data_16980 ####################### # Entry information # ####################### save_entry_information _Entry.Sf_category entry_information _Entry.Sf_framecode entry_information _Entry.ID 16980 _Entry.Title ; RDC and RCSA refinement of an A-form RNA: Improvements in Major Groove Width ; _Entry.Type macromolecule _Entry.Version_type original _Entry.Submission_date 2010-06-07 _Entry.Accession_date 2010-06-07 _Entry.Last_release_date 2010-07-26 _Entry.Original_release_date 2010-07-26 _Entry.Origination author _Entry.NMR_STAR_version 3.1.1.61 _Entry.Original_NMR_STAR_version 3.0.9.13 _Entry.Experimental_method NMR _Entry.Experimental_method_subtype solution _Entry.Details . _Entry.BMRB_internal_directory_name . loop_ _Entry_author.Ordinal _Entry_author.Given_name _Entry_author.Family_name _Entry_author.First_initial _Entry_author.Middle_initials _Entry_author.Family_title _Entry_author.Entry_ID 1 Blanton Tolbert . S. . 16980 2 Michael Summers . F. . 16980 3 Yasuyuki Miyazaki . . . 16980 4 Shawn Barton . . . 16980 5 Benyam Kinde . . . 16980 6 Patrice Stark . . . 16980 7 Rashmi Singh . . . 16980 8 Ad Bax . . . 16980 9 David Case . . . 16980 stop_ loop_ _SG_project.SG_project_ID _SG_project.Project_name _SG_project.Full_name_of_center _SG_project.Initial_of_center _SG_project.Entry_ID 1 'not applicable' 'not applicable' . 16980 stop_ loop_ _Struct_keywords.Keywords _Struct_keywords.Text _Struct_keywords.Entry_ID 'A-form RNA' . 16980 'Moloney Murine Leukemia Virus Dimerization Signal' . 16980 'RDC and RCSA refinement' . 16980 'SLB duplex' . 16980 stop_ loop_ _Data_set.Type _Data_set.Count _Data_set.Entry_ID assigned_chemical_shifts 1 16980 stop_ loop_ _Datum.Type _Datum.Count _Datum.Entry_ID '1H chemical shifts' 77 16980 stop_ loop_ _Release.Release_number _Release.Format_type _Release.Format_version _Release.Date _Release.Submission_date _Release.Type _Release.Author _Release.Detail _Release.Entry_ID 1 . . 2010-07-26 2010-06-07 original author . 16980 stop_ loop_ _Related_entries.Database_name _Related_entries.Database_accession_code _Related_entries.Relationship _Related_entries.Entry_ID PDB 2KYD 'BMRB Entry Tracking System' 16980 stop_ save_ ############### # Citations # ############### save_entry_citation _Citation.Sf_category citations _Citation.Sf_framecode entry_citation _Citation.Entry_ID 16980 _Citation.ID 1 _Citation.Class 'entry citation' _Citation.CAS_abstract_code . _Citation.MEDLINE_UI_code . _Citation.DOI . _Citation.PubMed_ID 20549304 _Citation.Full_citation . _Citation.Title 'Major groove width variations in RNA structures determined by NMR and impact of 13C residual chemical shift anisotropy and 1H-13C residual dipolar coupling on refinement.' _Citation.Status published _Citation.Type journal _Citation.Journal_abbrev 'J. Biomol. NMR' _Citation.Journal_name_full 'Journal of biomolecular NMR' _Citation.Journal_volume 47 _Citation.Journal_issue 3 _Citation.Journal_ASTM . _Citation.Journal_ISSN . _Citation.Journal_CSD . _Citation.Book_title . _Citation.Book_chapter_title . _Citation.Book_volume . _Citation.Book_series . _Citation.Book_publisher . _Citation.Book_publisher_city . _Citation.Book_ISBN . _Citation.Conference_title . _Citation.Conference_site . _Citation.Conference_state_province . _Citation.Conference_country . _Citation.Conference_start_date . _Citation.Conference_end_date . _Citation.Conference_abstract_number . _Citation.Thesis_institution . _Citation.Thesis_institution_city . _Citation.Thesis_institution_country . _Citation.WWW_URL . _Citation.Page_first 205 _Citation.Page_last 219 _Citation.Year 2010 _Citation.Details . loop_ _Citation_author.Ordinal _Citation_author.Given_name _Citation_author.Family_name _Citation_author.First_initial _Citation_author.Middle_initials _Citation_author.Family_title _Citation_author.Entry_ID _Citation_author.Citation_ID 1 Blanton Tolbert . S. . 16980 1 2 Yasuyuki Miyazaki . . . 16980 1 3 Shawn Barton . . . 16980 1 4 Benyam Kinde . . . 16980 1 5 Patrice Starck . . . 16980 1 6 Rashmi Singh . . . 16980 1 7 Ad Bax . . . 16980 1 8 David Case . A. . 16980 1 9 Michael Summers . F. . 16980 1 stop_ save_ ############################################# # Molecular system (assembly) description # ############################################# save_assembly _Assembly.Sf_category assembly _Assembly.Sf_framecode assembly _Assembly.Entry_ID 16980 _Assembly.ID 1 _Assembly.Name 5'-R(*CP*UP*AP*GP*UP*UP*AP*GP*CP*UP*AP*AP*CP*UP*AP*G)-3' _Assembly.BMRB_code . _Assembly.Number_of_components 2 _Assembly.Organic_ligands . _Assembly.Metal_ions . _Assembly.Non_standard_bonds . _Assembly.Ambiguous_conformational_states . _Assembly.Ambiguous_chem_comp_sites . _Assembly.Molecules_in_chemical_exchange . _Assembly.Paramagnetic no _Assembly.Thiol_state . _Assembly.Molecular_mass . _Assembly.Enzyme_commission_number . _Assembly.Details . _Assembly.DB_query_date . _Assembly.DB_query_revised_last_date . loop_ _Entity_assembly.ID _Entity_assembly.Entity_assembly_name _Entity_assembly.Entity_ID _Entity_assembly.Entity_label _Entity_assembly.Asym_ID _Entity_assembly.PDB_chain_ID _Entity_assembly.Experimental_data_reported _Entity_assembly.Physical_state _Entity_assembly.Conformational_isomer _Entity_assembly.Chemical_exchange_state _Entity_assembly.Magnetic_equivalence_group_code _Entity_assembly.Role _Entity_assembly.Details _Entity_assembly.Entry_ID _Entity_assembly.Assembly_ID 1 'RNA (5'-R(*CP*UP*AP*GP*UP*UP*AP*GP*CP*UP*AP*AP*CP*UP*AP*G)-3')_1' 1 $RNA_(5'-R(*CP*UP*AP*GP*UP*UP*AP*GP*CP*UP*AP*AP*CP*UP*AP*G)-3') A . yes native no no . . . 16980 1 2 'RNA (5'-R(*CP*UP*AP*GP*UP*UP*AP*GP*CP*UP*AP*AP*CP*UP*AP*G)-3')_2' 1 $RNA_(5'-R(*CP*UP*AP*GP*UP*UP*AP*GP*CP*UP*AP*AP*CP*UP*AP*G)-3') B . yes native no no . . . 16980 1 stop_ save_ #################################### # Biological polymers and ligands # #################################### save_RNA_(5'-R(*CP*UP*AP*GP*UP*UP*AP*GP*CP*UP*AP*AP*CP*UP*AP*G)-3') _Entity.Sf_category entity _Entity.Sf_framecode RNA_(5'-R(*CP*UP*AP*GP*UP*UP*AP*GP*CP*UP*AP*AP*CP*UP*AP*G)-3') _Entity.Entry_ID 16980 _Entity.ID 1 _Entity.BMRB_code . _Entity.Name RNA_(5'-R(*CP*UP*AP*GP*UP*UP*AP*GP*CP*UP*AP*AP*CP*UP*AP*G)-3') _Entity.Type polymer _Entity.Polymer_common_type . _Entity.Polymer_type polyribonucleotide _Entity.Polymer_type_details . _Entity.Polymer_strand_ID A,B _Entity.Polymer_seq_one_letter_code_can . _Entity.Polymer_seq_one_letter_code ; GCGGUACUAGUUAGCUAACU AGCUUUGUA ; _Entity.Target_identifier . _Entity.Polymer_author_defined_seq . _Entity.Polymer_author_seq_details . _Entity.Ambiguous_conformational_states no _Entity.Ambiguous_chem_comp_sites no _Entity.Nstd_monomer no _Entity.Nstd_chirality no _Entity.Nstd_linkage no _Entity.Nonpolymer_comp_ID . _Entity.Nonpolymer_comp_label . _Entity.Number_of_monomers 29 _Entity.Number_of_nonpolymer_components . _Entity.Paramagnetic no _Entity.Thiol_state 'not present' _Entity.Src_method syn _Entity.Parent_entity_ID 1 _Entity.Fragment . _Entity.Mutation . _Entity.EC_number . _Entity.Calc_isoelectric_point . _Entity.Formula_weight . _Entity.Formula_weight_exptl . _Entity.Formula_weight_exptl_meth . _Entity.Details . _Entity.DB_query_date . _Entity.DB_query_revised_last_date . loop_ _Entity_comp_index.ID _Entity_comp_index.Auth_seq_ID _Entity_comp_index.Comp_ID _Entity_comp_index.Comp_label _Entity_comp_index.Entry_ID _Entity_comp_index.Entity_ID 1 . G . 16980 1 2 . C . 16980 1 3 . G . 16980 1 4 . G . 16980 1 5 . U . 16980 1 6 . A . 16980 1 7 . C . 16980 1 8 . U . 16980 1 9 . A . 16980 1 10 . G . 16980 1 11 . U . 16980 1 12 . U . 16980 1 13 . A . 16980 1 14 . G . 16980 1 15 . C . 16980 1 16 . U . 16980 1 17 . A . 16980 1 18 . A . 16980 1 19 . C . 16980 1 20 . U . 16980 1 21 . A . 16980 1 22 . G . 16980 1 23 . C . 16980 1 24 . U . 16980 1 25 . U . 16980 1 26 . U . 16980 1 27 . G . 16980 1 28 . U . 16980 1 29 . A . 16980 1 stop_ loop_ _Entity_poly_seq.Hetero _Entity_poly_seq.Mon_ID _Entity_poly_seq.Num _Entity_poly_seq.Comp_index_ID _Entity_poly_seq.Entry_ID _Entity_poly_seq.Entity_ID . G 1 1 16980 1 . C 2 2 16980 1 . G 3 3 16980 1 . G 4 4 16980 1 . U 5 5 16980 1 . A 6 6 16980 1 . C 7 7 16980 1 . U 8 8 16980 1 . A 9 9 16980 1 . G 10 10 16980 1 . U 11 11 16980 1 . U 12 12 16980 1 . A 13 13 16980 1 . G 14 14 16980 1 . C 15 15 16980 1 . U 16 16 16980 1 . A 17 17 16980 1 . A 18 18 16980 1 . C 19 19 16980 1 . U 20 20 16980 1 . A 21 21 16980 1 . G 22 22 16980 1 . C 23 23 16980 1 . U 24 24 16980 1 . U 25 25 16980 1 . U 26 26 16980 1 . G 27 27 16980 1 . U 28 28 16980 1 . A 29 29 16980 1 stop_ save_ #################### # Natural source # #################### save_natural_source _Entity_natural_src_list.Sf_category natural_source _Entity_natural_src_list.Sf_framecode natural_source _Entity_natural_src_list.Entry_ID 16980 _Entity_natural_src_list.ID 1 loop_ _Entity_natural_src.ID _Entity_natural_src.Entity_ID _Entity_natural_src.Entity_label _Entity_natural_src.Entity_chimera_segment_ID _Entity_natural_src.NCBI_taxonomy_ID _Entity_natural_src.Type _Entity_natural_src.Common _Entity_natural_src.Organism_name_scientific _Entity_natural_src.Organism_name_common _Entity_natural_src.Organism_acronym _Entity_natural_src.ICTVdb_decimal_code _Entity_natural_src.Superkingdom _Entity_natural_src.Kingdom _Entity_natural_src.Genus _Entity_natural_src.Species _Entity_natural_src.Strain _Entity_natural_src.Variant _Entity_natural_src.Subvariant _Entity_natural_src.Organ _Entity_natural_src.Tissue _Entity_natural_src.Tissue_fraction _Entity_natural_src.Cell_line _Entity_natural_src.Cell_type _Entity_natural_src.ATCC_number _Entity_natural_src.Organelle _Entity_natural_src.Cellular_location _Entity_natural_src.Fragment _Entity_natural_src.Fraction _Entity_natural_src.Secretion _Entity_natural_src.Plasmid _Entity_natural_src.Plasmid_details _Entity_natural_src.Gene_mnemonic _Entity_natural_src.Dev_stage _Entity_natural_src.Details _Entity_natural_src.Citation_ID _Entity_natural_src.Citation_label _Entity_natural_src.Entry_ID _Entity_natural_src.Entity_natural_src_list_ID 1 1 $RNA_(5'-R(*CP*UP*AP*GP*UP*UP*AP*GP*CP*UP*AP*AP*CP*UP*AP*G)-3') . 11786 virus . 'Murine leukemia virus' 'Murine leukemia virus' . 00.061.1.02.001. . . Gammaretrovirus . . . . . . . . . . . . . . . . . . . . . . 16980 1 stop_ save_ ######################### # Experimental source # ######################### save_experimental_source _Entity_experimental_src_list.Sf_category experimental_source _Entity_experimental_src_list.Sf_framecode experimental_source _Entity_experimental_src_list.Entry_ID 16980 _Entity_experimental_src_list.ID 1 loop_ _Entity_experimental_src.ID _Entity_experimental_src.Entity_ID _Entity_experimental_src.Entity_label _Entity_experimental_src.Entity_chimera_segment_ID _Entity_experimental_src.Production_method _Entity_experimental_src.Host_org_scientific_name _Entity_experimental_src.Host_org_name_common _Entity_experimental_src.Host_org_details _Entity_experimental_src.Host_org_NCBI_taxonomy_ID _Entity_experimental_src.Host_org_genus _Entity_experimental_src.Host_org_species _Entity_experimental_src.Host_org_strain _Entity_experimental_src.Host_org_variant _Entity_experimental_src.Host_org_subvariant _Entity_experimental_src.Host_org_organ _Entity_experimental_src.Host_org_tissue _Entity_experimental_src.Host_org_tissue_fraction _Entity_experimental_src.Host_org_cell_line _Entity_experimental_src.Host_org_cell_type _Entity_experimental_src.Host_org_cellular_location _Entity_experimental_src.Host_org_organelle _Entity_experimental_src.Host_org_gene _Entity_experimental_src.Host_org_culture_collection _Entity_experimental_src.Host_org_ATCC_number _Entity_experimental_src.Vector_type _Entity_experimental_src.PDBview_host_org_vector_name _Entity_experimental_src.PDBview_plasmid_name _Entity_experimental_src.Vector_name _Entity_experimental_src.Vector_details _Entity_experimental_src.Vendor_name _Entity_experimental_src.Host_org_dev_stage _Entity_experimental_src.Details _Entity_experimental_src.Citation_ID _Entity_experimental_src.Citation_label _Entity_experimental_src.Entry_ID _Entity_experimental_src.Entity_experimental_src_list_ID 1 1 $RNA_(5'-R(*CP*UP*AP*GP*UP*UP*AP*GP*CP*UP*AP*AP*CP*UP*AP*G)-3') . 'cell free synthesis' . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 16980 1 stop_ save_ ##################################### # Sample contents and methodology # ##################################### ######################## # Sample description # ######################## save_slb1 _Sample.Sf_category sample _Sample.Sf_framecode slb1 _Sample.Entry_ID 16980 _Sample.ID 1 _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number . _Sample.Solvent_system '100% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'RNA (5'-R(*CP*UP*AP*GP*UP*UP*AP*GP*CP*UP*AP*AP*CP*UP*AP*G)-3')' 'natural abundance' . . 1 $RNA_(5'-R(*CP*UP*AP*GP*UP*UP*AP*GP*CP*UP*AP*AP*CP*UP*AP*G)-3') . . . 0.25 1 mM . . . . 16980 1 2 'RNA (5'-R(*CP*UP*AP*GP*UP*UP*AP*GP*CP*UP*AP*AP*CP*UP*AP*G)-3')' '[U-100% 13C], [C-100% 13C]' . . 1 $RNA_(5'-R(*CP*UP*AP*GP*UP*UP*AP*GP*CP*UP*AP*AP*CP*UP*AP*G)-3') . . 0.25 . . mM . . . . 16980 1 3 'RNA (5'-R(*CP*UP*AP*GP*UP*UP*AP*GP*CP*UP*AP*AP*CP*UP*AP*G)-3')' '[G-100% 13C], [A-100% 13C]' . . 1 $RNA_(5'-R(*CP*UP*AP*GP*UP*UP*AP*GP*CP*UP*AP*AP*CP*UP*AP*G)-3') . . 0.25 . . mM . . . . 16980 1 4 'sodium chloride' 'natural abundance' . . . . . . 150 . . mM . . . . 16980 1 5 TRIS 'natural abundance' . . . . . . 10 . . mM . . . . 16980 1 6 D2O 'natural abundance' . . . . . . 100 . . % . . . . 16980 1 stop_ save_ ####################### # Sample conditions # ####################### save_sample_conditions_1 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_1 _Sample_condition_list.Entry_ID 16980 _Sample_condition_list.ID 1 _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 0.15 . M 16980 1 pH 6.5 . pH 16980 1 pressure 1 . atm 16980 1 temperature 303 . K 16980 1 stop_ save_ ############################ # Computer software used # ############################ save_AMBER _Software.Sf_category software _Software.Sf_framecode AMBER _Software.Entry_ID 16980 _Software.ID 1 _Software.Name AMBER _Software.Version . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Case, Darden, Cheatham, III, Simmerling, Wang, Duke, Luo, ... and Kollm' . . 16980 1 stop_ loop_ _Task.Task _Task.Entry_ID _Task.Software_ID refinement 16980 1 stop_ save_ save_CYANA _Software.Sf_category software _Software.Sf_framecode CYANA _Software.Entry_ID 16980 _Software.ID 2 _Software.Name CYANA _Software.Version . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Guntert, Mumenthaler and Wuthrich' . . 16980 2 stop_ loop_ _Task.Task _Task.Entry_ID _Task.Software_ID 'geometry optimization' 16980 2 stop_ save_ ######################### # Experimental detail # ######################### ################################## # NMR Spectrometer definitions # ################################## save_spectrometer_1 _NMR_spectrometer.Sf_category NMR_spectrometer _NMR_spectrometer.Sf_framecode spectrometer_1 _NMR_spectrometer.Entry_ID 16980 _NMR_spectrometer.ID 1 _NMR_spectrometer.Details . _NMR_spectrometer.Manufacturer Bruker _NMR_spectrometer.Model Avance _NMR_spectrometer.Serial_number . _NMR_spectrometer.Field_strength 800 save_ save_spectrometer_2 _NMR_spectrometer.Sf_category NMR_spectrometer _NMR_spectrometer.Sf_framecode spectrometer_2 _NMR_spectrometer.Entry_ID 16980 _NMR_spectrometer.ID 2 _NMR_spectrometer.Details . _NMR_spectrometer.Manufacturer Bruker _NMR_spectrometer.Model DMX _NMR_spectrometer.Serial_number . _NMR_spectrometer.Field_strength 600 save_ save_NMR_spectrometer_list _NMR_spectrometer_list.Sf_category NMR_spectrometer_list _NMR_spectrometer_list.Sf_framecode NMR_spectrometer_list _NMR_spectrometer_list.Entry_ID 16980 _NMR_spectrometer_list.ID 1 loop_ _NMR_spectrometer_view.ID _NMR_spectrometer_view.Name _NMR_spectrometer_view.Manufacturer _NMR_spectrometer_view.Model _NMR_spectrometer_view.Serial_number _NMR_spectrometer_view.Field_strength _NMR_spectrometer_view.Details _NMR_spectrometer_view.Citation_ID _NMR_spectrometer_view.Citation_label _NMR_spectrometer_view.Entry_ID _NMR_spectrometer_view.NMR_spectrometer_list_ID 1 spectrometer_1 Bruker Avance . 800 . . . 16980 1 2 spectrometer_2 Bruker DMX . 600 . . . 16980 1 stop_ save_ ############################# # NMR applied experiments # ############################# save_experiment_list _Experiment_list.Sf_category experiment_list _Experiment_list.Sf_framecode experiment_list _Experiment_list.Entry_ID 16980 _Experiment_list.ID 1 _Experiment_list.Details . loop_ _Experiment.ID _Experiment.Name _Experiment.Raw_data_flag _Experiment.NMR_spec_expt_ID _Experiment.NMR_spec_expt_label _Experiment.MS_expt_ID _Experiment.MS_expt_label _Experiment.SAXS_expt_ID _Experiment.SAXS_expt_label _Experiment.FRET_expt_ID _Experiment.FRET_expt_label _Experiment.EMR_expt_ID _Experiment.EMR_expt_label _Experiment.Sample_ID _Experiment.Sample_label _Experiment.Sample_state _Experiment.Sample_volume _Experiment.Sample_volume_units _Experiment.Sample_condition_list_ID _Experiment.Sample_condition_list_label _Experiment.Sample_spinning_rate _Experiment.Sample_angle _Experiment.NMR_tube_type _Experiment.NMR_spectrometer_ID _Experiment.NMR_spectrometer_label _Experiment.NMR_spectrometer_probe_ID _Experiment.NMR_spectrometer_probe_label _Experiment.NMR_spectral_processing_ID _Experiment.NMR_spectral_processing_label _Experiment.Mass_spectrometer_ID _Experiment.Mass_spectrometer_label _Experiment.Xray_instrument_ID _Experiment.Xray_instrument_label _Experiment.Fluorescence_instrument_ID _Experiment.Fluorescence_instrument_label _Experiment.EMR_instrument_ID _Experiment.EMR_instrument_label _Experiment.Chromatographic_system_ID _Experiment.Chromatographic_system_label _Experiment.Chromatographic_column_ID _Experiment.Chromatographic_column_label _Experiment.Entry_ID _Experiment.Experiment_list_ID 1 '2D 1H-1H NOESY' no . . . . . . . . . . 1 $slb1 isotropic . . 1 $sample_conditions_1 . . . 2 $spectrometer_2 . . . . . . . . . . . . . . . . 16980 1 2 '2D 1H-1H TOCSY' no . . . . . . . . . . 1 $slb1 isotropic . . 1 $sample_conditions_1 . . . 2 $spectrometer_2 . . . . . . . . . . . . . . . . 16980 1 3 '2D 1H-13C HMQC' no . . . . . . . . . . 1 $slb1 isotropic . . 1 $sample_conditions_1 . . . 1 $spectrometer_1 . . . . . . . . . . . . . . . . 16980 1 4 '2D Tr 1H-13C HSQC' no . . . . . . . . . . 1 $slb1 isotropic . . 1 $sample_conditions_1 . . . 1 $spectrometer_1 . . . . . . . . . . . . . . . . 16980 1 5 '2D Tr 1H-13C HSQC' no . . . . . . . . . . 1 $slb1 anisotropic . . 1 $sample_conditions_1 . . . 1 $spectrometer_1 . . . . . . . . . . . . . . . . 16980 1 stop_ save_ #################### # NMR parameters # #################### ############################## # Assigned chemical shifts # ############################## ################################ # Chemical shift referencing # ################################ save_chemical_shift_reference_1 _Chem_shift_reference.Sf_category chem_shift_reference _Chem_shift_reference.Sf_framecode chemical_shift_reference_1 _Chem_shift_reference.Entry_ID 16980 _Chem_shift_reference.ID 1 _Chem_shift_reference.Details . loop_ _Chem_shift_ref.Atom_type _Chem_shift_ref.Atom_isotope_number _Chem_shift_ref.Mol_common_name _Chem_shift_ref.Atom_group _Chem_shift_ref.Concentration_val _Chem_shift_ref.Concentration_units _Chem_shift_ref.Solvent _Chem_shift_ref.Rank _Chem_shift_ref.Chem_shift_units _Chem_shift_ref.Chem_shift_val _Chem_shift_ref.Ref_method _Chem_shift_ref.Ref_type _Chem_shift_ref.Indirect_shift_ratio _Chem_shift_ref.External_ref_loc _Chem_shift_ref.External_ref_sample_geometry _Chem_shift_ref.External_ref_axis _Chem_shift_ref.Indirect_shift_ratio_cit_ID _Chem_shift_ref.Indirect_shift_ratio_cit_label _Chem_shift_ref.Ref_correction_type _Chem_shift_ref.Correction_val _Chem_shift_ref.Correction_val_cit_ID _Chem_shift_ref.Correction_val_cit_label _Chem_shift_ref.Entry_ID _Chem_shift_ref.Chem_shift_reference_ID H 1 DSS 'methyl protons' . . . . ppm 0.00 internal direct 1.000000000 . . . 1 $entry_citation . . 1 $entry_citation 16980 1 stop_ save_ ################################### # Assigned chemical shift lists # ################################### ################################################################### # Chemical Shift Ambiguity Index Value Definitions # # # # The values other than 1 are used for those atoms with different # # chemical shifts that cannot be assigned to stereospecific atoms # # or to specific residues or chains. # # # # Index Value Definition # # # # 1 Unique (including isolated methyl protons, # # geminal atoms, and geminal methyl # # groups with identical chemical shifts) # # (e.g. ILE HD11, HD12, HD13 protons) # # 2 Ambiguity of geminal atoms or geminal methyl # # proton groups (e.g. ASP HB2 and HB3 # # protons, LEU CD1 and CD2 carbons, or # # LEU HD11, HD12, HD13 and HD21, HD22, # # HD23 methyl protons) # # 3 Aromatic atoms on opposite sides of # # symmetrical rings (e.g. TYR HE1 and HE2 # # protons) # # 4 Intraresidue ambiguities (e.g. LYS HG and # # HD protons or TRP HZ2 and HZ3 protons) # # 5 Interresidue ambiguities (LYS 12 vs. LYS 27) # # 6 Intermolecular ambiguities (e.g. ASP 31 CA # # in monomer 1 and ASP 31 CA in monomer 2 # # of an asymmetrical homodimer, duplex # # DNA assignments, or other assignments # # that may apply to atoms in one or more # # molecule in the molecular assembly) # # 9 Ambiguous, specific ambiguity not defined # # # ################################################################### save_assigned_chem_shift_list_1 _Assigned_chem_shift_list.Sf_category assigned_chemical_shifts _Assigned_chem_shift_list.Sf_framecode assigned_chem_shift_list_1 _Assigned_chem_shift_list.Entry_ID 16980 _Assigned_chem_shift_list.ID 1 _Assigned_chem_shift_list.Sample_condition_list_ID 1 _Assigned_chem_shift_list.Sample_condition_list_label $sample_conditions_1 _Assigned_chem_shift_list.Chem_shift_reference_ID 1 _Assigned_chem_shift_list.Chem_shift_reference_label $chemical_shift_reference_1 _Assigned_chem_shift_list.Chem_shift_1H_err . _Assigned_chem_shift_list.Chem_shift_13C_err . _Assigned_chem_shift_list.Chem_shift_15N_err . _Assigned_chem_shift_list.Chem_shift_31P_err . _Assigned_chem_shift_list.Chem_shift_2H_err . _Assigned_chem_shift_list.Chem_shift_19F_err . _Assigned_chem_shift_list.Error_derivation_method . _Assigned_chem_shift_list.Details . _Assigned_chem_shift_list.Text_data_format . _Assigned_chem_shift_list.Text_data . loop_ _Chem_shift_experiment.Experiment_ID _Chem_shift_experiment.Experiment_name _Chem_shift_experiment.Sample_ID _Chem_shift_experiment.Sample_label _Chem_shift_experiment.Sample_state _Chem_shift_experiment.Entry_ID _Chem_shift_experiment.Assigned_chem_shift_list_ID 1 '2D 1H-1H NOESY' . . . 16980 1 stop_ loop_ _Atom_chem_shift.ID _Atom_chem_shift.Assembly_atom_ID _Atom_chem_shift.Entity_assembly_ID _Atom_chem_shift.Entity_ID _Atom_chem_shift.Comp_index_ID _Atom_chem_shift.Seq_ID _Atom_chem_shift.Comp_ID _Atom_chem_shift.Atom_ID _Atom_chem_shift.Atom_type _Atom_chem_shift.Atom_isotope_number _Atom_chem_shift.Val _Atom_chem_shift.Val_err _Atom_chem_shift.Assign_fig_of_merit _Atom_chem_shift.Ambiguity_code _Atom_chem_shift.Occupancy _Atom_chem_shift.Resonance_ID _Atom_chem_shift.Auth_entity_assembly_ID _Atom_chem_shift.Auth_asym_ID _Atom_chem_shift.Auth_seq_ID _Atom_chem_shift.Auth_comp_ID _Atom_chem_shift.Auth_atom_ID _Atom_chem_shift.Details _Atom_chem_shift.Entry_ID _Atom_chem_shift.Assigned_chem_shift_list_ID 1 . 1 1 1 1 G H1' H 1 5.87 . . . . . . . 277 g h1' . 16980 1 2 . 1 1 2 2 C H1' H 1 5.67 . . . . . . . 278 c h1' . 16980 1 3 . 1 1 2 2 C H5 H 1 5.59 . . 1 . . . . 278 c h5 . 16980 1 4 . 1 1 2 2 C H6 H 1 7.72 . . 1 . . . . 278 c h6 . 16980 1 5 . 1 1 3 3 G H1' H 1 5.79 . . . . . . . 279 g h1' . 16980 1 6 . 1 1 3 3 G H8 H 1 7.58 . . 1 . . . . 279 g h8 . 16980 1 7 . 1 1 4 4 G H1' H 1 5.75 . . . . . . . 280 g h1' . 16980 1 8 . 1 1 4 4 G H8 H 1 7.25 . . 1 . . . . 280 g h8 . 16980 1 9 . 1 1 5 5 U H1' H 1 5.64 . . . . . . . 281 u h1' . 16980 1 10 . 1 1 5 5 U H5 H 1 5.45 . . 1 . . . . 281 u h5 . 16980 1 11 . 1 1 5 5 U H6 H 1 7.53 . . 1 . . . . 281 u h6 . 16980 1 12 . 1 1 6 6 A H1' H 1 6.04 . . . . . . . 282 a h1' . 16980 1 13 . 1 1 6 6 A H2 H 1 8.04 . . 1 . . . . 282 a h2 . 16980 1 14 . 1 1 6 6 A H8 H 1 8.27 . . 1 . . . . 282 a h8 . 16980 1 15 . 1 1 7 7 C H1' H 1 5.15 . . . . . . . 283 c h1' . 16980 1 16 . 1 1 7 7 C H5 H 1 5.48 . . 1 . . . . 283 c h5 . 16980 1 17 . 1 1 7 7 C H6 H 1 7.45 . . 1 . . . . 283 c h6 . 16980 1 18 . 1 1 8 8 U H1' H 1 5.55 . . . . . . . 284 u h1' . 16980 1 19 . 1 1 8 8 U H5 H 1 5.43 . . 1 . . . . 284 u h5 . 16980 1 20 . 1 1 8 8 U H6 H 1 7.89 . . 1 . . . . 284 u h6 . 16980 1 21 . 1 1 9 9 A H1' H 1 6.01 . . . . . . . 285 a h1' . 16980 1 22 . 1 1 9 9 A H2 H 1 6.78 . . 1 . . . . 285 a h2 . 16980 1 23 . 1 1 9 9 A H8 H 1 8.15 . . 1 . . . . 285 a h8 . 16980 1 24 . 1 1 10 10 G H1' H 1 5.53 . . . . . . . 286 g h1' . 16980 1 25 . 1 1 10 10 G H8 H 1 7.18 . . 1 . . . . 286 g h8 . 16980 1 26 . 1 1 11 11 U H1' H 1 5.51 . . . . . . . 287 u h1' . 16980 1 27 . 1 1 11 11 U H5 H 1 4.97 . . 1 . . . . 287 u h5 . 16980 1 28 . 1 1 11 11 U H6 H 1 7.69 . . 1 . . . . 287 u h6 . 16980 1 29 . 1 1 12 12 U H1' H 1 5.64 . . . . . . . 288 u h1' . 16980 1 30 . 1 1 12 12 U H5 H 1 5.59 . . 1 . . . . 288 u h5 . 16980 1 31 . 1 1 12 12 U H6 H 1 7.97 . . 1 . . . . 288 u h6 . 16980 1 32 . 1 1 13 13 A H1' H 1 5.95 . . . . . . . 289 a h1' . 16980 1 33 . 1 1 13 13 A H2 H 1 6.69 . . 1 . . . . 289 a h2 . 16980 1 34 . 1 1 13 13 A H8 H 1 8.13 . . 1 . . . . 289 a h8 . 16980 1 35 . 1 1 14 14 G H1' H 1 5.54 . . . . . . . 290 g h1' . 16980 1 36 . 1 1 14 14 G H8 H 1 7.24 . . 1 . . . . 290 g h8 . 16980 1 37 . 1 1 15 15 C H1' H 1 5.45 . . . . . . . 291 c h1' . 16980 1 38 . 1 1 15 15 C H5 H 1 5.13 . . 1 . . . . 291 c h5 . 16980 1 39 . 1 1 15 15 C H6 H 1 7.56 . . 1 . . . . 291 c h6 . 16980 1 40 . 1 1 16 16 U H1' H 1 5.5 . . . . . . . 292 u h1' . 16980 1 41 . 1 1 16 16 U H5 H 1 5.4 . . 1 . . . . 292 u h5 . 16980 1 42 . 1 1 16 16 U H6 H 1 7.85 . . 1 . . . . 292 u h6 . 16980 1 43 . 1 1 17 17 A H1' H 1 5.91 . . . . . . . 293 a h1' . 16980 1 44 . 1 1 17 17 A H2 H 1 6.43 . . 1 . . . . 293 a h2 . 16980 1 45 . 1 1 17 17 A H8 H 1 8.12 . . 1 . . . . 293 a h8 . 16980 1 46 . 1 1 18 18 A H1' H 1 5.84 . . . . . . . 294 a h1' . 16980 1 47 . 1 1 18 18 A H2 H 1 7.62 . . 1 . . . . 294 a h2 . 16980 1 48 . 1 1 18 18 A H8 H 1 7.86 . . 1 . . . . 294 a h8 . 16980 1 49 . 1 1 19 19 C H1' H 1 5.31 . . . . . . . 295 c h1' . 16980 1 50 . 1 1 19 19 C H5 H 1 5.16 . . 1 . . . . 295 c h5 . 16980 1 51 . 1 1 19 19 C H6 H 1 7.41 . . 1 . . . . 295 c h6 . 16980 1 52 . 1 1 20 20 U H1' H 1 5.52 . . . . . . . 296 u h1' . 16980 1 53 . 1 1 20 20 U H5 H 1 5.35 . . 1 . . . . 296 u h5 . 16980 1 54 . 1 1 20 20 U H6 H 1 7.82 . . 1 . . . . 296 u h6 . 16980 1 55 . 1 1 21 21 A H1' H 1 5.97 . . . . . . . 297 a h1' . 16980 1 56 . 1 1 21 21 A H2 H 1 6.78 . . 1 . . . . 297 a h2 . 16980 1 57 . 1 1 21 21 A H8 H 1 8.08 . . 1 . . . . 297 a h8 . 16980 1 58 . 1 1 22 22 G H1' H 1 5.53 . . . . . . . 298 g h1' . 16980 1 59 . 1 1 22 22 G H8 H 1 7.09 . . 1 . . . . 298 g h8 . 16980 1 60 . 1 1 23 23 C H1' H 1 5.59 . . . . . . . 299 c h1' . 16980 1 61 . 1 1 23 23 C H5 H 1 5.51 . . 1 . . . . 299 c h5 . 16980 1 62 . 1 1 23 23 C H6 H 1 7.71 . . 1 . . . . 299 c h6 . 16980 1 63 . 1 1 24 24 U H1' H 1 5.36 . . . . . . . 300 u h1' . 16980 1 64 . 1 1 24 24 U H5 H 1 5.76 . . 1 . . . . 300 u h5 . 16980 1 65 . 1 1 24 24 U H6 H 1 7.9 . . 1 . . . . 300 u h6 . 16980 1 66 . 1 1 25 25 U H5 H 1 5.75 . . 1 . . . . 301 u h5 . 16980 1 67 . 1 1 25 25 U H6 H 1 7.81 . . 1 . . . . 301 u h6 . 16980 1 68 . 1 1 26 26 U H1' H 1 5.71 . . . . . . . 302 u h1' . 16980 1 69 . 1 1 26 26 U H5 H 1 5.75 . . 1 . . . . 302 u h5 . 16980 1 70 . 1 1 26 26 U H6 H 1 7.81 . . 1 . . . . 302 u h6 . 16980 1 71 . 1 1 27 27 G H1' H 1 5.79 . . . . . . . 303 g h1' . 16980 1 72 . 1 1 27 27 G H8 H 1 7.91 . . 1 . . . . 303 g h8 . 16980 1 73 . 1 1 28 28 U H1' H 1 5.64 . . . . . . . 304 u h1' . 16980 1 74 . 1 1 28 28 U H5 H 1 5.53 . . 1 . . . . 304 u h5 . 16980 1 75 . 1 1 28 28 U H6 H 1 7.66 . . 1 . . . . 304 u h6 . 16980 1 76 . 1 1 29 29 A H1' H 1 6.03 . . . . . . . 305 a h1' . 16980 1 77 . 1 1 29 29 A H8 H 1 8.29 . . 1 . . . . 305 a h8 . 16980 1 stop_ save_