data_15859 ####################### # Entry information # ####################### save_entry_information _Entry.Sf_category entry_information _Entry.Sf_framecode entry_information _Entry.ID 15859 _Entry.Title ; NMR solution structure of the d3'-stem closed by a GAAA tetraloop of the group II intron Sc.ai5(gamma) ; _Entry.Type macromolecule _Entry.Version_type original _Entry.Submission_date 2008-07-04 _Entry.Accession_date 2008-07-04 _Entry.Last_release_date 2009-10-13 _Entry.Original_release_date 2009-10-13 _Entry.Origination author _Entry.NMR_STAR_version 3.1.1.61 _Entry.Original_NMR_STAR_version 3.0.8.116 _Entry.Experimental_method NMR _Entry.Experimental_method_subtype solution _Entry.Details . _Entry.BMRB_internal_directory_name . loop_ _Entry_author.Ordinal _Entry_author.Given_name _Entry_author.Family_name _Entry_author.First_initial _Entry_author.Middle_initials _Entry_author.Family_title _Entry_author.Entry_ID 1 Daniela Kruschel . . . 15859 2 Roland Sigel . 'K. O.' . 15859 stop_ loop_ _SG_project.SG_project_ID _SG_project.Project_name _SG_project.Full_name_of_center _SG_project.Initial_of_center _SG_project.Entry_ID . 'not applicable' 'not applicable' . 15859 stop_ loop_ _Struct_keywords.Keywords _Struct_keywords.Text _Struct_keywords.Entry_ID d3'-stem . 15859 'GAAA tetraloop' . 15859 'group II intron' . 15859 hairpin . 15859 NMR . 15859 ribozyme . 15859 'RNA 22-mer' . 15859 splicing . 15859 stop_ loop_ _Data_set.Type _Data_set.Count _Data_set.Entry_ID assigned_chemical_shifts 1 15859 stop_ loop_ _Datum.Type _Datum.Count _Datum.Entry_ID '13C chemical shifts' 58 15859 '15N chemical shifts' 11 15859 '1H chemical shifts' 183 15859 stop_ loop_ _Release.Release_number _Release.Format_type _Release.Format_version _Release.Date _Release.Submission_date _Release.Type _Release.Author _Release.Detail _Release.Entry_ID 1 . . 2009-10-13 2008-07-04 original author . 15859 stop_ loop_ _Related_entries.Database_name _Related_entries.Database_accession_code _Related_entries.Relationship _Related_entries.Entry_ID BMRB 15856 'NMR data related to NMR solution structure of the d3'-hairpin including EBS1 of the group II intron Sc.ai5(gamma)' 15859 BMRB 15857 'NMR data related to NMR solution structure of the d3'-hairpin including EBS1 and IBS1 of the group II intron Sc.ai5(gamma)' 15859 BMRB 15858 'NMR data related to NMR solution structure of the exon/intron binding site 1 (EBS1/IBS1) of the group II intron Sc.ai5(gamma)' 15859 BMRB 15859 'NMR data related to NMR solution structure of the d3'-stem closed by a GAAA tetraloop of the group II intron Sc.ai5(gamma)' 15859 BMRB 5962 'NMR data related to solution structure of domain 5 from the ai5(gamma) group II intron' 15859 BMRB 6756 'NMR data related to solution structure of domain 6 from the ai5(gamma)group II intron' 15859 PDB 1KXK 'Crystal Structure of a RNA Molecule Containing Domain 5 and 6 of the Yeast ai5g Group II Self-splicing Intron' 15859 PDB 1R2P 'Solution structure of domain 5 from the ai5(gamma) group II intron' 15859 PDB 2AHT 'Solution structure of domain 6 from the ai5(gamma)group II intron' 15859 PDB 2K63 'NMR solution structure of the d3'-hairpin including the exon binding site 1 (EBS1) of the group II intron Sc.ai5(gamma)' 15859 PDB 2K64 'NMR solution structure of the d3'-hairpin including EBS1 together with IBS1 of the group II intron Sc.ai5(gamma)' 15859 PDB 2K65 'NMR solution structure of the exon/intron binding site 1 (EBS1/IBS1) of the group II intron Sc.ai5(gamma)' 15859 PDB 2K66 'BMRB Entry Tracking System' 15859 PDB 3BWP 'Crystal structure of a self-spliced group II intron' 15859 stop_ save_ ############### # Citations # ############### save_entry_citation _Citation.Sf_category citations _Citation.Sf_framecode entry_citation _Citation.Entry_ID 15859 _Citation.ID 1 _Citation.Class 'entry citation' _Citation.CAS_abstract_code . _Citation.MEDLINE_UI_code . _Citation.DOI . _Citation.PubMed_ID . _Citation.Full_citation . _Citation.Title 'Solution structure of the 5'-splice site of a group II intron ribozyme' _Citation.Status 'in preparation' _Citation.Type journal _Citation.Journal_abbrev 'Not known' _Citation.Journal_name_full . _Citation.Journal_volume . _Citation.Journal_issue . _Citation.Journal_ASTM . _Citation.Journal_ISSN . _Citation.Journal_CSD . _Citation.Book_title . _Citation.Book_chapter_title . _Citation.Book_volume . _Citation.Book_series . _Citation.Book_publisher . _Citation.Book_publisher_city . _Citation.Book_ISBN . _Citation.Conference_title . _Citation.Conference_site . _Citation.Conference_state_province . _Citation.Conference_country . _Citation.Conference_start_date . _Citation.Conference_end_date . _Citation.Conference_abstract_number . _Citation.Thesis_institution . _Citation.Thesis_institution_city . _Citation.Thesis_institution_country . _Citation.WWW_URL . _Citation.Page_first . _Citation.Page_last . _Citation.Year . _Citation.Details . loop_ _Citation_author.Ordinal _Citation_author.Given_name _Citation_author.Family_name _Citation_author.First_initial _Citation_author.Middle_initials _Citation_author.Family_title _Citation_author.Entry_ID _Citation_author.Citation_ID 1 Daniela Kruschel . . . 15859 1 2 Roland Sigel . 'K. O.' . 15859 1 stop_ save_ ############################################# # Molecular system (assembly) description # ############################################# save_assembly _Assembly.Sf_category assembly _Assembly.Sf_framecode assembly _Assembly.Entry_ID 15859 _Assembly.ID 1 _Assembly.Name 29-MER _Assembly.BMRB_code . _Assembly.Number_of_components 1 _Assembly.Organic_ligands . _Assembly.Metal_ions . _Assembly.Non_standard_bonds . _Assembly.Ambiguous_conformational_states . _Assembly.Ambiguous_chem_comp_sites . _Assembly.Molecules_in_chemical_exchange . _Assembly.Paramagnetic no _Assembly.Thiol_state . _Assembly.Molecular_mass . _Assembly.Enzyme_commission_number . _Assembly.Details . _Assembly.DB_query_date . _Assembly.DB_query_revised_last_date . loop_ _Entity_assembly.ID _Entity_assembly.Entity_assembly_name _Entity_assembly.Entity_ID _Entity_assembly.Entity_label _Entity_assembly.Asym_ID _Entity_assembly.PDB_chain_ID _Entity_assembly.Experimental_data_reported _Entity_assembly.Physical_state _Entity_assembly.Conformational_isomer _Entity_assembly.Chemical_exchange_state _Entity_assembly.Magnetic_equivalence_group_code _Entity_assembly.Role _Entity_assembly.Details _Entity_assembly.Entry_ID _Entity_assembly.Assembly_ID 1 'RNA (22-MER)' 1 $RNA_(22-MER) A . yes native no no . . . 15859 1 stop_ save_ #################################### # Biological polymers and ligands # #################################### save_RNA_(22-MER) _Entity.Sf_category entity _Entity.Sf_framecode RNA_(22-MER) _Entity.Entry_ID 15859 _Entity.ID 1 _Entity.BMRB_code . _Entity.Name RNA_(22-MER) _Entity.Type polymer _Entity.Polymer_common_type . _Entity.Polymer_type polyribonucleotide _Entity.Polymer_type_details . _Entity.Polymer_strand_ID A _Entity.Polymer_seq_one_letter_code_can . _Entity.Polymer_seq_one_letter_code ; GGAGUAUGUGAAAGCAUACU CC ; _Entity.Target_identifier . _Entity.Polymer_author_defined_seq . _Entity.Polymer_author_seq_details . _Entity.Ambiguous_conformational_states no _Entity.Ambiguous_chem_comp_sites no _Entity.Nstd_monomer no _Entity.Nstd_chirality no _Entity.Nstd_linkage no _Entity.Nonpolymer_comp_ID . _Entity.Nonpolymer_comp_label . _Entity.Number_of_monomers 22 _Entity.Number_of_nonpolymer_components . _Entity.Paramagnetic no _Entity.Thiol_state 'not present' _Entity.Src_method syn _Entity.Parent_entity_ID . _Entity.Fragment . _Entity.Mutation '11-nt loop of wt-sequence replaced by a GAAA tetraloop' _Entity.EC_number . _Entity.Calc_isoelectric_point . _Entity.Formula_weight . _Entity.Formula_weight_exptl . _Entity.Formula_weight_exptl_meth . _Entity.Details . _Entity.DB_query_date . _Entity.DB_query_revised_last_date . loop_ _Entity_comp_index.ID _Entity_comp_index.Auth_seq_ID _Entity_comp_index.Comp_ID _Entity_comp_index.Comp_label _Entity_comp_index.Entry_ID _Entity_comp_index.Entity_ID 1 . G . 15859 1 2 . G . 15859 1 3 . A . 15859 1 4 . G . 15859 1 5 . U . 15859 1 6 . A . 15859 1 7 . U . 15859 1 8 . G . 15859 1 9 . U . 15859 1 10 . G . 15859 1 11 . A . 15859 1 12 . A . 15859 1 13 . A . 15859 1 14 . G . 15859 1 15 . C . 15859 1 16 . A . 15859 1 17 . U . 15859 1 18 . A . 15859 1 19 . C . 15859 1 20 . U . 15859 1 21 . C . 15859 1 22 . C . 15859 1 stop_ loop_ _Entity_poly_seq.Hetero _Entity_poly_seq.Mon_ID _Entity_poly_seq.Num _Entity_poly_seq.Comp_index_ID _Entity_poly_seq.Entry_ID _Entity_poly_seq.Entity_ID . G 1 1 15859 1 . G 2 2 15859 1 . A 3 3 15859 1 . G 4 4 15859 1 . U 5 5 15859 1 . A 6 6 15859 1 . U 7 7 15859 1 . G 8 8 15859 1 . U 9 9 15859 1 . G 10 10 15859 1 . A 11 11 15859 1 . A 12 12 15859 1 . A 13 13 15859 1 . G 14 14 15859 1 . C 15 15 15859 1 . A 16 16 15859 1 . U 17 17 15859 1 . A 18 18 15859 1 . C 19 19 15859 1 . U 20 20 15859 1 . C 21 21 15859 1 . C 22 22 15859 1 stop_ save_ #################### # Natural source # #################### save_natural_source _Entity_natural_src_list.Sf_category natural_source _Entity_natural_src_list.Sf_framecode natural_source _Entity_natural_src_list.Entry_ID 15859 _Entity_natural_src_list.ID 1 loop_ _Entity_natural_src.ID _Entity_natural_src.Entity_ID _Entity_natural_src.Entity_label _Entity_natural_src.Entity_chimera_segment_ID _Entity_natural_src.NCBI_taxonomy_ID _Entity_natural_src.Type _Entity_natural_src.Common _Entity_natural_src.Organism_name_scientific _Entity_natural_src.Organism_name_common _Entity_natural_src.Organism_acronym _Entity_natural_src.ICTVdb_decimal_code _Entity_natural_src.Superkingdom _Entity_natural_src.Kingdom _Entity_natural_src.Genus _Entity_natural_src.Species _Entity_natural_src.Strain _Entity_natural_src.Variant _Entity_natural_src.Subvariant _Entity_natural_src.Organ _Entity_natural_src.Tissue _Entity_natural_src.Tissue_fraction _Entity_natural_src.Cell_line _Entity_natural_src.Cell_type _Entity_natural_src.ATCC_number _Entity_natural_src.Organelle _Entity_natural_src.Cellular_location _Entity_natural_src.Fragment _Entity_natural_src.Fraction _Entity_natural_src.Secretion _Entity_natural_src.Plasmid _Entity_natural_src.Plasmid_details _Entity_natural_src.Gene_mnemonic _Entity_natural_src.Dev_stage _Entity_natural_src.Details _Entity_natural_src.Citation_ID _Entity_natural_src.Citation_label _Entity_natural_src.Entry_ID _Entity_natural_src.Entity_natural_src_list_ID 1 1 $RNA_(22-MER) . 4932 organism . 'Saccharomyces cerevisiae' 'Baker's yeast' . . Eukaryota Fungi Saccharomyces cerevisiae . . . . . . . . . . . . . . . . . . . . . 15859 1 stop_ save_ ######################### # Experimental source # ######################### save_experimental_source _Entity_experimental_src_list.Sf_category experimental_source _Entity_experimental_src_list.Sf_framecode experimental_source _Entity_experimental_src_list.Entry_ID 15859 _Entity_experimental_src_list.ID 1 loop_ _Entity_experimental_src.ID _Entity_experimental_src.Entity_ID _Entity_experimental_src.Entity_label _Entity_experimental_src.Entity_chimera_segment_ID _Entity_experimental_src.Production_method _Entity_experimental_src.Host_org_scientific_name _Entity_experimental_src.Host_org_name_common _Entity_experimental_src.Host_org_details _Entity_experimental_src.Host_org_NCBI_taxonomy_ID _Entity_experimental_src.Host_org_genus _Entity_experimental_src.Host_org_species _Entity_experimental_src.Host_org_strain _Entity_experimental_src.Host_org_variant _Entity_experimental_src.Host_org_subvariant _Entity_experimental_src.Host_org_organ _Entity_experimental_src.Host_org_tissue _Entity_experimental_src.Host_org_tissue_fraction _Entity_experimental_src.Host_org_cell_line _Entity_experimental_src.Host_org_cell_type _Entity_experimental_src.Host_org_cellular_location _Entity_experimental_src.Host_org_organelle _Entity_experimental_src.Host_org_gene _Entity_experimental_src.Host_org_culture_collection _Entity_experimental_src.Host_org_ATCC_number _Entity_experimental_src.Vector_type _Entity_experimental_src.PDBview_host_org_vector_name _Entity_experimental_src.PDBview_plasmid_name _Entity_experimental_src.Vector_name _Entity_experimental_src.Vector_details _Entity_experimental_src.Vendor_name _Entity_experimental_src.Host_org_dev_stage _Entity_experimental_src.Details _Entity_experimental_src.Citation_ID _Entity_experimental_src.Citation_label _Entity_experimental_src.Entry_ID _Entity_experimental_src.Entity_experimental_src_list_ID 1 1 $RNA_(22-MER) . 'in vitro transcription' 'Saccharomyces cerevisiae' . . . Saccharomyces cerevisiae . . . . . . . . . . . . . . . . . . . . 'The sequence was synthesized in vitro using T7 polymerase and synthetic DNA oligonucleotides.' . . 15859 1 stop_ save_ ##################################### # Sample contents and methodology # ##################################### ######################## # Sample description # ######################## save_sample_1 _Sample.Sf_category sample _Sample.Sf_framecode sample_1 _Sample.Entry_ID 15859 _Sample.ID 1 _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number . _Sample.Solvent_system '100% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'RNA (22-MER)' 'natural abundance' . . 1 $RNA_(22-MER) . . 0.9-1.3 0.9 1.3 mM . . . . 15859 1 2 'potassium chloride' 'natural abundance' . . . . . . 10 . . mM . . . . 15859 1 3 EDTA 'natural abundance' . . . . . . 10 . . uM . . . . 15859 1 4 D2O '[U-100% 2H]' . . . . . . 100 . . % . . . . 15859 1 stop_ save_ save_sample_2 _Sample.Sf_category sample _Sample.Sf_framecode sample_2 _Sample.Entry_ID 15859 _Sample.ID 2 _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number . _Sample.Solvent_system '90% H2O/10% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'RNA (22-MER)' 'natural abundance' . . 1 $RNA_(22-MER) . . 0.9-1.3 0.9 1.3 mM . . . . 15859 2 2 'potassium chloride' 'natural abundance' . . . . . . 10 . . mM . . . . 15859 2 3 EDTA 'natural abundance' . . . . . . 10 . . uM . . . . 15859 2 4 H2O 'natural abundance' . . . . . . 90 . . % . . . . 15859 2 5 D2O '[U-100% 2H]' . . . . . . 10 . . % . . . . 15859 2 stop_ save_ save_sample_3 _Sample.Sf_category sample _Sample.Sf_framecode sample_3 _Sample.Entry_ID 15859 _Sample.ID 3 _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number . _Sample.Solvent_system '100% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'RNA (22-MER)' '[U-100% 13C; U-100% 15N]' . . 1 $RNA_(22-MER) . . 1.0 . . mM . . . . 15859 3 2 'potassium chloride' 'natural abundance' . . . . . . 10 . . mM . . . . 15859 3 3 EDTA 'natural abundance' . . . . . . 10 . . uM . . . . 15859 3 4 D2O '[U-100% 2H]' . . . . . . 100 . . % . . . . 15859 3 stop_ save_ save_sample_4 _Sample.Sf_category sample _Sample.Sf_framecode sample_4 _Sample.Entry_ID 15859 _Sample.ID 4 _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number . _Sample.Solvent_system '90% H2O/10% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'RNA (22-MER)' '[U-100% 13C; U-100% 15N]' . . 1 $RNA_(22-MER) . . 1.0 . . mM . . . . 15859 4 2 'potassium chloride' 'natural abundance' . . . . . . 10 . . mM . . . . 15859 4 3 EDTA 'natural abundance' . . . . . . 10 . . uM . . . . 15859 4 4 H2O 'natural abundance' . . . . . . 90 . . % . . . . 15859 4 5 D2O '[U-100% 2H]' . . . . . . 10 . . % . . . . 15859 4 stop_ save_ ####################### # Sample conditions # ####################### save_sample_conditions_1 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_1 _Sample_condition_list.Entry_ID 15859 _Sample_condition_list.ID 1 _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 10 . mM 15859 1 pD 6.45 0.05 pH 15859 1 pressure 1 . atm 15859 1 temperature 293 . K 15859 1 stop_ save_ save_sample_conditions_5 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_5 _Sample_condition_list.Entry_ID 15859 _Sample_condition_list.ID 2 _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 10 . mM 15859 2 pD 6.45 0.05 pH 15859 2 pressure 1 . atm 15859 2 temperature 303 . K 15859 2 stop_ save_ save_sample_conditions_2 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_2 _Sample_condition_list.Entry_ID 15859 _Sample_condition_list.ID 3 _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 10 . mM 15859 3 pH 6.2 . pH 15859 3 pressure 1 . atm 15859 3 temperature 278 . K 15859 3 stop_ save_ save_sample_conditions_6 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_6 _Sample_condition_list.Entry_ID 15859 _Sample_condition_list.ID 4 _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 10 . mM 15859 4 pH 6.2 . pH 15859 4 pressure 1 . atm 15859 4 temperature 293 . K 15859 4 stop_ save_ save_sample_conditions_3 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_3 _Sample_condition_list.Entry_ID 15859 _Sample_condition_list.ID 5 _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 10 . mM 15859 5 pD 6.8 . pH 15859 5 pressure 1 . atm 15859 5 temperature 303 . K 15859 5 stop_ save_ save_sample_conditions_4 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_4 _Sample_condition_list.Entry_ID 15859 _Sample_condition_list.ID 6 _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 10 . mM 15859 6 pH 6.4 . pH 15859 6 pressure 1 . atm 15859 6 temperature 278 . K 15859 6 stop_ save_ ############################ # Computer software used # ############################ save_TOPSPIN _Software.Sf_category software _Software.Sf_framecode TOPSPIN _Software.Entry_ID 15859 _Software.ID 1 _Software.Name TOPSPIN _Software.Version '1.3, 2.0, 2.1' _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Bruker Biospin' . . 15859 1 stop_ loop_ _Task.Task _Task.Entry_ID _Task.Software_ID processing 15859 1 stop_ save_ save_SPARKY _Software.Sf_category software _Software.Sf_framecode SPARKY _Software.Entry_ID 15859 _Software.ID 2 _Software.Name SPARKY _Software.Version 3.1 _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID Goddard . . 15859 2 stop_ loop_ _Task.Task _Task.Entry_ID _Task.Software_ID 'chemical shift assignment' 15859 2 'data analysis' 15859 2 'peak picking' 15859 2 stop_ save_ save_DYANA _Software.Sf_category software _Software.Sf_framecode DYANA _Software.Entry_ID 15859 _Software.ID 3 _Software.Name DYANA _Software.Version 1.5 _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Guntert, Braun and Wuthrich' . . 15859 3 stop_ loop_ _Task.Task _Task.Entry_ID _Task.Software_ID 'structure solution' 15859 3 stop_ save_ save_CNSSOLVE _Software.Sf_category software _Software.Sf_framecode CNSSOLVE _Software.Entry_ID 15859 _Software.ID 4 _Software.Name CNSSOLVE _Software.Version 1.2 _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Brunger, Adams, Clore, Gros, Nilges and Read' . . 15859 4 stop_ loop_ _Task.Task _Task.Entry_ID _Task.Software_ID 'structure solution' 15859 4 stop_ save_ save_X-PLOR_NIH _Software.Sf_category software _Software.Sf_framecode X-PLOR_NIH _Software.Entry_ID 15859 _Software.ID 5 _Software.Name 'X-PLOR NIH' _Software.Version 2.16 _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Schwieters, Kuszewski, Tjandra and Clore' . . 15859 5 stop_ loop_ _Task.Task _Task.Entry_ID _Task.Software_ID refinement 15859 5 stop_ save_ ######################### # Experimental detail # ######################### ################################## # NMR Spectrometer definitions # ################################## save_spectrometer_1 _NMR_spectrometer.Sf_category NMR_spectrometer _NMR_spectrometer.Sf_framecode spectrometer_1 _NMR_spectrometer.Entry_ID 15859 _NMR_spectrometer.ID 1 _NMR_spectrometer.Details 'equipped with a CRYO TXI (1H; 13C; 15N) with an actively shielded z-gradient coil' _NMR_spectrometer.Manufacturer Bruker _NMR_spectrometer.Model Avance _NMR_spectrometer.Serial_number . _NMR_spectrometer.Field_strength 700 save_ save_NMR_spectrometer_list _NMR_spectrometer_list.Sf_category NMR_spectrometer_list _NMR_spectrometer_list.Sf_framecode NMR_spectrometer_list _NMR_spectrometer_list.Entry_ID 15859 _NMR_spectrometer_list.ID 1 loop_ _NMR_spectrometer_view.ID _NMR_spectrometer_view.Name _NMR_spectrometer_view.Manufacturer _NMR_spectrometer_view.Model _NMR_spectrometer_view.Serial_number _NMR_spectrometer_view.Field_strength _NMR_spectrometer_view.Details _NMR_spectrometer_view.Citation_ID _NMR_spectrometer_view.Citation_label _NMR_spectrometer_view.Entry_ID _NMR_spectrometer_view.NMR_spectrometer_list_ID 1 spectrometer_1 Bruker Avance . 700 'equipped with a CRYO TXI (1H; 13C; 15N) with an actively shielded z-gradient coil' . . 15859 1 stop_ save_ ############################# # NMR applied experiments # ############################# save_experiment_list _Experiment_list.Sf_category experiment_list _Experiment_list.Sf_framecode experiment_list _Experiment_list.Entry_ID 15859 _Experiment_list.ID 1 _Experiment_list.Details . loop_ _Experiment.ID _Experiment.Name _Experiment.Raw_data_flag _Experiment.NMR_spec_expt_ID _Experiment.NMR_spec_expt_label _Experiment.MS_expt_ID _Experiment.MS_expt_label _Experiment.SAXS_expt_ID _Experiment.SAXS_expt_label _Experiment.FRET_expt_ID _Experiment.FRET_expt_label _Experiment.EMR_expt_ID _Experiment.EMR_expt_label _Experiment.Sample_ID _Experiment.Sample_label _Experiment.Sample_state _Experiment.Sample_volume _Experiment.Sample_volume_units _Experiment.Sample_condition_list_ID _Experiment.Sample_condition_list_label _Experiment.Sample_spinning_rate _Experiment.Sample_angle _Experiment.NMR_tube_type _Experiment.NMR_spectrometer_ID _Experiment.NMR_spectrometer_label _Experiment.NMR_spectrometer_probe_ID _Experiment.NMR_spectrometer_probe_label _Experiment.NMR_spectral_processing_ID _Experiment.NMR_spectral_processing_label _Experiment.Mass_spectrometer_ID _Experiment.Mass_spectrometer_label _Experiment.Xray_instrument_ID _Experiment.Xray_instrument_label _Experiment.Fluorescence_instrument_ID _Experiment.Fluorescence_instrument_label _Experiment.EMR_instrument_ID _Experiment.EMR_instrument_label _Experiment.Chromatographic_system_ID _Experiment.Chromatographic_system_label _Experiment.Chromatographic_column_ID _Experiment.Chromatographic_column_label _Experiment.Entry_ID _Experiment.Experiment_list_ID 1 '2D 1H-1H NOESY' no . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . 1 $spectrometer_1 . . . . . . . . . . . . . . . . 15859 1 2 '2D 1H-1H TOCSY' no . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . 1 $spectrometer_1 . . . . . . . . . . . . . . . . 15859 1 3 '2D 1H-1H NOESY' no . . . . . . . . . . 2 $sample_2 isotropic . . 3 $sample_conditions_2 . . . 1 $spectrometer_1 . . . . . . . . . . . . . . . . 15859 1 4 '2D 1H-13C HSQC' no . . . . . . . . . . 3 $sample_3 isotropic . . 5 $sample_conditions_3 . . . 1 $spectrometer_1 . . . . . . . . . . . . . . . . 15859 1 5 '2D 1H-15N HSQC' no . . . . . . . . . . 4 $sample_4 isotropic . . 6 $sample_conditions_4 . . . 1 $spectrometer_1 . . . . . . . . . . . . . . . . 15859 1 6 '2D JNN HNN-COSY' no . . . . . . . . . . 4 $sample_4 isotropic . . 6 $sample_conditions_4 . . . 1 $spectrometer_1 . . . . . . . . . . . . . . . . 15859 1 stop_ save_ #################### # NMR parameters # #################### ############################## # Assigned chemical shifts # ############################## ################################ # Chemical shift referencing # ################################ save_chemical_shift_reference_1 _Chem_shift_reference.Sf_category chem_shift_reference _Chem_shift_reference.Sf_framecode chemical_shift_reference_1 _Chem_shift_reference.Entry_ID 15859 _Chem_shift_reference.ID 1 _Chem_shift_reference.Details . loop_ _Chem_shift_ref.Atom_type _Chem_shift_ref.Atom_isotope_number _Chem_shift_ref.Mol_common_name _Chem_shift_ref.Atom_group _Chem_shift_ref.Concentration_val _Chem_shift_ref.Concentration_units _Chem_shift_ref.Solvent _Chem_shift_ref.Rank _Chem_shift_ref.Chem_shift_units _Chem_shift_ref.Chem_shift_val _Chem_shift_ref.Ref_method _Chem_shift_ref.Ref_type _Chem_shift_ref.Indirect_shift_ratio _Chem_shift_ref.External_ref_loc _Chem_shift_ref.External_ref_sample_geometry _Chem_shift_ref.External_ref_axis _Chem_shift_ref.Indirect_shift_ratio_cit_ID _Chem_shift_ref.Indirect_shift_ratio_cit_label _Chem_shift_ref.Ref_correction_type _Chem_shift_ref.Correction_val _Chem_shift_ref.Correction_val_cit_ID _Chem_shift_ref.Correction_val_cit_label _Chem_shift_ref.Entry_ID _Chem_shift_ref.Chem_shift_reference_ID C 13 DSS 'methyl protons' . . . . ppm 0.00 . indirect 0.251449530 . . . . . . . . . 15859 1 H 1 DSS 'methyl protons' . . . . ppm 0.00 internal direct 1.000000000 . . . . . . . . . 15859 1 N 15 DSS 'methyl protons' . . . . ppm 0.00 . indirect 0.101329118 . . . . . . . . . 15859 1 stop_ save_ ################################### # Assigned chemical shift lists # ################################### ################################################################### # Chemical Shift Ambiguity Index Value Definitions # # # # The values other than 1 are used for those atoms with different # # chemical shifts that cannot be assigned to stereospecific atoms # # or to specific residues or chains. # # # # Index Value Definition # # # # 1 Unique (including isolated methyl protons, # # geminal atoms, and geminal methyl # # groups with identical chemical shifts) # # (e.g. ILE HD11, HD12, HD13 protons) # # 2 Ambiguity of geminal atoms or geminal methyl # # proton groups (e.g. ASP HB2 and HB3 # # protons, LEU CD1 and CD2 carbons, or # # LEU HD11, HD12, HD13 and HD21, HD22, # # HD23 methyl protons) # # 3 Aromatic atoms on opposite sides of # # symmetrical rings (e.g. TYR HE1 and HE2 # # protons) # # 4 Intraresidue ambiguities (e.g. LYS HG and # # HD protons or TRP HZ2 and HZ3 protons) # # 5 Interresidue ambiguities (LYS 12 vs. LYS 27) # # 6 Intermolecular ambiguities (e.g. ASP 31 CA # # in monomer 1 and ASP 31 CA in monomer 2 # # of an asymmetrical homodimer, duplex # # DNA assignments, or other assignments # # that may apply to atoms in one or more # # molecule in the molecular assembly) # # 9 Ambiguous, specific ambiguity not defined # # # ################################################################### save_assigned_chem_shift_list_1 _Assigned_chem_shift_list.Sf_category assigned_chemical_shifts _Assigned_chem_shift_list.Sf_framecode assigned_chem_shift_list_1 _Assigned_chem_shift_list.Entry_ID 15859 _Assigned_chem_shift_list.ID 1 _Assigned_chem_shift_list.Sample_condition_list_ID 1 _Assigned_chem_shift_list.Sample_condition_list_label $sample_conditions_1 _Assigned_chem_shift_list.Chem_shift_reference_ID 1 _Assigned_chem_shift_list.Chem_shift_reference_label $chemical_shift_reference_1 _Assigned_chem_shift_list.Chem_shift_1H_err . _Assigned_chem_shift_list.Chem_shift_13C_err . _Assigned_chem_shift_list.Chem_shift_15N_err . _Assigned_chem_shift_list.Chem_shift_31P_err . _Assigned_chem_shift_list.Chem_shift_2H_err . _Assigned_chem_shift_list.Chem_shift_19F_err . _Assigned_chem_shift_list.Error_derivation_method . _Assigned_chem_shift_list.Details . _Assigned_chem_shift_list.Text_data_format . _Assigned_chem_shift_list.Text_data . loop_ _Chem_shift_experiment.Experiment_ID _Chem_shift_experiment.Experiment_name _Chem_shift_experiment.Sample_ID _Chem_shift_experiment.Sample_label _Chem_shift_experiment.Sample_state _Chem_shift_experiment.Entry_ID _Chem_shift_experiment.Assigned_chem_shift_list_ID 1 '2D 1H-1H NOESY' . . . 15859 1 3 '2D 1H-1H NOESY' . . . 15859 1 4 '2D 1H-13C HSQC' . . . 15859 1 5 '2D 1H-15N HSQC' . . . 15859 1 stop_ loop_ _Atom_chem_shift.ID _Atom_chem_shift.Assembly_atom_ID _Atom_chem_shift.Entity_assembly_ID _Atom_chem_shift.Entity_ID _Atom_chem_shift.Comp_index_ID _Atom_chem_shift.Seq_ID _Atom_chem_shift.Comp_ID _Atom_chem_shift.Atom_ID _Atom_chem_shift.Atom_type _Atom_chem_shift.Atom_isotope_number _Atom_chem_shift.Val _Atom_chem_shift.Val_err _Atom_chem_shift.Assign_fig_of_merit _Atom_chem_shift.Ambiguity_code _Atom_chem_shift.Occupancy _Atom_chem_shift.Resonance_ID _Atom_chem_shift.Auth_entity_assembly_ID _Atom_chem_shift.Auth_asym_ID _Atom_chem_shift.Auth_seq_ID _Atom_chem_shift.Auth_comp_ID _Atom_chem_shift.Auth_atom_ID _Atom_chem_shift.Details _Atom_chem_shift.Entry_ID _Atom_chem_shift.Assigned_chem_shift_list_ID 1 . 1 1 1 1 G H1 H 1 12.462 0.005 . 1 . . . . 1 G H1 . 15859 1 2 . 1 1 1 1 G H1' H 1 5.781 0.005 . 1 . . . . 1 G H1' . 15859 1 3 . 1 1 1 1 G H2' H 1 4.883 0.005 . 1 . . . . 1 G H2' . 15859 1 4 . 1 1 1 1 G H3' H 1 4.655 0.005 . 1 . . . . 1 G H3' . 15859 1 5 . 1 1 1 1 G H4' H 1 4.514 0.005 . 1 . . . . 1 G H4' . 15859 1 6 . 1 1 1 1 G H5' H 1 4.365 0.005 . 1 . . . . 1 G H5' . 15859 1 7 . 1 1 1 1 G H5'' H 1 4.229 0.005 . 1 . . . . 1 G H5'' . 15859 1 8 . 1 1 1 1 G H8 H 1 8.074 0.005 . 1 . . . . 1 G H8 . 15859 1 9 . 1 1 1 1 G H21 H 1 7.891 0.005 . 1 . . . . 1 G H21 . 15859 1 10 . 1 1 1 1 G H22 H 1 5.604 0.005 . 1 . . . . 1 G H22 . 15859 1 11 . 1 1 1 1 G C1' C 13 88.78 0.05 . 1 . . . . 1 G C1' . 15859 1 12 . 1 1 1 1 G C8 C 13 136.31 0.05 . 1 . . . . 1 G C8 . 15859 1 13 . 1 1 1 1 G N1 N 15 146.59 0.05 . 1 . . . . 1 G N1 . 15859 1 14 . 1 1 2 2 G H1 H 1 12.085 0.005 . 1 . . . . 2 G H1 . 15859 1 15 . 1 1 2 2 G H1' H 1 5.854 0.005 . 1 . . . . 2 G H1' . 15859 1 16 . 1 1 2 2 G H2' H 1 4.652 0.005 . 1 . . . . 2 G H2' . 15859 1 17 . 1 1 2 2 G H3' H 1 4.528 0.005 . 1 . . . . 2 G H3' . 15859 1 18 . 1 1 2 2 G H4' H 1 4.547 0.005 . 1 . . . . 2 G H4' . 15859 1 19 . 1 1 2 2 G H5' H 1 4.437 0.005 . 1 . . . . 2 G H5' . 15859 1 20 . 1 1 2 2 G H5'' H 1 4.233 0.005 . 1 . . . . 2 G H5'' . 15859 1 21 . 1 1 2 2 G H8 H 1 7.489 0.005 . 1 . . . . 2 G H8 . 15859 1 22 . 1 1 2 2 G H21 H 1 7.822 0.005 . 1 . . . . 2 G H21 . 15859 1 23 . 1 1 2 2 G H22 H 1 5.665 0.005 . 1 . . . . 2 G H22 . 15859 1 24 . 1 1 2 2 G C1' C 13 90.06 0.05 . 1 . . . . 2 G C1' . 15859 1 25 . 1 1 2 2 G C8 C 13 136.72 0.05 . 1 . . . . 2 G C8 . 15859 1 26 . 1 1 2 2 G N1 N 15 146.26 0.05 . 1 . . . . 2 G N1 . 15859 1 27 . 1 1 3 3 A H1' H 1 5.954 0.005 . 1 . . . . 3 A H1' . 15859 1 28 . 1 1 3 3 A H2 H 1 7.465 0.005 . 1 . . . . 3 A H2 . 15859 1 29 . 1 1 3 3 A H2' H 1 4.716 0.005 . 1 . . . . 3 A H2' . 15859 1 30 . 1 1 3 3 A H3' H 1 4.590 0.005 . 1 . . . . 3 A H3' . 15859 1 31 . 1 1 3 3 A H4' H 1 4.487 0.005 . 1 . . . . 3 A H4' . 15859 1 32 . 1 1 3 3 A H5'' H 1 4.127 0.005 . 1 . . . . 3 A H5'' . 15859 1 33 . 1 1 3 3 A H8 H 1 7.710 0.005 . 1 . . . . 3 A H8 . 15859 1 34 . 1 1 3 3 A H61 H 1 8.049 0.005 . 1 . . . . 3 A H61 . 15859 1 35 . 1 1 3 3 A H62 H 1 6.710 0.005 . 1 . . . . 3 A H62 . 15859 1 36 . 1 1 3 3 A C1' C 13 90.2 0.05 . 1 . . . . 3 A C1' . 15859 1 37 . 1 1 3 3 A C2 C 13 150.65 0.05 . 1 . . . . 3 A C2 . 15859 1 38 . 1 1 3 3 A C8 C 13 137 0.05 . 1 . . . . 3 A C8 . 15859 1 39 . 1 1 4 4 G H1 H 1 13.040 0.005 . 1 . . . . 4 G H1 . 15859 1 40 . 1 1 4 4 G H1' H 1 5.511 0.005 . 1 . . . . 4 G H1' . 15859 1 41 . 1 1 4 4 G H2' H 1 4.390 0.005 . 1 . . . . 4 G H2' . 15859 1 42 . 1 1 4 4 G H3' H 1 4.289 0.005 . 1 . . . . 4 G H3' . 15859 1 43 . 1 1 4 4 G H4' H 1 4.434 0.005 . 1 . . . . 4 G H4' . 15859 1 44 . 1 1 4 4 G H5' H 1 4.370 0.005 . 1 . . . . 4 G H5' . 15859 1 45 . 1 1 4 4 G H5'' H 1 3.997 0.005 . 1 . . . . 4 G H5'' . 15859 1 46 . 1 1 4 4 G H8 H 1 7.012 0.005 . 1 . . . . 4 G H8 . 15859 1 47 . 1 1 4 4 G H21 H 1 8.082 0.005 . 1 . . . . 4 G H21 . 15859 1 48 . 1 1 4 4 G H22 H 1 5.943 0.005 . 1 . . . . 4 G H22 . 15859 1 49 . 1 1 4 4 G C1' C 13 90.23 0.05 . 1 . . . . 4 G C1' . 15859 1 50 . 1 1 4 4 G C8 C 13 133.23 0.05 . 1 . . . . 4 G C8 . 15859 1 51 . 1 1 4 4 G N1 N 15 147.44 0.05 . 1 . . . . 4 G N1 . 15859 1 52 . 1 1 5 5 U H1' H 1 5.485 0.005 . 1 . . . . 5 U H1' . 15859 1 53 . 1 1 5 5 U H2' H 1 4.558 0.005 . 1 . . . . 5 U H2' . 15859 1 54 . 1 1 5 5 U H3 H 1 13.209 0.005 . 1 . . . . 5 U H3 . 15859 1 55 . 1 1 5 5 U H3' H 1 4.510 0.005 . 1 . . . . 5 U H3' . 15859 1 56 . 1 1 5 5 U H4' H 1 4.412 0.005 . 1 . . . . 5 U H4' . 15859 1 57 . 1 1 5 5 U H5 H 1 5.058 0.005 . 1 . . . . 5 U H5 . 15859 1 58 . 1 1 5 5 U H5'' H 1 4.053 0.005 . 1 . . . . 5 U H5'' . 15859 1 59 . 1 1 5 5 U H6 H 1 7.629 0.005 . 1 . . . . 5 U H6 . 15859 1 60 . 1 1 5 5 U C1' C 13 90.81 0.05 . 1 . . . . 5 U C1' . 15859 1 61 . 1 1 5 5 U C5 C 13 100.44 0.05 . 1 . . . . 5 U C5 . 15859 1 62 . 1 1 5 5 U C6 C 13 138.42 0.05 . 1 . . . . 5 U C6 . 15859 1 63 . 1 1 5 5 U N3 N 15 161.24 0.05 . 1 . . . . 5 U N3 . 15859 1 64 . 1 1 6 6 A H1' H 1 5.959 0.005 . 1 . . . . 6 A H1' . 15859 1 65 . 1 1 6 6 A H2 H 1 7.007 0.005 . 1 . . . . 6 A H2 . 15859 1 66 . 1 1 6 6 A H2' H 1 4.443 0.005 . 1 . . . . 6 A H2' . 15859 1 67 . 1 1 6 6 A H3' H 1 4.619 0.005 . 1 . . . . 6 A H3' . 15859 1 68 . 1 1 6 6 A H4' H 1 4.525 0.005 . 1 . . . . 6 A H4' . 15859 1 69 . 1 1 6 6 A H5'' H 1 4.137 0.005 . 1 . . . . 6 A H5'' . 15859 1 70 . 1 1 6 6 A H8 H 1 8.111 0.005 . 1 . . . . 6 A H8 . 15859 1 71 . 1 1 6 6 A H61 H 1 7.573 0.005 . 1 . . . . 6 A H61 . 15859 1 72 . 1 1 6 6 A H62 H 1 6.181 0.005 . 1 . . . . 6 A H62 . 15859 1 73 . 1 1 6 6 A C1' C 13 88.76 0.05 . 1 . . . . 6 A C1' . 15859 1 74 . 1 1 6 6 A C2 C 13 150.5 0.05 . 1 . . . . 6 A C2 . 15859 1 75 . 1 1 6 6 A C8 C 13 137.07 0.05 . 1 . . . . 6 A C8 . 15859 1 76 . 1 1 7 7 U H1' H 1 5.382 0.005 . 1 . . . . 7 U H1' . 15859 1 77 . 1 1 7 7 U H2' H 1 4.396 0.005 . 1 . . . . 7 U H2' . 15859 1 78 . 1 1 7 7 U H3 H 1 13.137 0.005 . 1 . . . . 7 U H3 . 15859 1 79 . 1 1 7 7 U H4' H 1 4.486 0.005 . 1 . . . . 7 U H4' . 15859 1 80 . 1 1 7 7 U H5 H 1 4.985 0.005 . 1 . . . . 7 U H5 . 15859 1 81 . 1 1 7 7 U H6 H 1 7.554 0.005 . 1 . . . . 7 U H6 . 15859 1 82 . 1 1 7 7 U C1' C 13 90.42 0.05 . 1 . . . . 7 U C1' . 15859 1 83 . 1 1 7 7 U C5 C 13 100.46 0.05 . 1 . . . . 7 U C5 . 15859 1 84 . 1 1 7 7 U C6 C 13 137.54 0.05 . 1 . . . . 7 U C6 . 15859 1 85 . 1 1 7 7 U N3 N 15 161.52 0.05 . 1 . . . . 7 U N3 . 15859 1 86 . 1 1 8 8 G H1 H 1 12.298 0.005 . 1 . . . . 8 G H1 . 15859 1 87 . 1 1 8 8 G H1' H 1 5.719 0.005 . 1 . . . . 8 G H1' . 15859 1 88 . 1 1 8 8 G H2' H 1 4.403 0.005 . 1 . . . . 8 G H2' . 15859 1 89 . 1 1 8 8 G H3' H 1 4.431 0.005 . 1 . . . . 8 G H3' . 15859 1 90 . 1 1 8 8 G H5'' H 1 4.058 0.005 . 1 . . . . 8 G H5'' . 15859 1 91 . 1 1 8 8 G H8 H 1 7.507 0.005 . 1 . . . . 8 G H8 . 15859 1 92 . 1 1 8 8 G H21 H 1 7.628 0.005 . 1 . . . . 8 G H21 . 15859 1 93 . 1 1 8 8 G H22 H 1 5.726 0.005 . 1 . . . . 8 G H22 . 15859 1 94 . 1 1 8 8 G C1' C 13 90.05 0.05 . 1 . . . . 8 G C1' . 15859 1 95 . 1 1 8 8 G C8 C 13 133.19 0.05 . 1 . . . . 8 G C8 . 15859 1 96 . 1 1 8 8 G N1 N 15 146.55 0.05 . 1 . . . . 8 G N1 . 15859 1 97 . 1 1 9 9 U H1' H 1 5.351 0.005 . 1 . . . . 9 U H1' . 15859 1 98 . 1 1 9 9 U H2' H 1 4.184 0.005 . 1 . . . . 9 U H2' . 15859 1 99 . 1 1 9 9 U H3 H 1 11.203 0.005 . 1 . . . . 9 U H3 . 15859 1 100 . 1 1 9 9 U H3' H 1 4.418 0.005 . 1 . . . . 9 U H3' . 15859 1 101 . 1 1 9 9 U H4' H 1 4.299 0.005 . 1 . . . . 9 U H4' . 15859 1 102 . 1 1 9 9 U H5 H 1 5.312 0.005 . 1 . . . . 9 U H5 . 15859 1 103 . 1 1 9 9 U H5' H 1 4.050 0.005 . 1 . . . . 9 U H5' . 15859 1 104 . 1 1 9 9 U H5'' H 1 4.018 0.005 . 1 . . . . 9 U H5'' . 15859 1 105 . 1 1 9 9 U H6 H 1 7.488 0.005 . 1 . . . . 9 U H6 . 15859 1 106 . 1 1 9 9 U C1' C 13 90.96 0.05 . 1 . . . . 9 U C1' . 15859 1 107 . 1 1 9 9 U C5 C 13 102.01 0.05 . 1 . . . . 9 U C5 . 15859 1 108 . 1 1 9 9 U C6 C 13 134.31 0.05 . 1 . . . . 9 U C6 . 15859 1 109 . 1 1 9 9 U N3 N 15 156.77 0.05 . 1 . . . . 9 U N3 . 15859 1 110 . 1 1 10 10 G H1 H 1 10.387 0.005 . 1 . . . . 10 G H1 . 15859 1 111 . 1 1 10 10 G H1' H 1 5.555 0.005 . 1 . . . . 10 G H1' . 15859 1 112 . 1 1 10 10 G H2' H 1 4.510 0.005 . 1 . . . . 10 G H2' . 15859 1 113 . 1 1 10 10 G H3' H 1 4.666 0.005 . 1 . . . . 10 G H3' . 15859 1 114 . 1 1 10 10 G H4' H 1 4.402 0.005 . 1 . . . . 10 G H4' . 15859 1 115 . 1 1 10 10 G H5' H 1 4.331 0.005 . 1 . . . . 10 G H5' . 15859 1 116 . 1 1 10 10 G H5'' H 1 4.053 0.005 . 1 . . . . 10 G H5'' . 15859 1 117 . 1 1 10 10 G H8 H 1 7.656 0.005 . 1 . . . . 10 G H8 . 15859 1 118 . 1 1 10 10 G H22 H 1 5.931 0.005 . 1 . . . . 10 G H22 . 15859 1 119 . 1 1 10 10 G C1' C 13 88.87 0.05 . 1 . . . . 10 G C1' . 15859 1 120 . 1 1 10 10 G C8 C 13 134.2 0.05 . 1 . . . . 10 G C8 . 15859 1 121 . 1 1 10 10 G N1 N 15 145.59 0.05 . 1 . . . . 10 G N1 . 15859 1 122 . 1 1 11 11 A H1' H 1 5.628 0.005 . 1 . . . . 11 A H1' . 15859 1 123 . 1 1 11 11 A H2 H 1 7.764 0.005 . 1 . . . . 11 A H2 . 15859 1 124 . 1 1 11 11 A H2' H 1 4.617 0.005 . 1 . . . . 11 A H2' . 15859 1 125 . 1 1 11 11 A H3' H 1 4.428 0.005 . 1 . . . . 11 A H3' . 15859 1 126 . 1 1 11 11 A H4' H 1 4.089 0.005 . 1 . . . . 11 A H4' . 15859 1 127 . 1 1 11 11 A H5'' H 1 3.936 0.005 . 1 . . . . 11 A H5'' . 15859 1 128 . 1 1 11 11 A H8 H 1 8.296 0.005 . 1 . . . . 11 A H8 . 15859 1 129 . 1 1 11 11 A C1' C 13 88.71 0.05 . 1 . . . . 11 A C1' . 15859 1 130 . 1 1 11 11 A C2 C 13 151.66 0.05 . 1 . . . . 11 A C2 . 15859 1 131 . 1 1 11 11 A C8 C 13 139.59 0.05 . 1 . . . . 11 A C8 . 15859 1 132 . 1 1 12 12 A H1' H 1 5.465 0.005 . 1 . . . . 12 A H1' . 15859 1 133 . 1 1 12 12 A H2 H 1 7.700 0.005 . 1 . . . . 12 A H2 . 15859 1 134 . 1 1 12 12 A H2' H 1 4.365 0.005 . 1 . . . . 12 A H2' . 15859 1 135 . 1 1 12 12 A H3' H 1 4.583 0.005 . 1 . . . . 12 A H3' . 15859 1 136 . 1 1 12 12 A H4' H 1 4.266 0.005 . 1 . . . . 12 A H4' . 15859 1 137 . 1 1 12 12 A H5' H 1 3.962 0.005 . 1 . . . . 12 A H5' . 15859 1 138 . 1 1 12 12 A H5'' H 1 3.855 0.005 . 1 . . . . 12 A H5'' . 15859 1 139 . 1 1 12 12 A H8 H 1 7.914 0.005 . 1 . . . . 12 A H8 . 15859 1 140 . 1 1 12 12 A C1' C 13 89.44 0.05 . 1 . . . . 12 A C1' . 15859 1 141 . 1 1 12 12 A C2 C 13 151.75 0.05 . 1 . . . . 12 A C2 . 15859 1 142 . 1 1 13 13 A H1' H 1 5.984 0.005 . 1 . . . . 13 A H1' . 15859 1 143 . 1 1 13 13 A H2 H 1 8.087 0.005 . 1 . . . . 13 A H2 . 15859 1 144 . 1 1 13 13 A H2' H 1 4.586 0.005 . 1 . . . . 13 A H2' . 15859 1 145 . 1 1 13 13 A H3' H 1 5.005 0.005 . 1 . . . . 13 A H3' . 15859 1 146 . 1 1 13 13 A H4' H 1 4.454 0.005 . 1 . . . . 13 A H4' . 15859 1 147 . 1 1 13 13 A H5'' H 1 4.275 0.005 . 1 . . . . 13 A H5'' . 15859 1 148 . 1 1 13 13 A H8 H 1 8.153 0.005 . 1 . . . . 13 A H8 . 15859 1 149 . 1 1 13 13 A C1' C 13 90.02 0.05 . 1 . . . . 13 A C1' . 15859 1 150 . 1 1 13 13 A C2 C 13 152.71 0.05 . 1 . . . . 13 A C2 . 15859 1 151 . 1 1 13 13 A C8 C 13 137.92 0.05 . 1 . . . . 13 A C8 . 15859 1 152 . 1 1 14 14 G H1 H 1 10.983 0.005 . 1 . . . . 14 G H1 . 15859 1 153 . 1 1 14 14 G H1' H 1 4.053 0.005 . 1 . . . . 14 G H1' . 15859 1 154 . 1 1 14 14 G H2' H 1 4.331 0.005 . 1 . . . . 14 G H2' . 15859 1 155 . 1 1 14 14 G H3' H 1 4.266 0.005 . 1 . . . . 14 G H3' . 15859 1 156 . 1 1 14 14 G H5'' H 1 3.914 0.005 . 1 . . . . 14 G H5'' . 15859 1 157 . 1 1 14 14 G H8 H 1 7.701 0.005 . 1 . . . . 14 G H8 . 15859 1 158 . 1 1 14 14 G H21 H 1 8.070 0.005 . 1 . . . . 14 G H21 . 15859 1 159 . 1 1 14 14 G H22 H 1 5.937 0.005 . 1 . . . . 14 G H22 . 15859 1 160 . 1 1 14 14 G C8 C 13 134.68 0.05 . 1 . . . . 14 G C8 . 15859 1 161 . 1 1 14 14 G N1 N 15 144.07 0.05 . 1 . . . . 14 G N1 . 15859 1 162 . 1 1 15 15 C H1' H 1 5.360 0.005 . 1 . . . . 15 C H1' . 15859 1 163 . 1 1 15 15 C H2' H 1 4.371 0.005 . 1 . . . . 15 C H2' . 15859 1 164 . 1 1 15 15 C H3' H 1 4.482 0.005 . 1 . . . . 15 C H3' . 15859 1 165 . 1 1 15 15 C H5 H 1 5.288 0.005 . 1 . . . . 15 C H5 . 15859 1 166 . 1 1 15 15 C H6 H 1 7.569 0.005 . 1 . . . . 15 C H6 . 15859 1 167 . 1 1 15 15 C H41 H 1 8.072 0.005 . 1 . . . . 15 C H41 . 15859 1 168 . 1 1 15 15 C H42 H 1 6.702 0.005 . 1 . . . . 15 C H42 . 15859 1 169 . 1 1 15 15 C C1' C 13 90.59 0.05 . 1 . . . . 15 C C1' . 15859 1 170 . 1 1 15 15 C C5 C 13 94.75 0.05 . 1 . . . . 15 C C5 . 15859 1 171 . 1 1 15 15 C C6 C 13 138.53 0.05 . 1 . . . . 15 C C6 . 15859 1 172 . 1 1 16 16 A H1' H 1 5.880 0.005 . 1 . . . . 16 A H1' . 15859 1 173 . 1 1 16 16 A H2 H 1 7.208 0.005 . 1 . . . . 16 A H2 . 15859 1 174 . 1 1 16 16 A H2' H 1 4.412 0.005 . 1 . . . . 16 A H2' . 15859 1 175 . 1 1 16 16 A H3' H 1 4.643 0.005 . 1 . . . . 16 A H3' . 15859 1 176 . 1 1 16 16 A H4' H 1 4.443 0.005 . 1 . . . . 16 A H4' . 15859 1 177 . 1 1 16 16 A H5'' H 1 4.091 0.005 . 1 . . . . 16 A H5'' . 15859 1 178 . 1 1 16 16 A H8 H 1 7.983 0.005 . 1 . . . . 16 A H8 . 15859 1 179 . 1 1 16 16 A H61 H 1 7.559 0.005 . 1 . . . . 16 A H61 . 15859 1 180 . 1 1 16 16 A H62 H 1 6.180 0.005 . 1 . . . . 16 A H62 . 15859 1 181 . 1 1 16 16 A C1' C 13 90.35 0.05 . 1 . . . . 16 A C1' . 15859 1 182 . 1 1 16 16 A C2 C 13 150.45 0.05 . 1 . . . . 16 A C2 . 15859 1 183 . 1 1 16 16 A C8 C 13 136.9 0.05 . 1 . . . . 16 A C8 . 15859 1 184 . 1 1 17 17 U H1' H 1 5.382 0.005 . 1 . . . . 17 U H1' . 15859 1 185 . 1 1 17 17 U H2' H 1 4.336 0.005 . 1 . . . . 17 U H2' . 15859 1 186 . 1 1 17 17 U H3 H 1 12.918 0.005 . 1 . . . . 17 U H3 . 15859 1 187 . 1 1 17 17 U H3' H 1 4.444 0.005 . 1 . . . . 17 U H3' . 15859 1 188 . 1 1 17 17 U H4' H 1 4.378 0.005 . 1 . . . . 17 U H4' . 15859 1 189 . 1 1 17 17 U H5 H 1 5.052 0.005 . 1 . . . . 17 U H5 . 15859 1 190 . 1 1 17 17 U H6 H 1 7.569 0.005 . 1 . . . . 17 U H6 . 15859 1 191 . 1 1 17 17 U C1' C 13 90.28 0.05 . 1 . . . . 17 U C1' . 15859 1 192 . 1 1 17 17 U C5 C 13 100.11 0.05 . 1 . . . . 17 U C5 . 15859 1 193 . 1 1 17 17 U C6 C 13 138.04 0.05 . 1 . . . . 17 U C6 . 15859 1 194 . 1 1 17 17 U N3 N 15 160.68 0.05 . 1 . . . . 17 U N3 . 15859 1 195 . 1 1 18 18 A H1' H 1 5.933 0.005 . 1 . . . . 18 A H1' . 15859 1 196 . 1 1 18 18 A H2 H 1 7.083 0.005 . 1 . . . . 18 A H2 . 15859 1 197 . 1 1 18 18 A H2' H 1 4.484 0.005 . 1 . . . . 18 A H2' . 15859 1 198 . 1 1 18 18 A H3' H 1 4.601 0.005 . 1 . . . . 18 A H3' . 15859 1 199 . 1 1 18 18 A H4' H 1 4.456 0.005 . 1 . . . . 18 A H4' . 15859 1 200 . 1 1 18 18 A H5'' H 1 4.116 0.005 . 1 . . . . 18 A H5'' . 15859 1 201 . 1 1 18 18 A H8 H 1 8.067 0.005 . 1 . . . . 18 A H8 . 15859 1 202 . 1 1 18 18 A H61 H 1 7.658 0.005 . 1 . . . . 18 A H61 . 15859 1 203 . 1 1 18 18 A H62 H 1 6.165 0.005 . 1 . . . . 18 A H62 . 15859 1 204 . 1 1 18 18 A C1' C 13 90.04 0.05 . 1 . . . . 18 A C1' . 15859 1 205 . 1 1 18 18 A C2 C 13 150.68 0.05 . 1 . . . . 18 A C2 . 15859 1 206 . 1 1 18 18 A C8 C 13 136.92 0.05 . 1 . . . . 18 A C8 . 15859 1 207 . 1 1 19 19 C H1' H 1 5.298 0.005 . 1 . . . . 19 C H1' . 15859 1 208 . 1 1 19 19 C H2' H 1 4.142 0.005 . 1 . . . . 19 C H2' . 15859 1 209 . 1 1 19 19 C H3' H 1 4.283 0.005 . 1 . . . . 19 C H3' . 15859 1 210 . 1 1 19 19 C H4' H 1 4.349 0.005 . 1 . . . . 19 C H4' . 15859 1 211 . 1 1 19 19 C H5 H 1 5.158 0.005 . 1 . . . . 19 C H5 . 15859 1 212 . 1 1 19 19 C H5'' H 1 4.014 0.005 . 1 . . . . 19 C H5'' . 15859 1 213 . 1 1 19 19 C H6 H 1 7.435 0.005 . 1 . . . . 19 C H6 . 15859 1 214 . 1 1 19 19 C H41 H 1 8.057 0.005 . 1 . . . . 19 C H41 . 15859 1 215 . 1 1 19 19 C H42 H 1 6.738 0.005 . 1 . . . . 19 C H42 . 15859 1 216 . 1 1 19 19 C C1' C 13 91.07 0.05 . 1 . . . . 19 C C1' . 15859 1 217 . 1 1 19 19 C C5 C 13 94.46 0.05 . 1 . . . . 19 C C5 . 15859 1 218 . 1 1 19 19 C C6 C 13 137.88 0.05 . 1 . . . . 19 C C6 . 15859 1 219 . 1 1 20 20 U H1' H 1 5.488 0.005 . 1 . . . . 20 U H1' . 15859 1 220 . 1 1 20 20 U H2' H 1 4.439 0.005 . 1 . . . . 20 U H2' . 15859 1 221 . 1 1 20 20 U H3 H 1 13.774 0.005 . 1 . . . . 20 U H3 . 15859 1 222 . 1 1 20 20 U H3' H 1 4.469 0.005 . 1 . . . . 20 U H3' . 15859 1 223 . 1 1 20 20 U H5 H 1 5.267 0.005 . 1 . . . . 20 U H5 . 15859 1 224 . 1 1 20 20 U H5'' H 1 4.019 0.005 . 1 . . . . 20 U H5'' . 15859 1 225 . 1 1 20 20 U H6 H 1 7.837 0.005 . 1 . . . . 20 U H6 . 15859 1 226 . 1 1 20 20 U C1' C 13 91.07 0.05 . 1 . . . . 20 U C1' . 15859 1 227 . 1 1 20 20 U C5 C 13 100.5 0.05 . 1 . . . . 20 U C5 . 15859 1 228 . 1 1 20 20 U C6 C 13 139.81 0.05 . 1 . . . . 20 U C6 . 15859 1 229 . 1 1 20 20 U N1 N 15 162.1 0.05 . 1 . . . . 20 U N1 . 15859 1 230 . 1 1 21 21 C H1' H 1 5.544 0.005 . 1 . . . . 21 C H1' . 15859 1 231 . 1 1 21 21 C H2' H 1 4.160 0.005 . 1 . . . . 21 C H2' . 15859 1 232 . 1 1 21 21 C H3' H 1 4.367 0.005 . 1 . . . . 21 C H3' . 15859 1 233 . 1 1 21 21 C H5 H 1 5.589 0.005 . 1 . . . . 21 C H5 . 15859 1 234 . 1 1 21 21 C H5'' H 1 4.021 0.005 . 1 . . . . 21 C H5'' . 15859 1 235 . 1 1 21 21 C H6 H 1 7.853 0.005 . 1 . . . . 21 C H6 . 15859 1 236 . 1 1 21 21 C H41 H 1 8.051 0.005 . 1 . . . . 21 C H41 . 15859 1 237 . 1 1 21 21 C H42 H 1 6.703 0.005 . 1 . . . . 21 C H42 . 15859 1 238 . 1 1 21 21 C C1' C 13 91.5 0.05 . 1 . . . . 21 C C1' . 15859 1 239 . 1 1 21 21 C C5 C 13 94.56 0.05 . 1 . . . . 21 C C5 . 15859 1 240 . 1 1 21 21 C C6 C 13 139.02 0.05 . 1 . . . . 21 C C6 . 15859 1 241 . 1 1 22 22 C H1' H 1 5.681 0.005 . 1 . . . . 22 C H1' . 15859 1 242 . 1 1 22 22 C H2' H 1 3.936 0.005 . 1 . . . . 22 C H2' . 15859 1 243 . 1 1 22 22 C H3' H 1 4.117 0.005 . 1 . . . . 22 C H3' . 15859 1 244 . 1 1 22 22 C H4' H 1 4.441 0.005 . 1 . . . . 22 C H4' . 15859 1 245 . 1 1 22 22 C H5 H 1 5.436 0.005 . 1 . . . . 22 C H5 . 15859 1 246 . 1 1 22 22 C H5'' H 1 3.974 0.005 . 1 . . . . 22 C H5'' . 15859 1 247 . 1 1 22 22 C H6 H 1 7.608 0.005 . 1 . . . . 22 C H6 . 15859 1 248 . 1 1 22 22 C H41 H 1 7.950 0.005 . 1 . . . . 22 C H41 . 15859 1 249 . 1 1 22 22 C H42 H 1 6.710 0.005 . 1 . . . . 22 C H42 . 15859 1 250 . 1 1 22 22 C C1' C 13 90.04 0.05 . 1 . . . . 22 C C1' . 15859 1 251 . 1 1 22 22 C C5 C 13 95.33 0.05 . 1 . . . . 22 C C5 . 15859 1 252 . 1 1 22 22 C C6 C 13 139.45 0.05 . 1 . . . . 22 C C6 . 15859 1 stop_ save_