_chem_shift.ID _Atom_chem_shift.Assembly_atom_ID _Atom_chem_shift.Entity_assembly_ID _Atom_chem_shift.Entity_ID _Atom_chem_shift.Comp_index_ID _Atom_chem_shift.Seq_ID _Atom_chem_shift.Comp_ID _Atom_chem_shift.Atom_ID _Atom_chem_shift.Atom_type _Atom_chem_shift.Atom_isotope_number _Atom_chem_shift.Val _Atom_chem_shift.Val_err _Atom_chem_shift.Assign_fig_of_merit _Atom_chem_shift.Ambiguity_code _Atom_chem_shift.Ambiguity_set_ID _Atom_chem_shift.Occupancy _Atom_chem_shift.Resonance_ID _Atom_chem_shift.Auth_entity_assembly_ID _Atom_chem_shift.Auth_asym_ID _Atom_chem_shift.Auth_seq_ID _Atom_chem_shift.Auth_comp_ID _Atom_chem_shift.Auth_atom_ID _Atom_chem_shift.Details _Atom_chem_shift.Entry_ID _Atom_chem_shift.Assigned_chem_shift_list_ID 1 . 1 1 1 1 DG H1 H 1 12.17 0.02 . . . . . . . 1 DG H1 . 30056 1 2 . 1 1 1 1 DG H1' H 1 5.86 0.02 . . . . . . . 1 DG H1' . 30056 1 3 . 1 1 1 1 DG H2' H 1 2.74 0.02 . . . . . . . 1 DG H2' . 30056 1 4 . 1 1 1 1 DG H2'' H 1 2.81 0.02 . . . . . . . 1 DG H2'' . 30056 1 5 . 1 1 1 1 DG H3' H 1 4.99 0.02 . . . . . . . 1 DG H3' . 30056 1 6 . 1 1 1 1 DG H4' H 1 4.19 0.02 . . . . . . . 1 DG H4' . 30056 1 7 . 1 1 1 1 DG H8 H 1 7.39 0.02 . . . . . . . 1 DG H8 . 30056 1 8 . 1 1 1 1 DG H21 H 1 10.76 0.02 . . . . . . . 1 DG H21 . 30056 1 9 . 1 1 1 1 DG H22 H 1 6.48 0.02 . . . . . . . 1 DG H22 . 30056 1 10 . 1 1 2 2 DG H1 H 1 12.11 0.02 . . . . . . . 2 DG H1 . 30056 1 11 . 1 1 2 2 DG H1' H 1 6.01 0.02 . . . . . . . 2 DG H1' . 30056 1 12 . 1 1 2 2 DG H2' H 1 2.51 0.02 . . . . . . . 2 DG H2' . 30056 1 13 . 1 1 2 2 DG H2'' H 1 2.80 0.02 . . . . . . . 2 DG H2'' . 30056 1 14 . 1 1 2 2 DG H3' H 1 5.09 0.02 . . . . . . . 2 DG H3' . 30056 1 15 . 1 1 2 2 DG H4' H 1 4.23 0.02 . . . . . . . 2 DG H4' . 30056 1 16 . 1 1 2 2 DG H5' H 1 4.18 0.02 . . . . . . . 2 DG H5' . 30056 1 17 . 1 1 2 2 DG H5'' H 1 4.19 0.02 . . . . . . . 2 DG H5'' . 30056 1 18 . 1 1 2 2 DG H8 H 1 8.14 0.02 . . . . . . . 2 DG H8 . 30056 1 19 . 1 1 3 3 DT H1' H 1 6.36 0.02 . . . . . . . 3 DT H1' . 30056 1 20 . 1 1 3 3 DT H2' H 1 2.40 0.02 . . . . . . . 3 DT H2' . 30056 1 21 . 1 1 3 3 DT H2'' H 1 2.61 0.02 . . . . . . . 3 DT H2'' . 30056 1 22 . 1 1 3 3 DT H3' H 1 4.38 0.02 . . . . . . . 3 DT H3' . 30056 1 23 . 1 1 3 3 DT H4' H 1 4.10 0.02 . . . . . . . 3 DT H4' . 30056 1 24 . 1 1 3 3 DT H5' H 1 3.08 0.02 . . . . . . . 3 DT H5' . 30056 1 25 . 1 1 3 3 DT H5'' H 1 3.09 0.02 . . . . . . . 3 DT H5'' . 30056 1 26 . 1 1 3 3 DT H6 H 1 7.84 0.02 . . . . . . . 3 DT H6 . 30056 1 27 . 1 1 3 3 DT H71 H 1 1.97 0.02 . . . . . . . 3 DT H71 . 30056 1 28 . 1 1 3 3 DT H72 H 1 1.97 0.02 . . . . . . . 3 DT H72 . 30056 1 29 . 1 1 3 3 DT H73 H 1 1.97 0.02 . . . . . . . 3 DT H73 . 30056 1 30 . 1 1 4 4 DT H1' H 1 5.80 0.02 . . . . . . . 4 DT H1' . 30056 1 31 . 1 1 4 4 DT H2' H 1 1.89 0.02 . . . . . . . 4 DT H2' . 30056 1 32 . 1 1 4 4 DT H2'' H 1 2.24 0.02 . . . . . . . 4 DT H2'' . 30056 1 33 . 1 1 4 4 DT H3 H 1 11.00 0.02 . . . . . . . 4 DT H3 . 30056 1 34 . 1 1 4 4 DT H3' H 1 4.62 0.02 . . . . . . . 4 DT H3' . 30056 1 35 . 1 1 4 4 DT H4' H 1 4.06 0.02 . . . . . . . 4 DT H4' . 30056 1 36 . 1 1 4 4 DT H5' H 1 3.52 0.02 . . . . . . . 4 DT H5' . 30056 1 37 . 1 1 4 4 DT H5'' H 1 3.10 0.02 . . . . . . . 4 DT H5'' . 30056 1 38 . 1 1 4 4 DT H6 H 1 7.34 0.02 . . . . . . . 4 DT H6 . 30056 1 39 . 1 1 4 4 DT H71 H 1 1.65 0.02 . . . . . . . 4 DT H71 . 30056 1 40 . 1 1 4 4 DT H72 H 1 1.65 0.02 . . . . . . . 4 DT H72 . 30056 1 41 . 1 1 4 4 DT H73 H 1 1.65 0.02 . . . . . . . 4 DT H73 . 30056 1 42 . 1 1 5 5 DT H1' H 1 5.95 0.02 . . . . . . . 5 DT H1' . 30056 1 43 . 1 1 5 5 DT H2' H 1 2.38 0.02 . . . . . . . 5 DT H2' . 30056 1 44 . 1 1 5 5 DT H2'' H 1 2.23 0.02 . . . . . . . 5 DT H2'' . 30056 1 45 . 1 1 5 5 DT H3 H 1 10.33 0.02 . . . . . . . 5 DT H3 . 30056 1 46 . 1 1 5 5 DT H3' H 1 4.59 0.02 . . . . . . . 5 DT H3' . 30056 1 47 . 1 1 5 5 DT H4' H 1 3.57 0.02 . . . . . . . 5 DT H4' . 30056 1 48 . 1 1 5 5 DT H5' H 1 4.10 0.02 . . . . . . . 5 DT H5' . 30056 1 49 . 1 1 5 5 DT H6 H 1 7.22 0.02 . . . . . . . 5 DT H6 . 30056 1 50 . 1 1 5 5 DT H71 H 1 1.45 0.02 . . . . . . . 5 DT H71 . 30056 1 51 . 1 1 5 5 DT H72 H 1 1.45 0.02 . . . . . . . 5 DT H72 . 30056 1 52 . 1 1 5 5 DT H73 H 1 1.45 0.02 . . . . . . . 5 DT H73 . 30056 1 53 . 1 1 6 6 DG H1 H 1 11.96 0.02 . . . . . . . 6 DG H1 . 30056 1 54 . 1 1 6 6 DG H1' H 1 6.08 0.02 . . . . . . . 6 DG H1' . 30056 1 55 . 1 1 6 6 DG H2' H 1 3.42 0.02 . . . . . . . 6 DG H2' . 30056 1 56 . 1 1 6 6 DG H2'' H 1 2.78 0.02 . . . . . . . 6 DG H2'' . 30056 1 57 . 1 1 6 6 DG H3' H 1 4.37 0.02 . . . . . . . 6 DG H3' . 30056 1 58 . 1 1 6 6 DG H4' H 1 4.19 0.02 . . . . . . . 6 DG H4' . 30056 1 59 . 1 1 6 6 DG H8 H 1 7.60 0.02 . . . . . . . 6 DG H8 . 30056 1 60 . 1 1 7 7 DG H1 H 1 11.66 0.02 . . . . . . . 7 DG H1 . 30056 1 61 . 1 1 7 7 DG H1' H 1 5.94 0.02 . . . . . . . 7 DG H1' . 30056 1 62 . 1 1 7 7 DG H2' H 1 2.65 0.02 . . . . . . . 7 DG H2' . 30056 1 63 . 1 1 7 7 DG H2'' H 1 2.76 0.02 . . . . . . . 7 DG H2'' . 30056 1 64 . 1 1 7 7 DG H3' H 1 5.00 0.02 . . . . . . . 7 DG H3' . 30056 1 65 . 1 1 7 7 DG H4' H 1 4.38 0.02 . . . . . . . 7 DG H4' . 30056 1 66 . 1 1 7 7 DG H5' H 1 4.09 0.02 . . . . . . . 7 DG H5' . 30056 1 67 . 1 1 7 7 DG H5'' H 1 4.08 0.02 . . . . . . . 7 DG H5'' . 30056 1 68 . 1 1 7 7 DG H8 H 1 8.06 0.02 . . . . . . . 7 DG H8 . 30056 1 69 . 1 1 7 7 DG H21 H 1 10.1 0.10 . . . . . . . 7 DG H21 . 30056 1 70 . 1 1 7 7 DG H22 H 1 6.5 0.02 . . . . . . . 7 DG H22 . 30056 1 71 . 1 1 8 8 DT H1' H 1 5.50 0.02 . . . . . . . 8 DT H1' . 30056 1 72 . 1 1 8 8 DT H2' H 1 1.45 0.02 . . . . . . . 8 DT H2' . 30056 1 73 . 1 1 8 8 DT H2'' H 1 2.25 0.02 . . . . . . . 8 DT H2'' . 30056 1 74 . 1 1 8 8 DT H3 H 1 10.49 0.02 . . . . . . . 8 DT H3 . 30056 1 75 . 1 1 8 8 DT H3' H 1 4.45 0.02 . . . . . . . 8 DT H3' . 30056 1 76 . 1 1 8 8 DT H4' H 1 4.01 0.02 . . . . . . . 8 DT H4' . 30056 1 77 . 1 1 8 8 DT H5' H 1 3.61 0.02 . . . . . . . 8 DT H5' . 30056 1 78 . 1 1 8 8 DT H5'' H 1 3.60 0.02 . . . . . . . 8 DT H5'' . 30056 1 79 . 1 1 8 8 DT H6 H 1 7.04 0.02 . . . . . . . 8 DT H6 . 30056 1 80 . 1 1 8 8 DT H71 H 1 1.78 0.02 . . . . . . . 8 DT H71 . 30056 1 81 . 1 1 8 8 DT H72 H 1 1.78 0.02 . . . . . . . 8 DT H72 . 30056 1 82 . 1 1 8 8 DT H73 H 1 1.78 0.02 . . . . . . . 8 DT H73 . 30056 1 83 . 1 1 9 9 DT H1' H 1 5.48 0.02 . . . . . . . 9 DT H1' . 30056 1 84 . 1 1 9 9 DT H2' H 1 2.08 0.02 . . . . . . . 9 DT H2' . 30056 1 85 . 1 1 9 9 DT H2'' H 1 1.94 0.02 . . . . . . . 9 DT H2'' . 30056 1 86 . 1 1 9 9 DT H3 H 1 10.12 0.02 . . . . . . . 9 DT H3 . 30056 1 87 . 1 1 9 9 DT H3' H 1 4.56 0.02 . . . . . . . 9 DT H3' . 30056 1 88 . 1 1 9 9 DT H4' H 1 3.62 0.02 . . . . . . . 9 DT H4' . 30056 1 89 . 1 1 9 9 DT H5' H 1 3.54 0.02 . . . . . . . 9 DT H5' . 30056 1 90 . 1 1 9 9 DT H5'' H 1 3.61 0.02 . . . . . . . 9 DT H5'' . 30056 1 91 . 1 1 9 9 DT H6 H 1 7.28 0.02 . . . . . . . 9 DT H6 . 30056 1 92 . 1 1 9 9 DT H71 H 1 1.57 0.02 . . . . . . . 9 DT H71 . 30056 1 93 . 1 1 9 9 DT H72 H 1 1.57 0.02 . . . . . . . 9 DT H72 . 30056 1 94 . 1 1 9 9 DT H73 H 1 1.57 0.02 . . . . . . . 9 DT H73 . 30056 1 95 . 1 1 10 10 DT H1' H 1 5.43 0.02 . . . . . . . 10 DT H1' . 30056 1 96 . 1 1 10 10 DT H2' H 1 1.75 0.02 . . . . . . . 10 DT H2' . 30056 1 97 . 1 1 10 10 DT H2'' H 1 2.37 0.02 . . . . . . . 10 DT H2'' . 30056 1 98 . 1 1 10 10 DT H3 H 1 9.78 0.02 . . . . . . . 10 DT H3 . 30056 1 99 . 1 1 10 10 DT H3' H 1 4.46 0.02 . . . . . . . 10 DT H3' . 30056 1 100 . 1 1 10 10 DT H6 H 1 7.16 0.02 . . . . . . . 10 DT H6 . 30056 1 101 . 1 1 10 10 DT H71 H 1 1.54 0.02 . . . . . . . 10 DT H71 . 30056 1 102 . 1 1 10 10 DT H72 H 1 1.54 0.02 . . . . . . . 10 DT H72 . 30056 1 103 . 1 1 10 10 DT H73 H 1 1.54 0.02 . . . . . . . 10 DT H73 . 30056 1 104 . 1 1 11 11 DT H1' H 1 5.404 0.02 . . . . . . . 11 DT H1' . 30056 1 105 . 1 1 11 11 DT H2' H 1 1.565 0.02 . . . . . . . 11 DT H2' . 30056 1 106 . 1 1 11 11 DT H2'' H 1 2.218 0.02 . . . . . . . 11 DT H2'' . 30056 1 107 . 1 1 11 11 DT H3' H 1 4.649 0.02 . . . . . . . 11 DT H3' . 30056 1 108 . 1 1 11 11 DT H4' H 1 4.398 0.02 . . . . . . . 11 DT H4' . 30056 1 109 . 1 1 11 11 DT H5' H 1 2.657 0.02 . . . . . . . 11 DT H5' . 30056 1 110 . 1 1 11 11 DT H5'' H 1 4.264 0.02 . . . . . . . 11 DT H5'' . 30056 1 111 . 1 1 11 11 DT H6 H 1 7.076 0.02 . . . . . . . 11 DT H6 . 30056 1 112 . 1 1 11 11 DT H71 H 1 1.424 0.02 . . . . . . . 11 DT H71 . 30056 1 113 . 1 1 11 11 DT H72 H 1 1.424 0.02 . . . . . . . 11 DT H72 . 30056 1 114 . 1 1 11 11 DT H73 H 1 1.424 0.02 . . . . . . . 11 DT H73 . 30056 1 115 . 1 1 12 12 DG H1 H 1 11.11 0.02 . . . . . . . 12 DG H1 . 30056 1 116 . 1 1 12 12 DG H1' H 1 6.10 0.02 . . . . . . . 12 DG H1' . 30056 1 117 . 1 1 12 12 DG H2' H 1 3.45 0.02 . . . . . . . 12 DG H2' . 30056 1 118 . 1 1 12 12 DG H2'' H 1 2.98 0.02 . . . . . . . 12 DG H2'' . 30056 1 119 . 1 1 12 12 DG H3' H 1 4.99 0.02 . . . . . . . 12 DG H3' . 30056 1 120 . 1 1 12 12 DG H8 H 1 7.45 0.02 . . . . . . . 12 DG H8 . 30056 1 121 . 1 1 13 13 DG H1 H 1 11.82 0.02 . . . . . . . 13 DG H1 . 30056 1 122 . 1 1 13 13 DG H1' H 1 6.19 0.02 . . . . . . . 13 DG H1' . 30056 1 123 . 1 1 13 13 DG H2' H 1 2.89 0.02 . . . . . . . 13 DG H2' . 30056 1 124 . 1 1 13 13 DG H2'' H 1 2.48 0.02 . . . . . . . 13 DG H2'' . 30056 1 125 . 1 1 13 13 DG H3' H 1 5.12 0.02 . . . . . . . 13 DG H3' . 30056 1 126 . 1 1 13 13 DG H4' H 1 4.40 0.02 . . . . . . . 13 DG H4' . 30056 1 127 . 1 1 13 13 DG H8 H 1 8.05 0.02 . . . . . . . 13 DG H8 . 30056 1 128 . 1 1 13 13 DG H21 H 1 9.4 0.10 . . . . . . . 13 DG H21 . 30056 1 129 . 1 1 13 13 DG H22 H 1 6.8 0.10 . . . . . . . 13 DG H22 . 30056 1 130 . 1 1 14 14 DT H1' H 1 6.24 0.02 . . . . . . . 14 DT H1' . 30056 1 131 . 1 1 14 14 DT H2' H 1 2.58 0.02 . . . . . . . 14 DT H2' . 30056 1 132 . 1 1 14 14 DT H2'' H 1 2.24 0.02 . . . . . . . 14 DT H2'' . 30056 1 133 . 1 1 14 14 DT H4' H 1 4.32 0.02 . . . . . . . 14 DT H4' . 30056 1 134 . 1 1 14 14 DT H6 H 1 7.82 0.02 . . . . . . . 14 DT H6 . 30056 1 135 . 1 1 14 14 DT H71 H 1 2.00 0.02 . . . . . . . 14 DT H71 . 30056 1 136 . 1 1 14 14 DT H72 H 1 2.00 0.02 . . . . . . . 14 DT H72 . 30056 1 137 . 1 1 14 14 DT H73 H 1 2.00 0.02 . . . . . . . 14 DT H73 . 30056 1 138 . 1 1 15 15 DT H1' H 1 6.15 0.02 . . . . . . . 15 DT H1' . 30056 1 139 . 1 1 15 15 DT H2' H 1 2.65 0.02 . . . . . . . 15 DT H2' . 30056 1 140 . 1 1 15 15 DT H2'' H 1 2.09 0.02 . . . . . . . 15 DT H2'' . 30056 1 141 . 1 1 15 15 DT H3 H 1 10.91 0.02 . . . . . . . 15 DT H3 . 30056 1 142 . 1 1 15 15 DT H3' H 1 4.93 0.02 . . . . . . . 15 DT H3' . 30056 1 143 . 1 1 15 15 DT H6 H 1 7.30 0.02 . . . . . . . 15 DT H6 . 30056 1 144 . 1 1 15 15 DT H71 H 1 1.26 0.02 . . . . . . . 15 DT H71 . 30056 1 145 . 1 1 15 15 DT H72 H 1 1.26 0.02 . . . . . . . 15 DT H72 . 30056 1 146 . 1 1 15 15 DT H73 H 1 1.26 0.02 . . . . . . . 15 DT H73 . 30056 1 147 . 1 1 16 16 DG H1 H 1 11.36 0.02 . . . . . . . 16 DG H1 . 30056 1 148 . 1 1 16 16 DG H1' H 1 6.05 0.02 . . . . . . . 16 DG H1' . 30056 1 149 . 1 1 16 16 DG H2' H 1 3.53 0.02 . . . . . . . 16 DG H2' . 30056 1 150 . 1 1 16 16 DG H2'' H 1 2.96 0.02 . . . . . . . 16 DG H2'' . 30056 1 151 . 1 1 16 16 DG H3' H 1 4.97 0.02 . . . . . . . 16 DG H3' . 30056 1 152 . 1 1 16 16 DG H4' H 1 4.28 0.02 . . . . . . . 16 DG H4' . 30056 1 153 . 1 1 16 16 DG H8 H 1 7.34 0.02 . . . . . . . 16 DG H8 . 30056 1 154 . 1 1 16 16 DG H21 H 1 9.67 0.06 . . . . . . . 16 DG H21 . 30056 1 155 . 1 1 16 16 DG H22 H 1 6.98 0.06 . . . . . . . 16 DG H22 . 30056 1 156 . 1 1 17 17 DG H1 H 1 11.81 0.02 . . . . . . . 17 DG H1 . 30056 1 157 . 1 1 17 17 DG H1' H 1 6.31 0.02 . . . . . . . 17 DG H1' . 30056 1 158 . 1 1 17 17 DG H2' H 1 2.73 0.02 . . . . . . . 17 DG H2' . 30056 1 159 . 1 1 17 17 DG H2'' H 1 2.48 0.02 . . . . . . . 17 DG H2'' . 30056 1 160 . 1 1 17 17 DG H4' H 1 4.28 0.02 . . . . . . . 17 DG H4' . 30056 1 161 . 1 1 17 17 DG H8 H 1 8.27 0.02 . . . . . . . 17 DG H8 . 30056 1 stop_ save_