data_19039 ####################### # Entry information # ####################### save_entry_information _Entry.Sf_category entry_information _Entry.Sf_framecode entry_information _Entry.ID 19039 _Entry.Title ; NMR solution structure of domain 5 from Azotobacter vinelandii Intron 5 at pH 7.8 ; _Entry.Type macromolecule _Entry.Version_type original _Entry.Submission_date 2013-02-15 _Entry.Accession_date 2013-02-15 _Entry.Last_release_date 2014-02-24 _Entry.Original_release_date 2014-02-24 _Entry.Origination author _Entry.NMR_STAR_version 3.1.1.61 _Entry.Original_NMR_STAR_version 3.1 _Entry.Experimental_method NMR _Entry.Experimental_method_subtype SOLUTION _Entry.Details . _Entry.BMRB_internal_directory_name . loop_ _Entry_author.Ordinal _Entry_author.Given_name _Entry_author.Family_name _Entry_author.First_initial _Entry_author.Middle_initials _Entry_author.Family_title _Entry_author.Entry_ID 1 Maria Pechlaner . . . 19039 2 Daniela Donghi . . . 19039 3 Veronika Zelenay . . . 19039 4 'Roland K. O.' Sigel . 'K. O.' . 19039 stop_ loop_ _SG_project.SG_project_ID _SG_project.Project_name _SG_project.Full_name_of_center _SG_project.Initial_of_center _SG_project.Entry_ID 1 'not applicable' 'not applicable' . 19039 stop_ loop_ _Struct_keywords.Keywords _Struct_keywords.Text _Struct_keywords.Entry_ID 'group II intron' . 19039 hairpin . 19039 ribozyme . 19039 RNA . 19039 stop_ loop_ _Data_set.Type _Data_set.Count _Data_set.Entry_ID assigned_chemical_shifts 6 19039 stop_ loop_ _Datum.Type _Datum.Count _Datum.Entry_ID '13C chemical shifts' 216 19039 '15N chemical shifts' 95 19039 '1H chemical shifts' 569 19039 stop_ loop_ _Release.Release_number _Release.Format_type _Release.Format_version _Release.Date _Release.Submission_date _Release.Type _Release.Author _Release.Detail _Release.Entry_ID 1 . . 2014-02-24 2013-02-15 original author . 19039 stop_ save_ ############### # Citations # ############### save_entry_citation _Citation.Sf_category citations _Citation.Sf_framecode entry_citation _Citation.Entry_ID 19039 _Citation.ID 1 _Citation.Class 'entry citation' _Citation.CAS_abstract_code . _Citation.MEDLINE_UI_code . _Citation.DOI . _Citation.PubMed_ID . _Citation.Full_citation . _Citation.Title 'Acid-base equilibria near neutral pH in the catalytic triad and the bulge of domain 5 of a bacterial group II intron' _Citation.Status 'in preparation' _Citation.Type journal _Citation.Journal_abbrev 'Not known' _Citation.Journal_name_full . _Citation.Journal_volume . _Citation.Journal_issue . _Citation.Journal_ASTM . _Citation.Journal_ISSN . _Citation.Journal_CSD . _Citation.Book_title . _Citation.Book_chapter_title . _Citation.Book_volume . _Citation.Book_series . _Citation.Book_publisher . _Citation.Book_publisher_city . _Citation.Book_ISBN . _Citation.Conference_title . _Citation.Conference_site . _Citation.Conference_state_province . _Citation.Conference_country . _Citation.Conference_start_date . _Citation.Conference_end_date . _Citation.Conference_abstract_number . _Citation.Thesis_institution . _Citation.Thesis_institution_city . _Citation.Thesis_institution_country . _Citation.WWW_URL . _Citation.Page_first . _Citation.Page_last . _Citation.Year . _Citation.Details . loop_ _Citation_author.Ordinal _Citation_author.Given_name _Citation_author.Family_name _Citation_author.First_initial _Citation_author.Middle_initials _Citation_author.Family_title _Citation_author.Entry_ID _Citation_author.Citation_ID 1 Maria Pechlaner . . . 19039 1 2 Daniela Donghi . . . 19039 1 3 Veronika Zelenay . . . 19039 1 4 'Roland K. O.' Sigel . 'K. O.' . 19039 1 stop_ save_ ############################################# # Molecular system (assembly) description # ############################################# save_assembly _Assembly.Sf_category assembly _Assembly.Sf_framecode assembly _Assembly.Entry_ID 19039 _Assembly.ID 1 _Assembly.Name 'domain 5 from Azotobacter vinelandii Intron 5' _Assembly.BMRB_code . _Assembly.Number_of_components 1 _Assembly.Organic_ligands . _Assembly.Metal_ions . _Assembly.Non_standard_bonds . _Assembly.Ambiguous_conformational_states . _Assembly.Ambiguous_chem_comp_sites . _Assembly.Molecules_in_chemical_exchange . _Assembly.Paramagnetic no _Assembly.Thiol_state . _Assembly.Molecular_mass . _Assembly.Enzyme_commission_number . _Assembly.Details . _Assembly.DB_query_date . _Assembly.DB_query_revised_last_date . loop_ _Entity_assembly.ID _Entity_assembly.Entity_assembly_name _Entity_assembly.Entity_ID _Entity_assembly.Entity_label _Entity_assembly.Asym_ID _Entity_assembly.PDB_chain_ID _Entity_assembly.Experimental_data_reported _Entity_assembly.Physical_state _Entity_assembly.Conformational_isomer _Entity_assembly.Chemical_exchange_state _Entity_assembly.Magnetic_equivalence_group_code _Entity_assembly.Role _Entity_assembly.Details _Entity_assembly.Entry_ID _Entity_assembly.Assembly_ID 1 'RNA (35-MER)' 1 $RNA_(35-MER) A . yes native no no . . . 19039 1 stop_ save_ #################################### # Biological polymers and ligands # #################################### save_RNA_(35-MER) _Entity.Sf_category entity _Entity.Sf_framecode RNA_(35-MER) _Entity.Entry_ID 19039 _Entity.ID 1 _Entity.BMRB_code . _Entity.Name RNA_(35-MER) _Entity.Type polymer _Entity.Polymer_common_type . _Entity.Polymer_type polyribonucleotide _Entity.Polymer_type_details . _Entity.Polymer_strand_ID A _Entity.Polymer_seq_one_letter_code_can . _Entity.Polymer_seq_one_letter_code ; GGAGCCGUAUGCGGUAGUUC CGCACGUACGGAUCU ; _Entity.Target_identifier . _Entity.Polymer_author_defined_seq . _Entity.Polymer_author_seq_details ; The sequence corresponds to residues 1836 to 1870 from group II intron 5 of A. vinelandii (numbering includes the open reading frame). ; _Entity.Ambiguous_conformational_states no _Entity.Ambiguous_chem_comp_sites no _Entity.Nstd_monomer no _Entity.Nstd_chirality no _Entity.Nstd_linkage no _Entity.Nonpolymer_comp_ID . _Entity.Nonpolymer_comp_label . _Entity.Number_of_monomers 35 _Entity.Number_of_nonpolymer_components . _Entity.Paramagnetic no _Entity.Thiol_state 'not present' _Entity.Src_method syn _Entity.Parent_entity_ID . _Entity.Fragment 'group II intron Domain 5 (D5)' _Entity.Mutation . _Entity.EC_number . _Entity.Calc_isoelectric_point . _Entity.Formula_weight 11268.784 _Entity.Formula_weight_exptl . _Entity.Formula_weight_exptl_meth . _Entity.Details . _Entity.DB_query_date . _Entity.DB_query_revised_last_date . loop_ _Entity_comp_index.ID _Entity_comp_index.Auth_seq_ID _Entity_comp_index.Comp_ID _Entity_comp_index.Comp_label _Entity_comp_index.Entry_ID _Entity_comp_index.Entity_ID 1 . G . 19039 1 2 . G . 19039 1 3 . A . 19039 1 4 . G . 19039 1 5 . C . 19039 1 6 . C . 19039 1 7 . G . 19039 1 8 . U . 19039 1 9 . A . 19039 1 10 . U . 19039 1 11 . G . 19039 1 12 . C . 19039 1 13 . G . 19039 1 14 . G . 19039 1 15 . U . 19039 1 16 . A . 19039 1 17 . G . 19039 1 18 . U . 19039 1 19 . U . 19039 1 20 . C . 19039 1 21 . C . 19039 1 22 . G . 19039 1 23 . C . 19039 1 24 . A . 19039 1 25 . C . 19039 1 26 . G . 19039 1 27 . U . 19039 1 28 . A . 19039 1 29 . C . 19039 1 30 . G . 19039 1 31 . G . 19039 1 32 . A . 19039 1 33 . U . 19039 1 34 . C . 19039 1 35 . U . 19039 1 stop_ loop_ _Entity_poly_seq.Hetero _Entity_poly_seq.Mon_ID _Entity_poly_seq.Num _Entity_poly_seq.Comp_index_ID _Entity_poly_seq.Entry_ID _Entity_poly_seq.Entity_ID . G 1 1 19039 1 . G 2 2 19039 1 . A 3 3 19039 1 . G 4 4 19039 1 . C 5 5 19039 1 . C 6 6 19039 1 . G 7 7 19039 1 . U 8 8 19039 1 . A 9 9 19039 1 . U 10 10 19039 1 . G 11 11 19039 1 . C 12 12 19039 1 . G 13 13 19039 1 . G 14 14 19039 1 . U 15 15 19039 1 . A 16 16 19039 1 . G 17 17 19039 1 . U 18 18 19039 1 . U 19 19 19039 1 . C 20 20 19039 1 . C 21 21 19039 1 . G 22 22 19039 1 . C 23 23 19039 1 . A 24 24 19039 1 . C 25 25 19039 1 . G 26 26 19039 1 . U 27 27 19039 1 . A 28 28 19039 1 . C 29 29 19039 1 . G 30 30 19039 1 . G 31 31 19039 1 . A 32 32 19039 1 . U 33 33 19039 1 . C 34 34 19039 1 . U 35 35 19039 1 stop_ save_ #################### # Natural source # #################### save_natural_source _Entity_natural_src_list.Sf_category natural_source _Entity_natural_src_list.Sf_framecode natural_source _Entity_natural_src_list.Entry_ID 19039 _Entity_natural_src_list.ID 1 loop_ _Entity_natural_src.ID _Entity_natural_src.Entity_ID _Entity_natural_src.Entity_label _Entity_natural_src.Entity_chimera_segment_ID _Entity_natural_src.NCBI_taxonomy_ID _Entity_natural_src.Type _Entity_natural_src.Common _Entity_natural_src.Organism_name_scientific _Entity_natural_src.Organism_name_common _Entity_natural_src.Organism_acronym _Entity_natural_src.ICTVdb_decimal_code _Entity_natural_src.Superkingdom _Entity_natural_src.Kingdom _Entity_natural_src.Genus _Entity_natural_src.Species _Entity_natural_src.Strain _Entity_natural_src.Variant _Entity_natural_src.Subvariant _Entity_natural_src.Organ _Entity_natural_src.Tissue _Entity_natural_src.Tissue_fraction _Entity_natural_src.Cell_line _Entity_natural_src.Cell_type _Entity_natural_src.ATCC_number _Entity_natural_src.Organelle _Entity_natural_src.Cellular_location _Entity_natural_src.Fragment _Entity_natural_src.Fraction _Entity_natural_src.Secretion _Entity_natural_src.Plasmid _Entity_natural_src.Plasmid_details _Entity_natural_src.Gene_mnemonic _Entity_natural_src.Dev_stage _Entity_natural_src.Details _Entity_natural_src.Citation_ID _Entity_natural_src.Citation_label _Entity_natural_src.Entry_ID _Entity_natural_src.Entity_natural_src_list_ID 1 1 $RNA_(35-MER) . 354 organism . 'Azotobacter vinelandii' 'Azotobacter vinelandii' . . Bacteria . Azotobacter vinelandii . . . . . . . . . . . . . . . . . . . . . 19039 1 stop_ save_ ######################### # Experimental source # ######################### save_experimental_source _Entity_experimental_src_list.Sf_category experimental_source _Entity_experimental_src_list.Sf_framecode experimental_source _Entity_experimental_src_list.Entry_ID 19039 _Entity_experimental_src_list.ID 1 loop_ _Entity_experimental_src.ID _Entity_experimental_src.Entity_ID _Entity_experimental_src.Entity_label _Entity_experimental_src.Entity_chimera_segment_ID _Entity_experimental_src.Production_method _Entity_experimental_src.Host_org_scientific_name _Entity_experimental_src.Host_org_name_common _Entity_experimental_src.Host_org_details _Entity_experimental_src.Host_org_NCBI_taxonomy_ID _Entity_experimental_src.Host_org_genus _Entity_experimental_src.Host_org_species _Entity_experimental_src.Host_org_strain _Entity_experimental_src.Host_org_variant _Entity_experimental_src.Host_org_subvariant _Entity_experimental_src.Host_org_organ _Entity_experimental_src.Host_org_tissue _Entity_experimental_src.Host_org_tissue_fraction _Entity_experimental_src.Host_org_cell_line _Entity_experimental_src.Host_org_cell_type _Entity_experimental_src.Host_org_cellular_location _Entity_experimental_src.Host_org_organelle _Entity_experimental_src.Host_org_gene _Entity_experimental_src.Host_org_culture_collection _Entity_experimental_src.Host_org_ATCC_number _Entity_experimental_src.Vector_type _Entity_experimental_src.PDBview_host_org_vector_name _Entity_experimental_src.PDBview_plasmid_name _Entity_experimental_src.Vector_name _Entity_experimental_src.Vector_details _Entity_experimental_src.Vendor_name _Entity_experimental_src.Host_org_dev_stage _Entity_experimental_src.Details _Entity_experimental_src.Citation_ID _Entity_experimental_src.Citation_label _Entity_experimental_src.Entry_ID _Entity_experimental_src.Entity_experimental_src_list_ID 1 1 $RNA_(35-MER) . 'cell free synthesis' . . . . . . . . . . . . . . . . . . . 'double-stranded DNA template' . . . . . . 'the sequence occurs naturally as part of Intron 5 from A.vinelandii and was transcribed in vitro using T7 RNA polymerase from a dsDNA template' . . 19039 1 stop_ save_ ##################################### # Sample contents and methodology # ##################################### ######################## # Sample description # ######################## save_AvD5_wt_d2o _Sample.Sf_category sample _Sample.Sf_framecode AvD5_wt_d2o _Sample.Entry_ID 19039 _Sample.ID 1 _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number . _Sample.Solvent_system '100% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'RNA (35-MER)' 'natural abundance' . . 1 $RNA_(35-MER) . . . 0.5 1 mM . . . . 19039 1 2 'potassium chloride' 'natural abundance' . . . . . . 60 . . mM . . . . 19039 1 3 EDTA 'natural abundance' . . . . . . 10 . . uM . . . . 19039 1 stop_ save_ save_AvD5_wt_h2o _Sample.Sf_category sample _Sample.Sf_framecode AvD5_wt_h2o _Sample.Entry_ID 19039 _Sample.ID 2 _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number . _Sample.Solvent_system '90% H2O/10% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'RNA (35-MER)' 'natural abundance' . . 1 $RNA_(35-MER) . . . 0.5 1 mM . . . . 19039 2 2 'potassium chloride' 'natural abundance' . . . . . . 60 . . mM . . . . 19039 2 3 EDTA 'natural abundance' . . . . . . 10 . . uM . . . . 19039 2 stop_ save_ save_AvD5_lab_d2o _Sample.Sf_category sample _Sample.Sf_framecode AvD5_lab_d2o _Sample.Entry_ID 19039 _Sample.ID 3 _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number . _Sample.Solvent_system '100% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'RNA (35-MER)' '[100% 13C; 100% 15N]' . . 1 $RNA_(35-MER) . . . 0.5 1 mM . . . . 19039 3 2 'potassium chloride' 'natural abundance' . . . . . . 60 . . mM . . . . 19039 3 3 EDTA 'natural abundance' . . . . . . 10 . . uM . . . . 19039 3 stop_ save_ save_AvD5_lab_h2o _Sample.Sf_category sample _Sample.Sf_framecode AvD5_lab_h2o _Sample.Entry_ID 19039 _Sample.ID 4 _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number . _Sample.Solvent_system '90% H2O/10% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'RNA (35-MER)' '[100% 13C; 100% 15N]' . . 1 $RNA_(35-MER) . . . 0.5 1 mM . . . . 19039 4 2 'potassium chloride' 'natural abundance' . . . . . . 60 . . mM . . . . 19039 4 3 EDTA 'natural abundance' . . . . . . 10 . . uM . . . . 19039 4 stop_ save_ save_AvD5_deut_d2o _Sample.Sf_category sample _Sample.Sf_framecode AvD5_deut_d2o _Sample.Entry_ID 19039 _Sample.ID 5 _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number . _Sample.Solvent_system '100% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'RNA (35-MER)' '[3',4',5',5'',5]-100% 2D' . . 1 $RNA_(35-MER) . . . 0.5 1 mM . . . . 19039 5 2 'potassium chloride' 'natural abundance' . . . . . . 60 . . mM . . . . 19039 5 3 EDTA 'natural abundance' . . . . . . 10 . . uM . . . . 19039 5 stop_ save_ ####################### # Sample conditions # ####################### save_300K_d2o_pH7.8 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode 300K_d2o_pH7.8 _Sample_condition_list.Entry_ID 19039 _Sample_condition_list.ID 1 _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 60 . mM 19039 1 pD 7.8 . pH 19039 1 pressure 1 . atm 19039 1 temperature 300 . K 19039 1 stop_ save_ save_275K_h2o_pH7.8 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode 275K_h2o_pH7.8 _Sample_condition_list.Entry_ID 19039 _Sample_condition_list.ID 2 _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 60 . mM 19039 2 pH 7.8 . pH 19039 2 pressure 1 . atm 19039 2 temperature 275 . K 19039 2 stop_ save_ save_300K_d2o_pH5.2 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode 300K_d2o_pH5.2 _Sample_condition_list.Entry_ID 19039 _Sample_condition_list.ID 3 _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 60 . mM 19039 3 pD 5.2 . pH 19039 3 pressure 1 . atm 19039 3 temperature 300 . K 19039 3 stop_ save_ save_300K_d2o_pH6.7 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode 300K_d2o_pH6.7 _Sample_condition_list.Entry_ID 19039 _Sample_condition_list.ID 4 _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 60 . mM 19039 4 pD 6.7 . pH 19039 4 pressure 1 . atm 19039 4 temperature 300 . K 19039 4 stop_ save_ save_275K_h2o_pH5.2 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode 275K_h2o_pH5.2 _Sample_condition_list.Entry_ID 19039 _Sample_condition_list.ID 5 _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 60 . mM 19039 5 pH 5.2 . pH 19039 5 pressure 1 . atm 19039 5 temperature 275 . K 19039 5 stop_ save_ save_275K_h2o_pH6.7 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode 275K_h2o_pH6.7 _Sample_condition_list.Entry_ID 19039 _Sample_condition_list.ID 6 _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 60 . mM 19039 6 pH 6.7 . pH 19039 6 pressure 1 . atm 19039 6 temperature 275 . K 19039 6 stop_ save_ ############################ # Computer software used # ############################ save_CNS _Software.Sf_category software _Software.Sf_framecode CNS _Software.Entry_ID 19039 _Software.ID 1 _Software.Name CNS _Software.Version 1.2 _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Brunger, Adams, Clore, Gros, Nilges and Read' . . 19039 1 stop_ loop_ _Task.Task _Task.Entry_ID _Task.Software_ID refinement 19039 1 'structure solution' 19039 1 stop_ save_ save_X-PLOR_NIH _Software.Sf_category software _Software.Sf_framecode X-PLOR_NIH _Software.Entry_ID 19039 _Software.ID 2 _Software.Name 'X-PLOR NIH' _Software.Version 2.3 _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Schwieters, Kuszewski, Tjandra and Clore' . . 19039 2 stop_ loop_ _Task.Task _Task.Entry_ID _Task.Software_ID refinement 19039 2 'structure solution' 19039 2 stop_ save_ save_Molmol _Software.Sf_category software _Software.Sf_framecode Molmol _Software.Entry_ID 19039 _Software.ID 3 _Software.Name Molmol _Software.Version . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Koradi, Billeter and Wuthrich' . . 19039 3 stop_ loop_ _Task.Task _Task.Entry_ID _Task.Software_ID 'data analysis' 19039 3 stop_ save_ save_SPARKY _Software.Sf_category software _Software.Sf_framecode SPARKY _Software.Entry_ID 19039 _Software.ID 4 _Software.Name SPARKY _Software.Version . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID Goddard . . 19039 4 stop_ loop_ _Task.Task _Task.Entry_ID _Task.Software_ID 'chemical shift assignment' 19039 4 'data analysis' 19039 4 'peak picking' 19039 4 stop_ save_ save_TOPSPIN _Software.Sf_category software _Software.Sf_framecode TOPSPIN _Software.Entry_ID 19039 _Software.ID 5 _Software.Name TOPSPIN _Software.Version 3.0.a _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Bruker Biospin' . . 19039 5 stop_ loop_ _Task.Task _Task.Entry_ID _Task.Software_ID 'data analysis' 19039 5 processing 19039 5 stop_ save_ save_CURVES _Software.Sf_category software _Software.Sf_framecode CURVES _Software.Entry_ID 19039 _Software.ID 6 _Software.Name CURVES _Software.Version . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID Lavery . . 19039 6 stop_ loop_ _Task.Task _Task.Entry_ID _Task.Software_ID 'data analysis' 19039 6 stop_ save_ ######################### # Experimental detail # ######################### ################################## # NMR Spectrometer definitions # ################################## save_AV-700 _NMR_spectrometer.Sf_category NMR_spectrometer _NMR_spectrometer.Sf_framecode AV-700 _NMR_spectrometer.Entry_ID 19039 _NMR_spectrometer.ID 1 _NMR_spectrometer.Details 'TXI z-axis pulsed field gradient CryoProbe' _NMR_spectrometer.Manufacturer Bruker _NMR_spectrometer.Model Avance _NMR_spectrometer.Serial_number . _NMR_spectrometer.Field_strength 700 save_ save_AV-600 _NMR_spectrometer.Sf_category NMR_spectrometer _NMR_spectrometer.Sf_framecode AV-600 _NMR_spectrometer.Entry_ID 19039 _NMR_spectrometer.ID 2 _NMR_spectrometer.Details 'TCI z-gradient Cryoprobe' _NMR_spectrometer.Manufacturer Bruker _NMR_spectrometer.Model Avance _NMR_spectrometer.Serial_number . _NMR_spectrometer.Field_strength 600 save_ save_AV-500 _NMR_spectrometer.Sf_category NMR_spectrometer _NMR_spectrometer.Sf_framecode AV-500 _NMR_spectrometer.Entry_ID 19039 _NMR_spectrometer.ID 3 _NMR_spectrometer.Details '5 mm QNP CryoProbe' _NMR_spectrometer.Manufacturer Bruker _NMR_spectrometer.Model Avance _NMR_spectrometer.Serial_number . _NMR_spectrometer.Field_strength 500 save_ save_NMR_spectrometer_list _NMR_spectrometer_list.Sf_category NMR_spectrometer_list _NMR_spectrometer_list.Sf_framecode NMR_spectrometer_list _NMR_spectrometer_list.Entry_ID 19039 _NMR_spectrometer_list.ID 1 loop_ _NMR_spectrometer_view.ID _NMR_spectrometer_view.Name _NMR_spectrometer_view.Manufacturer _NMR_spectrometer_view.Model _NMR_spectrometer_view.Serial_number _NMR_spectrometer_view.Field_strength _NMR_spectrometer_view.Details _NMR_spectrometer_view.Citation_ID _NMR_spectrometer_view.Citation_label _NMR_spectrometer_view.Entry_ID _NMR_spectrometer_view.NMR_spectrometer_list_ID 1 AV-700 Bruker Avance . 700 'TXI z-axis pulsed field gradient CryoProbe' . . 19039 1 2 AV-600 Bruker Avance . 600 'TCI z-gradient Cryoprobe' . . 19039 1 3 AV-500 Bruker Avance . 500 '5 mm QNP CryoProbe' . . 19039 1 stop_ save_ ############################# # NMR applied experiments # ############################# save_experiment_list _Experiment_list.Sf_category experiment_list _Experiment_list.Sf_framecode experiment_list _Experiment_list.Entry_ID 19039 _Experiment_list.ID 1 _Experiment_list.Details . loop_ _Experiment.ID _Experiment.Name _Experiment.Raw_data_flag _Experiment.NMR_spec_expt_ID _Experiment.NMR_spec_expt_label _Experiment.MS_expt_ID _Experiment.MS_expt_label _Experiment.SAXS_expt_ID _Experiment.SAXS_expt_label _Experiment.FRET_expt_ID _Experiment.FRET_expt_label _Experiment.EMR_expt_ID _Experiment.EMR_expt_label _Experiment.Sample_ID _Experiment.Sample_label _Experiment.Sample_state _Experiment.Sample_volume _Experiment.Sample_volume_units _Experiment.Sample_condition_list_ID _Experiment.Sample_condition_list_label _Experiment.Sample_spinning_rate _Experiment.Sample_angle _Experiment.NMR_tube_type _Experiment.NMR_spectrometer_ID _Experiment.NMR_spectrometer_label _Experiment.NMR_spectrometer_probe_ID _Experiment.NMR_spectrometer_probe_label _Experiment.NMR_spectral_processing_ID _Experiment.NMR_spectral_processing_label _Experiment.Mass_spectrometer_ID _Experiment.Mass_spectrometer_label _Experiment.Xray_instrument_ID _Experiment.Xray_instrument_label _Experiment.Fluorescence_instrument_ID _Experiment.Fluorescence_instrument_label _Experiment.EMR_instrument_ID _Experiment.EMR_instrument_label _Experiment.Chromatographic_system_ID _Experiment.Chromatographic_system_label _Experiment.Chromatographic_column_ID _Experiment.Chromatographic_column_label _Experiment.Entry_ID _Experiment.Experiment_list_ID 1 '2D 1H-1H NOESY' no . . . . . . . . . . 1 $AvD5_wt_d2o isotropic . . 1 $300K_d2o_pH7.8 . . . . . . . . . . . . . . . . . . . . . 19039 1 2 '2D 1H-1H NOESY' no . . . . . . . . . . 5 $AvD5_deut_d2o isotropic . . 1 $300K_d2o_pH7.8 . . . . . . . . . . . . . . . . . . . . . 19039 1 3 '2D 1H-1H NOESY' no . . . . . . . . . . 2 $AvD5_wt_h2o isotropic . . 2 $275K_h2o_pH7.8 . . . . . . . . . . . . . . . . . . . . . 19039 1 4 '2D 1H-1H TOCSY' no . . . . . . . . . . 1 $AvD5_wt_d2o isotropic . . 1 $300K_d2o_pH7.8 . . . . . . . . . . . . . . . . . . . . . 19039 1 5 '2D 1H-15N HSQC' no . . . . . . . . . . 4 $AvD5_lab_h2o isotropic . . 2 $275K_h2o_pH7.8 . . . . . . . . . . . . . . . . . . . . . 19039 1 6 '2D 1H-13C HSQC aromatic' no . . . . . . . . . . 3 $AvD5_lab_d2o isotropic . . 1 $300K_d2o_pH7.8 . . . . . . . . . . . . . . . . . . . . . 19039 1 7 '2D 1H-13C HSQC aliphatic' no . . . . . . . . . . 3 $AvD5_lab_d2o isotropic . . 1 $300K_d2o_pH7.8 . . . . . . . . . . . . . . . . . . . . . 19039 1 8 '2D JNN HNN COSY' no . . . . . . . . . . 4 $AvD5_lab_h2o isotropic . . 2 $275K_h2o_pH7.8 . . . . . . . . . . . . . . . . . . . . . 19039 1 9 '2D 1H-1H NOESY' no . . . . . . . . . . 1 $AvD5_wt_d2o isotropic . . 3 $300K_d2o_pH5.2 . . . . . . . . . . . . . . . . . . . . . 19039 1 10 '2D 1H-1H NOESY' no . . . . . . . . . . 1 $AvD5_wt_d2o isotropic . . 4 $300K_d2o_pH6.7 . . . . . . . . . . . . . . . . . . . . . 19039 1 11 '2D 1H-1H NOESY' no . . . . . . . . . . 2 $AvD5_wt_h2o isotropic . . 5 $275K_h2o_pH5.2 . . . . . . . . . . . . . . . . . . . . . 19039 1 12 '2D 1H-1H NOESY' no . . . . . . . . . . 2 $AvD5_wt_h2o isotropic . . 6 $275K_h2o_pH6.7 . . . . . . . . . . . . . . . . . . . . . 19039 1 13 '2D 1H-13C HSQC aromatic' no . . . . . . . . . . 3 $AvD5_lab_d2o isotropic . . 3 $300K_d2o_pH5.2 . . . . . . . . . . . . . . . . . . . . . 19039 1 14 '2D 1H-13C HSQC aromatic' no . . . . . . . . . . 3 $AvD5_lab_d2o isotropic . . 4 $300K_d2o_pH6.7 . . . . . . . . . . . . . . . . . . . . . 19039 1 15 '2D 1H-13C HSQC aliphatic' no . . . . . . . . . . 3 $AvD5_lab_d2o isotropic . . 4 $300K_d2o_pH6.7 . . . . . . . . . . . . . . . . . . . . . 19039 1 16 '2D 1H-15N HSQC' no . . . . . . . . . . 4 $AvD5_lab_h2o isotropic . . 5 $275K_h2o_pH5.2 . . . . . . . . . . . . . . . . . . . . . 19039 1 17 '2D 1H-15N HSQC' no . . . . . . . . . . 4 $AvD5_lab_h2o isotropic . . 6 $275K_h2o_pH6.7 . . . . . . . . . . . . . . . . . . . . . 19039 1 18 '2D JNN HNN COSY' no . . . . . . . . . . 4 $AvD5_lab_h2o isotropic . . 5 $275K_h2o_pH5.2 . . . . . . . . . . . . . . . . . . . . . 19039 1 19 '2D JNN HNN COSY' no . . . . . . . . . . 4 $AvD5_lab_h2o isotropic . . 6 $275K_h2o_pH6.7 . . . . . . . . . . . . . . . . . . . . . 19039 1 stop_ save_ #################### # NMR parameters # #################### ############################## # Assigned chemical shifts # ############################## ################################ # Chemical shift referencing # ################################ save_DSS _Chem_shift_reference.Sf_category chem_shift_reference _Chem_shift_reference.Sf_framecode DSS _Chem_shift_reference.Entry_ID 19039 _Chem_shift_reference.ID 1 _Chem_shift_reference.Details . loop_ _Chem_shift_ref.Atom_type _Chem_shift_ref.Atom_isotope_number _Chem_shift_ref.Mol_common_name _Chem_shift_ref.Atom_group _Chem_shift_ref.Concentration_val _Chem_shift_ref.Concentration_units _Chem_shift_ref.Solvent _Chem_shift_ref.Rank _Chem_shift_ref.Chem_shift_units _Chem_shift_ref.Chem_shift_val _Chem_shift_ref.Ref_method _Chem_shift_ref.Ref_type _Chem_shift_ref.Indirect_shift_ratio _Chem_shift_ref.External_ref_loc _Chem_shift_ref.External_ref_sample_geometry _Chem_shift_ref.External_ref_axis _Chem_shift_ref.Indirect_shift_ratio_cit_ID _Chem_shift_ref.Indirect_shift_ratio_cit_label _Chem_shift_ref.Ref_correction_type _Chem_shift_ref.Correction_val _Chem_shift_ref.Correction_val_cit_ID _Chem_shift_ref.Correction_val_cit_label _Chem_shift_ref.Entry_ID _Chem_shift_ref.Chem_shift_reference_ID C 13 DSS 'methyl protons' . . . . ppm 0 external indirect 0.251449530 . . . . . . . . . 19039 1 H 1 DSS 'methyl protons' . . . . ppm 0 external direct 1.0 . . . . . . . . . 19039 1 N 15 DSS 'methyl protons' . . . . ppm 0 external indirect 0.101329118 . . . . . . . . . 19039 1 stop_ save_ ################################### # Assigned chemical shift lists # ################################### ################################################################### # Chemical Shift Ambiguity Index Value Definitions # # # # The values other than 1 are used for those atoms with different # # chemical shifts that cannot be assigned to stereospecific atoms # # or to specific residues or chains. # # # # Index Value Definition # # # # 1 Unique (including isolated methyl protons, # # geminal atoms, and geminal methyl # # groups with identical chemical shifts) # # (e.g. ILE HD11, HD12, HD13 protons) # # 2 Ambiguity of geminal atoms or geminal methyl # # proton groups (e.g. ASP HB2 and HB3 # # protons, LEU CD1 and CD2 carbons, or # # LEU HD11, HD12, HD13 and HD21, HD22, # # HD23 methyl protons) # # 3 Aromatic atoms on opposite sides of # # symmetrical rings (e.g. TYR HE1 and HE2 # # protons) # # 4 Intraresidue ambiguities (e.g. LYS HG and # # HD protons or TRP HZ2 and HZ3 protons) # # 5 Interresidue ambiguities (LYS 12 vs. LYS 27) # # 6 Intermolecular ambiguities (e.g. ASP 31 CA # # in monomer 1 and ASP 31 CA in monomer 2 # # of an asymmetrical homodimer, duplex # # DNA assignments, or other assignments # # that may apply to atoms in one or more # # molecule in the molecular assembly) # # 9 Ambiguous, specific ambiguity not defined # # # ################################################################### save_chem_shifts_pH7.8_300K _Assigned_chem_shift_list.Sf_category assigned_chemical_shifts _Assigned_chem_shift_list.Sf_framecode chem_shifts_pH7.8_300K _Assigned_chem_shift_list.Entry_ID 19039 _Assigned_chem_shift_list.ID 1 _Assigned_chem_shift_list.Sample_condition_list_ID 1 _Assigned_chem_shift_list.Sample_condition_list_label $300K_d2o_pH7.8 _Assigned_chem_shift_list.Chem_shift_reference_ID 1 _Assigned_chem_shift_list.Chem_shift_reference_label $DSS _Assigned_chem_shift_list.Chem_shift_1H_err . _Assigned_chem_shift_list.Chem_shift_13C_err . _Assigned_chem_shift_list.Chem_shift_15N_err . _Assigned_chem_shift_list.Chem_shift_31P_err . _Assigned_chem_shift_list.Chem_shift_2H_err . _Assigned_chem_shift_list.Chem_shift_19F_err . _Assigned_chem_shift_list.Error_derivation_method . _Assigned_chem_shift_list.Details . _Assigned_chem_shift_list.Text_data_format . _Assigned_chem_shift_list.Text_data . loop_ _Chem_shift_experiment.Experiment_ID _Chem_shift_experiment.Experiment_name _Chem_shift_experiment.Sample_ID _Chem_shift_experiment.Sample_label _Chem_shift_experiment.Sample_state _Chem_shift_experiment.Entry_ID _Chem_shift_experiment.Assigned_chem_shift_list_ID 1 '2D 1H-1H NOESY' . . . 19039 1 6 '2D 1H-13C HSQC aromatic' . . . 19039 1 stop_ loop_ _Atom_chem_shift.ID _Atom_chem_shift.Assembly_atom_ID _Atom_chem_shift.Entity_assembly_ID _Atom_chem_shift.Entity_ID _Atom_chem_shift.Comp_index_ID _Atom_chem_shift.Seq_ID _Atom_chem_shift.Comp_ID _Atom_chem_shift.Atom_ID _Atom_chem_shift.Atom_type _Atom_chem_shift.Atom_isotope_number _Atom_chem_shift.Val _Atom_chem_shift.Val_err _Atom_chem_shift.Assign_fig_of_merit _Atom_chem_shift.Ambiguity_code _Atom_chem_shift.Occupancy _Atom_chem_shift.Resonance_ID _Atom_chem_shift.Auth_entity_assembly_ID _Atom_chem_shift.Auth_asym_ID _Atom_chem_shift.Auth_seq_ID _Atom_chem_shift.Auth_comp_ID _Atom_chem_shift.Auth_atom_ID _Atom_chem_shift.Details _Atom_chem_shift.Entry_ID _Atom_chem_shift.Assigned_chem_shift_list_ID 1 . 1 1 1 1 G H1' H 1 5.849 0.005 . 1 . . . A 1 G H1' . 19039 1 2 . 1 1 1 1 G H2' H 1 4.908 0.005 . 1 . . . A 1 G H2' . 19039 1 3 . 1 1 1 1 G H8 H 1 8.157 0.005 . 1 . . . A 1 G H8 . 19039 1 4 . 1 1 1 1 G C8 C 13 139.781 0.050 . 1 . . . A 1 G C8 . 19039 1 5 . 1 1 2 2 G H1' H 1 5.761 0.005 . 1 . . . A 2 G H1' . 19039 1 6 . 1 1 2 2 G H2' H 1 4.674 0.005 . 1 . . . A 2 G H2' . 19039 1 7 . 1 1 2 2 G H8 H 1 7.638 0.005 . 1 . . . A 2 G H8 . 19039 1 8 . 1 1 2 2 G C8 C 13 137.420 0.050 . 1 . . . A 2 G C8 . 19039 1 9 . 1 1 3 3 A H1' H 1 5.927 0.005 . 1 . . . A 3 A H1' . 19039 1 10 . 1 1 3 3 A H2 H 1 7.588 0.005 . 1 . . . A 3 A H2 . 19039 1 11 . 1 1 3 3 A H8 H 1 7.813 0.005 . 1 . . . A 3 A H8 . 19039 1 12 . 1 1 3 3 A C2 C 13 153.861 0.050 . 1 . . . A 3 A C2 . 19039 1 13 . 1 1 3 3 A C8 C 13 139.555 0.050 . 1 . . . A 3 A C8 . 19039 1 14 . 1 1 4 4 G H1' H 1 5.759 0.005 . 1 . . . A 4 G H1' . 19039 1 15 . 1 1 4 4 G H8 H 1 7.684 0.005 . 1 . . . A 4 G H8 . 19039 1 16 . 1 1 5 5 C H1' H 1 5.534 0.005 . 1 . . . A 5 C H1' . 19039 1 17 . 1 1 5 5 C H2' H 1 4.326 0.005 . 1 . . . A 5 C H2' . 19039 1 18 . 1 1 5 5 C H5 H 1 5.186 0.005 . 1 . . . A 5 C H5 . 19039 1 19 . 1 1 5 5 C H6 H 1 7.539 0.005 . 1 . . . A 5 C H6 . 19039 1 20 . 1 1 6 6 C H1' H 1 5.419 0.005 . 1 . . . A 6 C H1' . 19039 1 21 . 1 1 6 6 C H2' H 1 4.530 0.005 . 1 . . . A 6 C H2' . 19039 1 22 . 1 1 6 6 C H5 H 1 5.412 0.005 . 1 . . . A 6 C H5 . 19039 1 23 . 1 1 6 6 C H6 H 1 7.746 0.005 . 1 . . . A 6 C H6 . 19039 1 24 . 1 1 6 6 C C6 C 13 140.892 0.050 . 1 . . . A 6 C C6 . 19039 1 25 . 1 1 7 7 G H1' H 1 5.657 0.005 . 1 . . . A 7 G H1' . 19039 1 26 . 1 1 7 7 G H2' H 1 4.467 0.005 . 1 . . . A 7 G H2' . 19039 1 27 . 1 1 7 7 G H8 H 1 7.478 0.005 . 1 . . . A 7 G H8 . 19039 1 28 . 1 1 7 7 G C8 C 13 136.225 0.050 . 1 . . . A 7 G C8 . 19039 1 29 . 1 1 8 8 U H1' H 1 5.536 0.005 . 1 . . . A 8 U H1' . 19039 1 30 . 1 1 8 8 U H2' H 1 4.537 0.005 . 1 . . . A 8 U H2' . 19039 1 31 . 1 1 8 8 U H5 H 1 5.087 0.005 . 1 . . . A 8 U H5 . 19039 1 32 . 1 1 8 8 U H6 H 1 7.705 0.005 . 1 . . . A 8 U H6 . 19039 1 33 . 1 1 8 8 U C6 C 13 141.451 0.050 . 1 . . . A 8 U C6 . 19039 1 34 . 1 1 9 9 A H1' H 1 6.009 0.005 . 1 . . . A 9 A H1' . 19039 1 35 . 1 1 9 9 A H2 H 1 7.283 0.005 . 1 . . . A 9 A H2 . 19039 1 36 . 1 1 9 9 A H2' H 1 4.504 0.005 . 1 . . . A 9 A H2' . 19039 1 37 . 1 1 9 9 A H8 H 1 8.049 0.005 . 1 . . . A 9 A H8 . 19039 1 38 . 1 1 9 9 A C2 C 13 153.789 0.050 . 1 . . . A 9 A C2 . 19039 1 39 . 1 1 9 9 A C8 C 13 139.688 0.050 . 1 . . . A 9 A C8 . 19039 1 40 . 1 1 10 10 U H1' H 1 5.543 0.005 . 1 . . . A 10 U H1' . 19039 1 41 . 1 1 10 10 U H2' H 1 4.254 0.005 . 1 . . . A 10 U H2' . 19039 1 42 . 1 1 10 10 U H5 H 1 5.387 0.005 . 1 . . . A 10 U H5 . 19039 1 43 . 1 1 10 10 U H6 H 1 7.520 0.005 . 1 . . . A 10 U H6 . 19039 1 44 . 1 1 10 10 U C6 C 13 141.153 0.050 . 1 . . . A 10 U C6 . 19039 1 45 . 1 1 11 11 G H1' H 1 5.723 0.005 . 1 . . . A 11 G H1' . 19039 1 46 . 1 1 11 11 G H2' H 1 4.605 0.005 . 1 . . . A 11 G H2' . 19039 1 47 . 1 1 11 11 G H8 H 1 7.861 0.005 . 1 . . . A 11 G H8 . 19039 1 48 . 1 1 11 11 G C8 C 13 137.797 0.050 . 1 . . . A 11 G C8 . 19039 1 49 . 1 1 12 12 C H1' H 1 5.478 0.005 . 1 . . . A 12 C H1' . 19039 1 50 . 1 1 12 12 C H2' H 1 4.489 0.005 . 1 . . . A 12 C H2' . 19039 1 51 . 1 1 12 12 C H5 H 1 5.177 0.005 . 1 . . . A 12 C H5 . 19039 1 52 . 1 1 12 12 C H6 H 1 7.637 0.005 . 1 . . . A 12 C H6 . 19039 1 53 . 1 1 12 12 C C6 C 13 140.924 0.050 . 1 . . . A 12 C C6 . 19039 1 54 . 1 1 13 13 G H1' H 1 5.703 0.005 . 1 . . . A 13 G H1' . 19039 1 55 . 1 1 13 13 G H2' H 1 4.594 0.005 . 1 . . . A 13 G H2' . 19039 1 56 . 1 1 13 13 G H8 H 1 7.517 0.005 . 1 . . . A 13 G H8 . 19039 1 57 . 1 1 13 13 G C8 C 13 136.182 0.050 . 1 . . . A 13 G C8 . 19039 1 58 . 1 1 14 14 G H1' H 1 5.664 0.005 . 1 . . . A 14 G H1' . 19039 1 59 . 1 1 14 14 G H2' H 1 4.520 0.005 . 1 . . . A 14 G H2' . 19039 1 60 . 1 1 14 14 G H8 H 1 7.062 0.005 . 1 . . . A 14 G H8 . 19039 1 61 . 1 1 14 14 G C8 C 13 135.674 0.050 . 1 . . . A 14 G C8 . 19039 1 62 . 1 1 15 15 U H1' H 1 5.452 0.005 . 1 . . . A 15 U H1' . 19039 1 63 . 1 1 15 15 U H2' H 1 4.356 0.005 . 1 . . . A 15 U H2' . 19039 1 64 . 1 1 15 15 U H5 H 1 5.332 0.005 . 1 . . . A 15 U H5 . 19039 1 65 . 1 1 15 15 U H6 H 1 7.497 0.005 . 1 . . . A 15 U H6 . 19039 1 66 . 1 1 15 15 U C6 C 13 140.479 0.050 . 1 . . . A 15 U C6 . 19039 1 67 . 1 1 16 16 A H1' H 1 5.687 0.005 . 1 . . . A 16 A H1' . 19039 1 68 . 1 1 16 16 A H2 H 1 7.839 0.005 . 1 . . . A 16 A H2 . 19039 1 69 . 1 1 16 16 A H2' H 1 4.579 0.005 . 1 . . . A 16 A H2' . 19039 1 70 . 1 1 16 16 A H8 H 1 8.106 0.005 . 1 . . . A 16 A H8 . 19039 1 71 . 1 1 16 16 A C2 C 13 155.363 0.050 . 1 . . . A 16 A C2 . 19039 1 72 . 1 1 16 16 A C8 C 13 140.700 0.050 . 1 . . . A 16 A C8 . 19039 1 73 . 1 1 17 17 G H1' H 1 5.557 0.005 . 1 . . . A 17 G H1' . 19039 1 74 . 1 1 17 17 G H2' H 1 4.585 0.005 . 1 . . . A 17 G H2' . 19039 1 75 . 1 1 17 17 G H8 H 1 7.749 0.005 . 1 . . . A 17 G H8 . 19039 1 76 . 1 1 17 17 G C8 C 13 139.820 0.050 . 1 . . . A 17 G C8 . 19039 1 77 . 1 1 18 18 U H1' H 1 6.058 0.005 . 1 . . . A 18 U H1' . 19039 1 78 . 1 1 18 18 U H2' H 1 4.437 0.005 . 1 . . . A 18 U H2' . 19039 1 79 . 1 1 18 18 U H5 H 1 5.924 0.005 . 1 . . . A 18 U H5 . 19039 1 80 . 1 1 18 18 U H6 H 1 7.819 0.005 . 1 . . . A 18 U H6 . 19039 1 81 . 1 1 18 18 U C6 C 13 143.752 0.050 . 1 . . . A 18 U C6 . 19039 1 82 . 1 1 19 19 U H1' H 1 5.743 0.005 . 1 . . . A 19 U H1' . 19039 1 83 . 1 1 19 19 U H2' H 1 4.455 0.005 . 1 . . . A 19 U H2' . 19039 1 84 . 1 1 19 19 U H5 H 1 5.844 0.005 . 1 . . . A 19 U H5 . 19039 1 85 . 1 1 19 19 U H6 H 1 7.843 0.005 . 1 . . . A 19 U H6 . 19039 1 86 . 1 1 19 19 U C6 C 13 143.801 0.050 . 1 . . . A 19 U C6 . 19039 1 87 . 1 1 20 20 C H1' H 1 5.596 0.005 . 1 . . . A 20 C H1' . 19039 1 88 . 1 1 20 20 C H2' H 1 4.439 0.005 . 1 . . . A 20 C H2' . 19039 1 89 . 1 1 20 20 C H5 H 1 5.854 0.005 . 1 . . . A 20 C H5 . 19039 1 90 . 1 1 20 20 C H6 H 1 7.950 0.005 . 1 . . . A 20 C H6 . 19039 1 91 . 1 1 20 20 C C6 C 13 142.447 0.050 . 1 . . . A 20 C C6 . 19039 1 92 . 1 1 21 21 C H1' H 1 5.509 0.005 . 1 . . . A 21 C H1' . 19039 1 93 . 1 1 21 21 C H2' H 1 4.581 0.005 . 1 . . . A 21 C H2' . 19039 1 94 . 1 1 21 21 C H5 H 1 5.588 0.005 . 1 . . . A 21 C H5 . 19039 1 95 . 1 1 21 21 C H6 H 1 7.705 0.005 . 1 . . . A 21 C H6 . 19039 1 96 . 1 1 21 21 C C6 C 13 141.088 0.050 . 1 . . . A 21 C C6 . 19039 1 97 . 1 1 22 22 G H1' H 1 5.677 0.005 . 1 . . . A 22 G H1' . 19039 1 98 . 1 1 22 22 G H2' H 1 4.495 0.005 . 1 . . . A 22 G H2' . 19039 1 99 . 1 1 22 22 G H8 H 1 7.554 0.005 . 1 . . . A 22 G H8 . 19039 1 100 . 1 1 22 22 G C8 C 13 136.021 0.050 . 1 . . . A 22 G C8 . 19039 1 101 . 1 1 23 23 C H1' H 1 5.402 0.005 . 1 . . . A 23 C H1' . 19039 1 102 . 1 1 23 23 C H2' H 1 4.381 0.005 . 1 . . . A 23 C H2' . 19039 1 103 . 1 1 23 23 C H5 H 1 5.171 0.005 . 1 . . . A 23 C H5 . 19039 1 104 . 1 1 23 23 C H6 H 1 7.465 0.005 . 1 . . . A 23 C H6 . 19039 1 105 . 1 1 23 23 C C6 C 13 140.349 0.050 . 1 . . . A 23 C C6 . 19039 1 106 . 1 1 24 24 A H1' H 1 5.848 0.005 . 1 . . . A 24 A H1' . 19039 1 107 . 1 1 24 24 A H2 H 1 7.146 0.005 . 1 . . . A 24 A H2 . 19039 1 108 . 1 1 24 24 A H2' H 1 4.193 0.005 . 1 . . . A 24 A H2' . 19039 1 109 . 1 1 24 24 A H8 H 1 7.919 0.005 . 1 . . . A 24 A H8 . 19039 1 110 . 1 1 24 24 A C2 C 13 154.033 0.050 . 1 . . . A 24 A C2 . 19039 1 111 . 1 1 24 24 A C8 C 13 139.584 0.050 . 1 . . . A 24 A C8 . 19039 1 112 . 1 1 25 25 C H1' H 1 5.551 0.005 . 1 . . . A 25 C H1' . 19039 1 113 . 1 1 25 25 C H2' H 1 4.083 0.005 . 1 . . . A 25 C H2' . 19039 1 114 . 1 1 25 25 C H5 H 1 5.381 0.005 . 1 . . . A 25 C H5 . 19039 1 115 . 1 1 25 25 C H6 H 1 7.403 0.005 . 1 . . . A 25 C H6 . 19039 1 116 . 1 1 25 25 C C6 C 13 141.839 0.050 . 1 . . . A 25 C C6 . 19039 1 117 . 1 1 26 26 G H1' H 1 5.627 0.005 . 1 . . . A 26 G H1' . 19039 1 118 . 1 1 26 26 G H2' H 1 4.711 0.005 . 1 . . . A 26 G H2' . 19039 1 119 . 1 1 26 26 G H8 H 1 7.836 0.005 . 1 . . . A 26 G H8 . 19039 1 120 . 1 1 26 26 G C8 C 13 139.066 0.050 . 1 . . . A 26 G C8 . 19039 1 121 . 1 1 27 27 U H1' H 1 5.665 0.005 . 1 . . . A 27 U H1' . 19039 1 122 . 1 1 27 27 U H2' H 1 4.519 0.005 . 1 . . . A 27 U H2' . 19039 1 123 . 1 1 27 27 U H5 H 1 5.582 0.005 . 1 . . . A 27 U H5 . 19039 1 124 . 1 1 27 27 U H6 H 1 7.846 0.005 . 1 . . . A 27 U H6 . 19039 1 125 . 1 1 27 27 U C6 C 13 142.162 0.050 . 1 . . . A 27 U C6 . 19039 1 126 . 1 1 28 28 A H1' H 1 6.021 0.005 . 1 . . . A 28 A H1' . 19039 1 127 . 1 1 28 28 A H2 H 1 7.233 0.005 . 1 . . . A 28 A H2 . 19039 1 128 . 1 1 28 28 A H2' H 1 4.567 0.005 . 1 . . . A 28 A H2' . 19039 1 129 . 1 1 28 28 A H8 H 1 8.254 0.005 . 1 . . . A 28 A H8 . 19039 1 130 . 1 1 28 28 A C2 C 13 153.394 0.050 . 1 . . . A 28 A C2 . 19039 1 131 . 1 1 28 28 A C8 C 13 140.061 0.050 . 1 . . . A 28 A C8 . 19039 1 132 . 1 1 29 29 C H1' H 1 5.411 0.005 . 1 . . . A 29 C H1' . 19039 1 133 . 1 1 29 29 C H2' H 1 4.434 0.005 . 1 . . . A 29 C H2' . 19039 1 134 . 1 1 29 29 C H5 H 1 5.173 0.005 . 1 . . . A 29 C H5 . 19039 1 135 . 1 1 29 29 C H6 H 1 7.454 0.005 . 1 . . . A 29 C H6 . 19039 1 136 . 1 1 29 29 C C6 C 13 140.344 0.050 . 1 . . . A 29 C C6 . 19039 1 137 . 1 1 30 30 G H1' H 1 5.668 0.005 . 1 . . . A 30 G H1' . 19039 1 138 . 1 1 30 30 G H2' H 1 4.592 0.005 . 1 . . . A 30 G H2' . 19039 1 139 . 1 1 30 30 G H8 H 1 7.425 0.005 . 1 . . . A 30 G H8 . 19039 1 140 . 1 1 30 30 G C8 C 13 136.026 0.050 . 1 . . . A 30 G C8 . 19039 1 141 . 1 1 31 31 G H1' H 1 5.660 0.005 . 1 . . . A 31 G H1' . 19039 1 142 . 1 1 31 31 G H2' H 1 4.312 0.005 . 1 . . . A 31 G H2' . 19039 1 143 . 1 1 31 31 G H8 H 1 7.255 0.005 . 1 . . . A 31 G H8 . 19039 1 144 . 1 1 31 31 G C8 C 13 136.416 0.050 . 1 . . . A 31 G C8 . 19039 1 145 . 1 1 32 32 A H1' H 1 6.054 0.005 . 1 . . . A 32 A H1' . 19039 1 146 . 1 1 32 32 A H2 H 1 8.098 0.005 . 1 . . . A 32 A H2 . 19039 1 147 . 1 1 32 32 A H2' H 1 4.662 0.005 . 1 . . . A 32 A H2' . 19039 1 148 . 1 1 32 32 A H8 H 1 7.956 0.005 . 1 . . . A 32 A H8 . 19039 1 149 . 1 1 32 32 A C2 C 13 154.619 0.050 . 1 . . . A 32 A C2 . 19039 1 150 . 1 1 32 32 A C8 C 13 139.689 0.050 . 1 . . . A 32 A C8 . 19039 1 151 . 1 1 33 33 U H1' H 1 5.280 0.005 . 1 . . . A 33 U H1' . 19039 1 152 . 1 1 33 33 U H2' H 1 4.283 0.005 . 1 . . . A 33 U H2' . 19039 1 153 . 1 1 33 33 U H5 H 1 5.296 0.005 . 1 . . . A 33 U H5 . 19039 1 154 . 1 1 33 33 U H6 H 1 7.266 0.005 . 1 . . . A 33 U H6 . 19039 1 155 . 1 1 33 33 U C6 C 13 141.056 0.050 . 1 . . . A 33 U C6 . 19039 1 156 . 1 1 34 34 C H1' H 1 5.652 0.005 . 1 . . . A 34 C H1' . 19039 1 157 . 1 1 34 34 C H2' H 1 4.333 0.005 . 1 . . . A 34 C H2' . 19039 1 158 . 1 1 34 34 C H5 H 1 5.573 0.005 . 1 . . . A 34 C H5 . 19039 1 159 . 1 1 34 34 C H6 H 1 7.787 0.005 . 1 . . . A 34 C H6 . 19039 1 160 . 1 1 34 34 C C6 C 13 141.585 0.050 . 1 . . . A 34 C C6 . 19039 1 161 . 1 1 35 35 U H1' H 1 5.721 0.005 . 1 . . . A 35 U H1' . 19039 1 162 . 1 1 35 35 U H2' H 1 3.999 0.005 . 1 . . . A 35 U H2' . 19039 1 163 . 1 1 35 35 U H5 H 1 5.623 0.005 . 1 . . . A 35 U H5 . 19039 1 164 . 1 1 35 35 U H6 H 1 7.760 0.005 . 1 . . . A 35 U H6 . 19039 1 165 . 1 1 35 35 U C6 C 13 142.110 0.050 . 1 . . . A 35 U C6 . 19039 1 stop_ save_ save_chem_shifts_pH5.2_300K _Assigned_chem_shift_list.Sf_category assigned_chemical_shifts _Assigned_chem_shift_list.Sf_framecode chem_shifts_pH5.2_300K _Assigned_chem_shift_list.Entry_ID 19039 _Assigned_chem_shift_list.ID 2 _Assigned_chem_shift_list.Sample_condition_list_ID 3 _Assigned_chem_shift_list.Sample_condition_list_label $300K_d2o_pH5.2 _Assigned_chem_shift_list.Chem_shift_reference_ID 1 _Assigned_chem_shift_list.Chem_shift_reference_label $DSS _Assigned_chem_shift_list.Chem_shift_1H_err . _Assigned_chem_shift_list.Chem_shift_13C_err . _Assigned_chem_shift_list.Chem_shift_15N_err . _Assigned_chem_shift_list.Chem_shift_31P_err . _Assigned_chem_shift_list.Chem_shift_2H_err . _Assigned_chem_shift_list.Chem_shift_19F_err . _Assigned_chem_shift_list.Error_derivation_method . _Assigned_chem_shift_list.Details . _Assigned_chem_shift_list.Text_data_format . _Assigned_chem_shift_list.Text_data . loop_ _Chem_shift_experiment.Experiment_ID _Chem_shift_experiment.Experiment_name _Chem_shift_experiment.Sample_ID _Chem_shift_experiment.Sample_label _Chem_shift_experiment.Sample_state _Chem_shift_experiment.Entry_ID _Chem_shift_experiment.Assigned_chem_shift_list_ID 9 '2D 1H-1H NOESY' . . . 19039 2 13 '2D 1H-13C HSQC aromatic' . . . 19039 2 stop_ loop_ _Atom_chem_shift.ID _Atom_chem_shift.Assembly_atom_ID _Atom_chem_shift.Entity_assembly_ID _Atom_chem_shift.Entity_ID _Atom_chem_shift.Comp_index_ID _Atom_chem_shift.Seq_ID _Atom_chem_shift.Comp_ID _Atom_chem_shift.Atom_ID _Atom_chem_shift.Atom_type _Atom_chem_shift.Atom_isotope_number _Atom_chem_shift.Val _Atom_chem_shift.Val_err _Atom_chem_shift.Assign_fig_of_merit _Atom_chem_shift.Ambiguity_code _Atom_chem_shift.Occupancy _Atom_chem_shift.Resonance_ID _Atom_chem_shift.Auth_entity_assembly_ID _Atom_chem_shift.Auth_asym_ID _Atom_chem_shift.Auth_seq_ID _Atom_chem_shift.Auth_comp_ID _Atom_chem_shift.Auth_atom_ID _Atom_chem_shift.Details _Atom_chem_shift.Entry_ID _Atom_chem_shift.Assigned_chem_shift_list_ID 1 . 1 1 1 1 G H1' H 1 5.865 0.005 . 1 . . . A 1 G H1' . 19039 2 2 . 1 1 1 1 G H2' H 1 4.921 0.005 . 1 . . . A 1 G H2' . 19039 2 3 . 1 1 1 1 G H8 H 1 8.114 0.005 . 1 . . . A 1 G H8 . 19039 2 4 . 1 1 1 1 G C8 C 13 139.523 0.050 . 1 . . . A 1 G C8 . 19039 2 5 . 1 1 2 2 G H1' H 1 5.756 0.005 . 1 . . . A 2 G H1' . 19039 2 6 . 1 1 2 2 G H2' H 1 4.676 0.005 . 1 . . . A 2 G H2' . 19039 2 7 . 1 1 2 2 G H8 H 1 7.655 0.005 . 1 . . . A 2 G H8 . 19039 2 8 . 1 1 2 2 G C8 C 13 137.148 0.050 . 1 . . . A 2 G C8 . 19039 2 9 . 1 1 3 3 A H1' H 1 6.005 0.005 . 1 . . . A 3 A H1' . 19039 2 10 . 1 1 3 3 A H2 H 1 7.588 0.005 . 1 . . . A 3 A H2 . 19039 2 11 . 1 1 3 3 A H2' H 1 4.990 0.005 . 1 . . . A 3 A H2' . 19039 2 12 . 1 1 3 3 A H3' H 1 4.803 0.005 . 1 . . . A 3 A H3' . 19039 2 13 . 1 1 3 3 A H8 H 1 7.922 0.005 . 1 . . . A 3 A H8 . 19039 2 14 . 1 1 3 3 A C2 C 13 153.757 0.050 . 1 . . . A 3 A C2 . 19039 2 15 . 1 1 3 3 A C8 C 13 139.586 0.050 . 1 . . . A 3 A C8 . 19039 2 16 . 1 1 4 4 G H1' H 1 5.943 0.005 . 1 . . . A 4 G H1' . 19039 2 17 . 1 1 4 4 G H2' H 1 4.633 0.005 . 1 . . . A 4 G H2' . 19039 2 18 . 1 1 4 4 G H8 H 1 7.723 0.005 . 1 . . . A 4 G H8 . 19039 2 19 . 1 1 4 4 G C8 C 13 138.995 0.050 . 1 . . . A 4 G C8 . 19039 2 20 . 1 1 5 5 C H1' H 1 5.668 0.005 . 1 . . . A 5 C H1' . 19039 2 21 . 1 1 5 5 C H2' H 1 4.308 0.005 . 1 . . . A 5 C H2' . 19039 2 22 . 1 1 5 5 C H5 H 1 5.144 0.005 . 1 . . . A 5 C H5 . 19039 2 23 . 1 1 5 5 C H6 H 1 7.750 0.005 . 1 . . . A 5 C H6 . 19039 2 24 . 1 1 5 5 C C6 C 13 141.524 0.050 . 1 . . . A 5 C C6 . 19039 2 25 . 1 1 6 6 C H1' H 1 5.437 0.005 . 1 . . . A 6 C H1' . 19039 2 26 . 1 1 6 6 C H2' H 1 4.550 0.005 . 1 . . . A 6 C H2' . 19039 2 27 . 1 1 6 6 C H5 H 1 5.404 0.005 . 1 . . . A 6 C H5 . 19039 2 28 . 1 1 6 6 C H6 H 1 7.689 0.005 . 1 . . . A 6 C H6 . 19039 2 29 . 1 1 6 6 C C6 C 13 140.855 0.050 . 1 . . . A 6 C C6 . 19039 2 30 . 1 1 7 7 G H1' H 1 5.675 0.005 . 1 . . . A 7 G H1' . 19039 2 31 . 1 1 7 7 G H2' H 1 4.495 0.005 . 1 . . . A 7 G H2' . 19039 2 32 . 1 1 7 7 G H8 H 1 7.565 0.005 . 1 . . . A 7 G H8 . 19039 2 33 . 1 1 7 7 G C8 C 13 136.512 0.050 . 1 . . . A 7 G C8 . 19039 2 34 . 1 1 8 8 U H5 H 1 5.087 0.005 . 1 . . . A 8 U H5 . 19039 2 35 . 1 1 8 8 U H6 H 1 7.663 0.005 . 1 . . . A 8 U H6 . 19039 2 36 . 1 1 8 8 U C6 C 13 141.907 0.050 . 1 . . . A 8 U C6 . 19039 2 37 . 1 1 9 9 A H1' H 1 6.024 0.005 . 1 . . . A 9 A H1' . 19039 2 38 . 1 1 9 9 A H2' H 1 4.649 0.005 . 1 . . . A 9 A H2' . 19039 2 39 . 1 1 10 10 U H1' H 1 5.353 0.005 . 1 . . . A 10 U H1' . 19039 2 40 . 1 1 10 10 U H2' H 1 4.384 0.005 . 1 . . . A 10 U H2' . 19039 2 41 . 1 1 10 10 U H5 H 1 5.393 0.005 . 1 . . . A 10 U H5 . 19039 2 42 . 1 1 10 10 U H6 H 1 7.603 0.005 . 1 . . . A 10 U H6 . 19039 2 43 . 1 1 10 10 U C6 C 13 140.829 0.050 . 1 . . . A 10 U C6 . 19039 2 44 . 1 1 11 11 G H1' H 1 5.737 0.005 . 1 . . . A 11 G H1' . 19039 2 45 . 1 1 11 11 G H2' H 1 4.537 0.005 . 1 . . . A 11 G H2' . 19039 2 46 . 1 1 11 11 G H8 H 1 7.736 0.005 . 1 . . . A 11 G H8 . 19039 2 47 . 1 1 11 11 G C8 C 13 136.620 0.050 . 1 . . . A 11 G C8 . 19039 2 48 . 1 1 12 12 C H1' H 1 5.453 0.005 . 1 . . . A 12 C H1' . 19039 2 49 . 1 1 12 12 C H2' H 1 4.456 0.005 . 1 . . . A 12 C H2' . 19039 2 50 . 1 1 12 12 C H5 H 1 5.210 0.005 . 1 . . . A 12 C H5 . 19039 2 51 . 1 1 12 12 C H6 H 1 7.625 0.005 . 1 . . . A 12 C H6 . 19039 2 52 . 1 1 12 12 C C6 C 13 140.629 0.050 . 1 . . . A 12 C C6 . 19039 2 53 . 1 1 13 13 G H1' H 1 5.688 0.005 . 1 . . . A 13 G H1' . 19039 2 54 . 1 1 13 13 G H2' H 1 4.579 0.005 . 1 . . . A 13 G H2' . 19039 2 55 . 1 1 13 13 G H8 H 1 7.607 0.005 . 1 . . . A 13 G H8 . 19039 2 56 . 1 1 13 13 G C8 C 13 136.165 0.050 . 1 . . . A 13 G C8 . 19039 2 57 . 1 1 14 14 G H1' H 1 5.666 0.005 . 1 . . . A 14 G H1' . 19039 2 58 . 1 1 14 14 G H2' H 1 4.511 0.005 . 1 . . . A 14 G H2' . 19039 2 59 . 1 1 14 14 G H8 H 1 7.155 0.005 . 1 . . . A 14 G H8 . 19039 2 60 . 1 1 14 14 G C8 C 13 135.973 0.050 . 1 . . . A 14 G C8 . 19039 2 61 . 1 1 15 15 U H1' H 1 5.582 0.005 . 1 . . . A 15 U H1' . 19039 2 62 . 1 1 15 15 U H2' H 1 4.376 0.005 . 1 . . . A 15 U H2' . 19039 2 63 . 1 1 15 15 U H5 H 1 5.456 0.005 . 1 . . . A 15 U H5 . 19039 2 64 . 1 1 15 15 U H6 H 1 7.585 0.005 . 1 . . . A 15 U H6 . 19039 2 65 . 1 1 15 15 U C6 C 13 141.408 0.050 . 1 . . . A 15 U C6 . 19039 2 66 . 1 1 16 16 A H1' H 1 5.752 0.005 . 1 . . . A 16 A H1' . 19039 2 67 . 1 1 16 16 A H2 H 1 7.964 0.005 . 1 . . . A 16 A H2 . 19039 2 68 . 1 1 16 16 A H2' H 1 4.589 0.005 . 1 . . . A 16 A H2' . 19039 2 69 . 1 1 16 16 A H8 H 1 8.210 0.005 . 1 . . . A 16 A H8 . 19039 2 70 . 1 1 16 16 A C2 C 13 152.143 0.050 . 1 . . . A 16 A C2 . 19039 2 71 . 1 1 16 16 A C8 C 13 142.236 0.050 . 1 . . . A 16 A C8 . 19039 2 72 . 1 1 17 17 G H1' H 1 5.596 0.005 . 1 . . . A 17 G H1' . 19039 2 73 . 1 1 17 17 G H2' H 1 4.666 0.005 . 1 . . . A 17 G H2' . 19039 2 74 . 1 1 17 17 G H8 H 1 7.747 0.005 . 1 . . . A 17 G H8 . 19039 2 75 . 1 1 17 17 G C8 C 13 140.231 0.050 . 1 . . . A 17 G C8 . 19039 2 76 . 1 1 18 18 U H1' H 1 6.021 0.005 . 1 . . . A 18 U H1' . 19039 2 77 . 1 1 18 18 U H2' H 1 4.431 0.005 . 1 . . . A 18 U H2' . 19039 2 78 . 1 1 18 18 U H5 H 1 5.906 0.005 . 1 . . . A 18 U H5 . 19039 2 79 . 1 1 18 18 U H6 H 1 7.808 0.005 . 1 . . . A 18 U H6 . 19039 2 80 . 1 1 18 18 U C6 C 13 143.906 0.050 . 1 . . . A 18 U C6 . 19039 2 81 . 1 1 19 19 U H1' H 1 5.782 0.005 . 1 . . . A 19 U H1' . 19039 2 82 . 1 1 19 19 U H2' H 1 4.473 0.005 . 1 . . . A 19 U H2' . 19039 2 83 . 1 1 19 19 U H5 H 1 5.872 0.005 . 1 . . . A 19 U H5 . 19039 2 84 . 1 1 19 19 U H6 H 1 7.865 0.005 . 1 . . . A 19 U H6 . 19039 2 85 . 1 1 19 19 U C6 C 13 143.922 0.050 . 1 . . . A 19 U C6 . 19039 2 86 . 1 1 20 20 C H1' H 1 5.596 0.005 . 1 . . . A 20 C H1' . 19039 2 87 . 1 1 20 20 C H2' H 1 4.457 0.005 . 1 . . . A 20 C H2' . 19039 2 88 . 1 1 20 20 C H5 H 1 5.881 0.005 . 1 . . . A 20 C H5 . 19039 2 89 . 1 1 20 20 C H6 H 1 7.960 0.005 . 1 . . . A 20 C H6 . 19039 2 90 . 1 1 20 20 C C6 C 13 142.692 0.050 . 1 . . . A 20 C C6 . 19039 2 91 . 1 1 21 21 C H1' H 1 5.516 0.005 . 1 . . . A 21 C H1' . 19039 2 92 . 1 1 21 21 C H2' H 1 4.454 0.005 . 1 . . . A 21 C H2' . 19039 2 93 . 1 1 21 21 C H6 H 1 7.748 0.005 . 1 . . . A 21 C H6 . 19039 2 94 . 1 1 21 21 C C6 C 13 141.191 0.050 . 1 . . . A 21 C C6 . 19039 2 95 . 1 1 22 22 G C8 C 13 136.228 0.050 . 1 . . . A 22 G C8 . 19039 2 96 . 1 1 26 26 G C8 C 13 139.074 0.050 . 1 . . . A 26 G C8 . 19039 2 97 . 1 1 27 27 U H2' H 1 4.473 0.005 . 1 . . . A 27 U H2' . 19039 2 98 . 1 1 28 28 A H1' H 1 5.915 0.005 . 1 . . . A 28 A H1' . 19039 2 99 . 1 1 28 28 A H2' H 1 4.603 0.005 . 1 . . . A 28 A H2' . 19039 2 100 . 1 1 28 28 A H8 H 1 8.284 0.005 . 1 . . . A 28 A H8 . 19039 2 101 . 1 1 28 28 A C8 C 13 140.828 0.050 . 1 . . . A 28 A C8 . 19039 2 102 . 1 1 29 29 C H1' H 1 5.476 0.005 . 1 . . . A 29 C H1' . 19039 2 103 . 1 1 29 29 C H2' H 1 4.392 0.005 . 1 . . . A 29 C H2' . 19039 2 104 . 1 1 29 29 C H5 H 1 5.202 0.005 . 1 . . . A 29 C H5 . 19039 2 105 . 1 1 29 29 C H6 H 1 7.494 0.005 . 1 . . . A 29 C H6 . 19039 2 106 . 1 1 29 29 C C6 C 13 140.461 0.050 . 1 . . . A 29 C C6 . 19039 2 107 . 1 1 30 30 G H1' H 1 5.720 0.005 . 1 . . . A 30 G H1' . 19039 2 108 . 1 1 30 30 G H2' H 1 4.644 0.005 . 1 . . . A 30 G H2' . 19039 2 109 . 1 1 30 30 G H8 H 1 7.586 0.005 . 1 . . . A 30 G H8 . 19039 2 110 . 1 1 31 31 G H1' H 1 5.721 0.005 . 1 . . . A 31 G H1' . 19039 2 111 . 1 1 31 31 G H2' H 1 4.611 0.005 . 1 . . . A 31 G H2' . 19039 2 112 . 1 1 31 31 G H8 H 1 7.286 0.005 . 1 . . . A 31 G H8 . 19039 2 113 . 1 1 31 31 G C8 C 13 136.562 0.050 . 1 . . . A 31 G C8 . 19039 2 114 . 1 1 32 32 A H1' H 1 6.024 0.005 . 1 . . . A 32 A H1' . 19039 2 115 . 1 1 32 32 A H2 H 1 8.216 0.005 . 1 . . . A 32 A H2 . 19039 2 116 . 1 1 32 32 A H2' H 1 4.526 0.005 . 1 . . . A 32 A H2' . 19039 2 117 . 1 1 32 32 A H8 H 1 8.001 0.005 . 1 . . . A 32 A H8 . 19039 2 118 . 1 1 32 32 A C2 C 13 147.130 0.050 . 1 . . . A 32 A C2 . 19039 2 119 . 1 1 32 32 A C8 C 13 142.495 0.050 . 1 . . . A 32 A C8 . 19039 2 120 . 1 1 33 33 U H1' H 1 5.596 0.005 . 1 . . . A 33 U H1' . 19039 2 121 . 1 1 33 33 U H2' H 1 4.358 0.005 . 1 . . . A 33 U H2' . 19039 2 122 . 1 1 33 33 U H5 H 1 5.147 0.005 . 1 . . . A 33 U H5 . 19039 2 123 . 1 1 33 33 U H6 H 1 7.773 0.005 . 1 . . . A 33 U H6 . 19039 2 124 . 1 1 33 33 U C6 C 13 142.365 0.050 . 1 . . . A 33 U C6 . 19039 2 125 . 1 1 34 34 C H1' H 1 5.642 0.005 . 1 . . . A 34 C H1' . 19039 2 126 . 1 1 34 34 C H2' H 1 4.312 0.005 . 1 . . . A 34 C H2' . 19039 2 127 . 1 1 34 34 C H5 H 1 5.573 0.005 . 1 . . . A 34 C H5 . 19039 2 128 . 1 1 34 34 C H6 H 1 7.796 0.005 . 1 . . . A 34 C H6 . 19039 2 129 . 1 1 34 34 C C6 C 13 141.673 0.050 . 1 . . . A 34 C C6 . 19039 2 130 . 1 1 35 35 U H1' H 1 5.701 0.005 . 1 . . . A 35 U H1' . 19039 2 131 . 1 1 35 35 U H2' H 1 3.982 0.005 . 1 . . . A 35 U H2' . 19039 2 132 . 1 1 35 35 U H5 H 1 5.589 0.005 . 1 . . . A 35 U H5 . 19039 2 133 . 1 1 35 35 U H6 H 1 7.764 0.005 . 1 . . . A 35 U H6 . 19039 2 stop_ save_ save_chem_shifts_pH6.7_300K _Assigned_chem_shift_list.Sf_category assigned_chemical_shifts _Assigned_chem_shift_list.Sf_framecode chem_shifts_pH6.7_300K _Assigned_chem_shift_list.Entry_ID 19039 _Assigned_chem_shift_list.ID 3 _Assigned_chem_shift_list.Sample_condition_list_ID 4 _Assigned_chem_shift_list.Sample_condition_list_label $300K_d2o_pH6.7 _Assigned_chem_shift_list.Chem_shift_reference_ID 1 _Assigned_chem_shift_list.Chem_shift_reference_label $DSS _Assigned_chem_shift_list.Chem_shift_1H_err . _Assigned_chem_shift_list.Chem_shift_13C_err . _Assigned_chem_shift_list.Chem_shift_15N_err . _Assigned_chem_shift_list.Chem_shift_31P_err . _Assigned_chem_shift_list.Chem_shift_2H_err . _Assigned_chem_shift_list.Chem_shift_19F_err . _Assigned_chem_shift_list.Error_derivation_method . _Assigned_chem_shift_list.Details . _Assigned_chem_shift_list.Text_data_format . _Assigned_chem_shift_list.Text_data . loop_ _Chem_shift_experiment.Experiment_ID _Chem_shift_experiment.Experiment_name _Chem_shift_experiment.Sample_ID _Chem_shift_experiment.Sample_label _Chem_shift_experiment.Sample_state _Chem_shift_experiment.Entry_ID _Chem_shift_experiment.Assigned_chem_shift_list_ID 10 '2D 1H-1H NOESY' . . . 19039 3 14 '2D 1H-13C HSQC aromatic' . . . 19039 3 15 '2D 1H-13C HSQC aliphatic' . . . 19039 3 stop_ loop_ _Atom_chem_shift.ID _Atom_chem_shift.Assembly_atom_ID _Atom_chem_shift.Entity_assembly_ID _Atom_chem_shift.Entity_ID _Atom_chem_shift.Comp_index_ID _Atom_chem_shift.Seq_ID _Atom_chem_shift.Comp_ID _Atom_chem_shift.Atom_ID _Atom_chem_shift.Atom_type _Atom_chem_shift.Atom_isotope_number _Atom_chem_shift.Val _Atom_chem_shift.Val_err _Atom_chem_shift.Assign_fig_of_merit _Atom_chem_shift.Ambiguity_code _Atom_chem_shift.Occupancy _Atom_chem_shift.Resonance_ID _Atom_chem_shift.Auth_entity_assembly_ID _Atom_chem_shift.Auth_asym_ID _Atom_chem_shift.Auth_seq_ID _Atom_chem_shift.Auth_comp_ID _Atom_chem_shift.Auth_atom_ID _Atom_chem_shift.Details _Atom_chem_shift.Entry_ID _Atom_chem_shift.Assigned_chem_shift_list_ID 1 . 1 1 1 1 G H1' H 1 5.876 0.005 . 1 . . . A 1 G H1' . 19039 3 2 . 1 1 1 1 G H2' H 1 4.935 0.005 . 1 . . . A 1 G H2' . 19039 3 3 . 1 1 1 1 G H3' H 1 4.583 0.005 . 1 . . . A 1 G H3' . 19039 3 4 . 1 1 1 1 G H4' H 1 4.559 0.005 . 1 . . . A 1 G H4' . 19039 3 5 . 1 1 1 1 G H5' H 1 4.410 0.005 . 1 . . . A 1 G H5' . 19039 3 6 . 1 1 1 1 G H5'' H 1 4.284 0.005 . 1 . . . A 1 G H5'' . 19039 3 7 . 1 1 1 1 G H8 H 1 8.140 0.005 . 1 . . . A 1 G H8 . 19039 3 8 . 1 1 1 1 G C1' C 13 91.929 0.050 . 1 . . . A 1 G C1' . 19039 3 9 . 1 1 1 1 G C2' C 13 75.459 0.050 . 1 . . . A 1 G C2' . 19039 3 10 . 1 1 1 1 G C3' C 13 72.977 0.050 . 1 . . . A 1 G C3' . 19039 3 11 . 1 1 1 1 G C5' C 13 67.356 0.050 . 1 . . . A 1 G C5' . 19039 3 12 . 1 1 1 1 G C8 C 13 139.670 0.050 . 1 . . . A 1 G C8 . 19039 3 13 . 1 1 1 1 G N7 N 15 233.286 0.050 . 1 . . . A 1 G N7 . 19039 3 14 . 1 1 2 2 G H1' H 1 5.780 0.005 . 1 . . . A 2 G H1' . 19039 3 15 . 1 1 2 2 G H2' H 1 4.683 0.005 . 1 . . . A 2 G H2' . 19039 3 16 . 1 1 2 2 G H3' H 1 4.626 0.005 . 1 . . . A 2 G H3' . 19039 3 17 . 1 1 2 2 G H4' H 1 4.557 0.005 . 1 . . . A 2 G H4' . 19039 3 18 . 1 1 2 2 G H5'' H 1 4.243 0.005 . 1 . . . A 2 G H5'' . 19039 3 19 . 1 1 2 2 G H8 H 1 7.653 0.005 . 1 . . . A 2 G H8 . 19039 3 20 . 1 1 2 2 G C8 C 13 137.308 0.050 . 1 . . . A 2 G C8 . 19039 3 21 . 1 1 2 2 G N7 N 15 234.198 0.050 . 1 . . . A 2 G N7 . 19039 3 22 . 1 1 3 3 A H2 H 1 7.595 0.005 . 1 . . . A 3 A H2 . 19039 3 23 . 1 1 3 3 A C2 C 13 153.868 0.050 . 1 . . . A 3 A C2 . 19039 3 24 . 1 1 3 3 A C8 C 13 139.599 0.050 . 1 . . . A 3 A C8 . 19039 3 25 . 1 1 5 5 C H1' H 1 5.580 0.005 . 1 . . . A 5 C H1' . 19039 3 26 . 1 1 5 5 C H2' H 1 4.327 0.005 . 1 . . . A 5 C H2' . 19039 3 27 . 1 1 5 5 C H5 H 1 5.176 0.005 . 1 . . . A 5 C H5 . 19039 3 28 . 1 1 5 5 C H6 H 1 7.523 0.005 . 1 . . . A 5 C H6 . 19039 3 29 . 1 1 5 5 C C2' C 13 75.438 0.050 . 1 . . . A 5 C C2' . 19039 3 30 . 1 1 6 6 C H1' H 1 5.432 0.005 . 1 . . . A 6 C H1' . 19039 3 31 . 1 1 6 6 C H2' H 1 4.545 0.005 . 1 . . . A 6 C H2' . 19039 3 32 . 1 1 6 6 C H3' H 1 4.386 0.005 . 1 . . . A 6 C H3' . 19039 3 33 . 1 1 6 6 C H4' H 1 4.399 0.005 . 1 . . . A 6 C H4' . 19039 3 34 . 1 1 6 6 C H5 H 1 5.417 0.005 . 1 . . . A 6 C H5 . 19039 3 35 . 1 1 6 6 C H5' H 1 4.526 0.005 . 1 . . . A 6 C H5' . 19039 3 36 . 1 1 6 6 C H5'' H 1 4.084 0.005 . 1 . . . A 6 C H5'' . 19039 3 37 . 1 1 6 6 C H6 H 1 7.740 0.005 . 1 . . . A 6 C H6 . 19039 3 38 . 1 1 6 6 C C1' C 13 93.940 0.050 . 1 . . . A 6 C C1' . 19039 3 39 . 1 1 6 6 C C2' C 13 75.363 0.050 . 1 . . . A 6 C C2' . 19039 3 40 . 1 1 6 6 C C4' C 13 81.894 0.050 . 1 . . . A 6 C C4' . 19039 3 41 . 1 1 6 6 C C5 C 13 97.638 0.050 . 1 . . . A 6 C C5 . 19039 3 42 . 1 1 6 6 C C5' C 13 64.500 0.050 . 1 . . . A 6 C C5' . 19039 3 43 . 1 1 6 6 C C6 C 13 140.863 0.050 . 1 . . . A 6 C C6 . 19039 3 44 . 1 1 7 7 G H1' H 1 5.668 0.005 . 1 . . . A 7 G H1' . 19039 3 45 . 1 1 7 7 G H2' H 1 4.479 0.005 . 1 . . . A 7 G H2' . 19039 3 46 . 1 1 7 7 G H3' H 1 4.507 0.005 . 1 . . . A 7 G H3' . 19039 3 47 . 1 1 7 7 G H4' H 1 4.446 0.005 . 1 . . . A 7 G H4' . 19039 3 48 . 1 1 7 7 G H5'' H 1 4.088 0.005 . 1 . . . A 7 G H5'' . 19039 3 49 . 1 1 7 7 G H8 H 1 7.501 0.005 . 1 . . . A 7 G H8 . 19039 3 50 . 1 1 7 7 G C1' C 13 93.034 0.050 . 1 . . . A 7 G C1' . 19039 3 51 . 1 1 7 7 G C8 C 13 136.263 0.050 . 1 . . . A 7 G C8 . 19039 3 52 . 1 1 7 7 G N7 N 15 235.183 0.050 . 1 . . . A 7 G N7 . 19039 3 53 . 1 1 8 8 U H1' H 1 5.564 0.005 . 1 . . . A 8 U H1' . 19039 3 54 . 1 1 8 8 U H2' H 1 4.541 0.005 . 1 . . . A 8 U H2' . 19039 3 55 . 1 1 8 8 U H3' H 1 4.585 0.005 . 1 . . . A 8 U H3' . 19039 3 56 . 1 1 8 8 U H4' H 1 4.456 0.005 . 1 . . . A 8 U H4' . 19039 3 57 . 1 1 8 8 U H5 H 1 5.097 0.005 . 1 . . . A 8 U H5 . 19039 3 58 . 1 1 8 8 U H5'' H 1 4.119 0.005 . 1 . . . A 8 U H5'' . 19039 3 59 . 1 1 8 8 U H6 H 1 7.710 0.005 . 1 . . . A 8 U H6 . 19039 3 60 . 1 1 8 8 U C1' C 13 93.314 0.050 . 1 . . . A 8 U C1' . 19039 3 61 . 1 1 8 8 U C5 C 13 102.854 0.050 . 1 . . . A 8 U C5 . 19039 3 62 . 1 1 8 8 U C5' C 13 64.568 0.050 . 1 . . . A 8 U C5' . 19039 3 63 . 1 1 8 8 U C6 C 13 141.500 0.050 . 1 . . . A 8 U C6 . 19039 3 64 . 1 1 9 9 A H1' H 1 6.019 0.005 . 1 . . . A 9 A H1' . 19039 3 65 . 1 1 9 9 A H2 H 1 7.334 0.005 . 1 . . . A 9 A H2 . 19039 3 66 . 1 1 9 9 A H2' H 1 4.533 0.005 . 1 . . . A 9 A H2' . 19039 3 67 . 1 1 9 9 A H3' H 1 4.562 0.005 . 1 . . . A 9 A H3' . 19039 3 68 . 1 1 9 9 A H4' H 1 4.527 0.005 . 1 . . . A 9 A H4' . 19039 3 69 . 1 1 9 9 A H5' H 1 4.557 0.005 . 1 . . . A 9 A H5' . 19039 3 70 . 1 1 9 9 A H5'' H 1 4.179 0.005 . 1 . . . A 9 A H5'' . 19039 3 71 . 1 1 9 9 A H8 H 1 8.099 0.005 . 1 . . . A 9 A H8 . 19039 3 72 . 1 1 9 9 A C1' C 13 92.928 0.050 . 1 . . . A 9 A C1' . 19039 3 73 . 1 1 9 9 A C2 C 13 153.263 0.050 . 1 . . . A 9 A C2 . 19039 3 74 . 1 1 9 9 A C5' C 13 65.413 0.050 . 1 . . . A 9 A C5' . 19039 3 75 . 1 1 9 9 A C8 C 13 139.936 0.050 . 1 . . . A 9 A C8 . 19039 3 76 . 1 1 9 9 A N7 N 15 232.122 0.050 . 1 . . . A 9 A N7 . 19039 3 77 . 1 1 10 10 U H1' H 1 5.479 0.005 . 1 . . . A 10 U H1' . 19039 3 78 . 1 1 10 10 U H2' H 1 4.293 0.005 . 1 . . . A 10 U H2' . 19039 3 79 . 1 1 10 10 U H3' H 1 4.588 0.005 . 1 . . . A 10 U H3' . 19039 3 80 . 1 1 10 10 U H4' H 1 4.403 0.005 . 1 . . . A 10 U H4' . 19039 3 81 . 1 1 10 10 U H5 H 1 5.393 0.005 . 1 . . . A 10 U H5 . 19039 3 82 . 1 1 10 10 U H5'' H 1 4.106 0.005 . 1 . . . A 10 U H5'' . 19039 3 83 . 1 1 10 10 U H6 H 1 7.544 0.005 . 1 . . . A 10 U H6 . 19039 3 84 . 1 1 10 10 U C1' C 13 92.529 0.050 . 1 . . . A 10 U C1' . 19039 3 85 . 1 1 10 10 U C2' C 13 75.609 0.050 . 1 . . . A 10 U C2' . 19039 3 86 . 1 1 10 10 U C3' C 13 73.210 0.050 . 1 . . . A 10 U C3' . 19039 3 87 . 1 1 10 10 U C4' C 13 82.879 0.050 . 1 . . . A 10 U C4' . 19039 3 88 . 1 1 10 10 U C5 C 13 104.298 0.050 . 1 . . . A 10 U C5 . 19039 3 89 . 1 1 10 10 U C5' C 13 64.904 0.050 . 1 . . . A 10 U C5' . 19039 3 90 . 1 1 10 10 U C6 C 13 141.004 0.050 . 1 . . . A 10 U C6 . 19039 3 91 . 1 1 11 11 G H1' H 1 5.733 0.005 . 1 . . . A 11 G H1' . 19039 3 92 . 1 1 11 11 G H2' H 1 4.578 0.005 . 1 . . . A 11 G H2' . 19039 3 93 . 1 1 11 11 G H3' H 1 4.521 0.005 . 1 . . . A 11 G H3' . 19039 3 94 . 1 1 11 11 G H4' H 1 4.476 0.005 . 1 . . . A 11 G H4' . 19039 3 95 . 1 1 11 11 G H5' H 1 4.419 0.005 . 1 . . . A 11 G H5' . 19039 3 96 . 1 1 11 11 G H5'' H 1 4.162 0.005 . 1 . . . A 11 G H5'' . 19039 3 97 . 1 1 11 11 G H8 H 1 7.829 0.005 . 1 . . . A 11 G H8 . 19039 3 98 . 1 1 11 11 G C1' C 13 92.883 0.050 . 1 . . . A 11 G C1' . 19039 3 99 . 1 1 11 11 G C5' C 13 66.116 0.050 . 1 . . . A 11 G C5' . 19039 3 100 . 1 1 11 11 G C8 C 13 137.551 0.050 . 1 . . . A 11 G C8 . 19039 3 101 . 1 1 11 11 G N7 N 15 232.687 0.050 . 1 . . . A 11 G N7 . 19039 3 102 . 1 1 12 12 C H1' H 1 5.476 0.005 . 1 . . . A 12 C H1' . 19039 3 103 . 1 1 12 12 C H2' H 1 4.495 0.005 . 1 . . . A 12 C H2' . 19039 3 104 . 1 1 12 12 C H3' H 1 4.509 0.005 . 1 . . . A 12 C H3' . 19039 3 105 . 1 1 12 12 C H4' H 1 4.417 0.005 . 1 . . . A 12 C H4' . 19039 3 106 . 1 1 12 12 C H5 H 1 5.187 0.005 . 1 . . . A 12 C H5 . 19039 3 107 . 1 1 12 12 C H5' H 1 4.485 0.005 . 1 . . . A 12 C H5' . 19039 3 108 . 1 1 12 12 C H5'' H 1 4.116 0.005 . 1 . . . A 12 C H5'' . 19039 3 109 . 1 1 12 12 C H6 H 1 7.645 0.005 . 1 . . . A 12 C H6 . 19039 3 110 . 1 1 12 12 C C1' C 13 93.599 0.050 . 1 . . . A 12 C C1' . 19039 3 111 . 1 1 12 12 C C2' C 13 75.471 0.050 . 1 . . . A 12 C C2' . 19039 3 112 . 1 1 12 12 C C5 C 13 97.444 0.050 . 1 . . . A 12 C C5 . 19039 3 113 . 1 1 12 12 C C5' C 13 64.665 0.050 . 1 . . . A 12 C C5' . 19039 3 114 . 1 1 12 12 C C6 C 13 140.886 0.050 . 1 . . . A 12 C C6 . 19039 3 115 . 1 1 13 13 G H1' H 1 5.706 0.005 . 1 . . . A 13 G H1' . 19039 3 116 . 1 1 13 13 G H2' H 1 4.596 0.005 . 1 . . . A 13 G H2' . 19039 3 117 . 1 1 13 13 G H3' H 1 4.562 0.005 . 1 . . . A 13 G H3' . 19039 3 118 . 1 1 13 13 G H4' H 1 4.439 0.005 . 1 . . . A 13 G H4' . 19039 3 119 . 1 1 13 13 G H5'' H 1 4.105 0.005 . 1 . . . A 13 G H5'' . 19039 3 120 . 1 1 13 13 G H8 H 1 7.521 0.005 . 1 . . . A 13 G H8 . 19039 3 121 . 1 1 13 13 G C1' C 13 92.721 0.050 . 1 . . . A 13 G C1' . 19039 3 122 . 1 1 13 13 G C8 C 13 136.171 0.050 . 1 . . . A 13 G C8 . 19039 3 123 . 1 1 13 13 G N7 N 15 235.001 0.050 . 1 . . . A 13 G N7 . 19039 3 124 . 1 1 14 14 G H1' H 1 5.673 0.005 . 1 . . . A 14 G H1' . 19039 3 125 . 1 1 14 14 G H2' H 1 4.523 0.005 . 1 . . . A 14 G H2' . 19039 3 126 . 1 1 14 14 G H3' H 1 4.276 0.005 . 1 . . . A 14 G H3' . 19039 3 127 . 1 1 14 14 G H4' H 1 4.438 0.005 . 1 . . . A 14 G H4' . 19039 3 128 . 1 1 14 14 G H5' H 1 4.431 0.005 . 1 . . . A 14 G H5' . 19039 3 129 . 1 1 14 14 G H5'' H 1 4.034 0.005 . 1 . . . A 14 G H5'' . 19039 3 130 . 1 1 14 14 G H8 H 1 7.072 0.005 . 1 . . . A 14 G H8 . 19039 3 131 . 1 1 14 14 G C1' C 13 92.832 0.050 . 1 . . . A 14 G C1' . 19039 3 132 . 1 1 14 14 G C3' C 13 73.042 0.050 . 1 . . . A 14 G C3' . 19039 3 133 . 1 1 14 14 G C5' C 13 65.657 0.050 . 1 . . . A 14 G C5' . 19039 3 134 . 1 1 14 14 G C8 C 13 135.714 0.050 . 1 . . . A 14 G C8 . 19039 3 135 . 1 1 14 14 G N7 N 15 236.279 0.050 . 1 . . . A 14 G N7 . 19039 3 136 . 1 1 15 15 U H1' H 1 5.473 0.005 . 1 . . . A 15 U H1' . 19039 3 137 . 1 1 15 15 U H2' H 1 4.366 0.005 . 1 . . . A 15 U H2' . 19039 3 138 . 1 1 15 15 U H3' H 1 4.449 0.005 . 1 . . . A 15 U H3' . 19039 3 139 . 1 1 15 15 U H4' H 1 4.354 0.005 . 1 . . . A 15 U H4' . 19039 3 140 . 1 1 15 15 U H5 H 1 5.353 0.005 . 1 . . . A 15 U H5 . 19039 3 141 . 1 1 15 15 U H5' H 1 4.357 0.005 . 1 . . . A 15 U H5' . 19039 3 142 . 1 1 15 15 U H5'' H 1 4.047 0.005 . 1 . . . A 15 U H5'' . 19039 3 143 . 1 1 15 15 U H6 H 1 7.510 0.005 . 1 . . . A 15 U H6 . 19039 3 144 . 1 1 15 15 U C1' C 13 93.291 0.050 . 1 . . . A 15 U C1' . 19039 3 145 . 1 1 15 15 U C2' C 13 75.412 0.050 . 1 . . . A 15 U C2' . 19039 3 146 . 1 1 15 15 U C3' C 13 73.041 0.050 . 1 . . . A 15 U C3' . 19039 3 147 . 1 1 15 15 U C4' C 13 82.971 0.050 . 1 . . . A 15 U C4' . 19039 3 148 . 1 1 15 15 U C5 C 13 104.195 0.050 . 1 . . . A 15 U C5 . 19039 3 149 . 1 1 15 15 U C5' C 13 64.802 0.050 . 1 . . . A 15 U C5' . 19039 3 150 . 1 1 15 15 U C6 C 13 140.576 0.050 . 1 . . . A 15 U C6 . 19039 3 151 . 1 1 16 16 A H1' H 1 5.704 0.005 . 1 . . . A 16 A H1' . 19039 3 152 . 1 1 16 16 A H2 H 1 7.856 0.005 . 1 . . . A 16 A H2 . 19039 3 153 . 1 1 16 16 A H2' H 1 4.591 0.005 . 1 . . . A 16 A H2' . 19039 3 154 . 1 1 16 16 A H3' H 1 4.560 0.005 . 1 . . . A 16 A H3' . 19039 3 155 . 1 1 16 16 A H4' H 1 4.391 0.005 . 1 . . . A 16 A H4' . 19039 3 156 . 1 1 16 16 A H5' H 1 4.296 0.005 . 1 . . . A 16 A H5' . 19039 3 157 . 1 1 16 16 A H5'' H 1 4.047 0.005 . 1 . . . A 16 A H5'' . 19039 3 158 . 1 1 16 16 A H8 H 1 8.120 0.005 . 1 . . . A 16 A H8 . 19039 3 159 . 1 1 16 16 A C1' C 13 91.776 0.050 . 1 . . . A 16 A C1' . 19039 3 160 . 1 1 16 16 A C2 C 13 155.299 0.050 . 1 . . . A 16 A C2 . 19039 3 161 . 1 1 16 16 A C2' C 13 75.467 0.050 . 1 . . . A 16 A C2' . 19039 3 162 . 1 1 16 16 A C3' C 13 73.809 0.050 . 1 . . . A 16 A C3' . 19039 3 163 . 1 1 16 16 A C4' C 13 83.705 0.050 . 1 . . . A 16 A C4' . 19039 3 164 . 1 1 16 16 A C5' C 13 66.362 0.050 . 1 . . . A 16 A C5' . 19039 3 165 . 1 1 16 16 A C8 C 13 140.774 0.050 . 1 . . . A 16 A C8 . 19039 3 166 . 1 1 16 16 A N1 N 15 225.185 0.050 . 1 . . . A 16 A N1 . 19039 3 167 . 1 1 16 16 A N7 N 15 231.661 0.050 . 1 . . . A 16 A N7 . 19039 3 168 . 1 1 17 17 G H1' H 1 5.568 0.005 . 1 . . . A 17 G H1' . 19039 3 169 . 1 1 17 17 G H2' H 1 4.595 0.005 . 1 . . . A 17 G H2' . 19039 3 170 . 1 1 17 17 G H3' H 1 4.682 0.005 . 1 . . . A 17 G H3' . 19039 3 171 . 1 1 17 17 G H4' H 1 4.436 0.005 . 1 . . . A 17 G H4' . 19039 3 172 . 1 1 17 17 G H5' H 1 4.192 0.005 . 1 . . . A 17 G H5' . 19039 3 173 . 1 1 17 17 G H5'' H 1 4.044 0.005 . 1 . . . A 17 G H5'' . 19039 3 174 . 1 1 17 17 G H8 H 1 7.759 0.005 . 1 . . . A 17 G H8 . 19039 3 175 . 1 1 17 17 G C1' C 13 89.631 0.050 . 1 . . . A 17 G C1' . 19039 3 176 . 1 1 17 17 G C2' C 13 76.266 0.050 . 1 . . . A 17 G C2' . 19039 3 177 . 1 1 17 17 G C3' C 13 78.288 0.050 . 1 . . . A 17 G C3' . 19039 3 178 . 1 1 17 17 G C4' C 13 85.705 0.050 . 1 . . . A 17 G C4' . 19039 3 179 . 1 1 17 17 G C5' C 13 67.710 0.050 . 1 . . . A 17 G C5' . 19039 3 180 . 1 1 17 17 G C8 C 13 139.860 0.050 . 1 . . . A 17 G C8 . 19039 3 181 . 1 1 17 17 G N7 N 15 236.088 0.050 . 1 . . . A 17 G N7 . 19039 3 182 . 1 1 18 18 U H1' H 1 6.063 0.005 . 1 . . . A 18 U H1' . 19039 3 183 . 1 1 18 18 U H2' H 1 4.445 0.005 . 1 . . . A 18 U H2' . 19039 3 184 . 1 1 18 18 U H4' H 1 4.551 0.005 . 1 . . . A 18 U H4' . 19039 3 185 . 1 1 18 18 U H5 H 1 5.931 0.005 . 1 . . . A 18 U H5 . 19039 3 186 . 1 1 18 18 U H5' H 1 4.214 0.005 . 1 . . . A 18 U H5' . 19039 3 187 . 1 1 18 18 U H5'' H 1 4.168 0.005 . 1 . . . A 18 U H5'' . 19039 3 188 . 1 1 18 18 U H6 H 1 7.829 0.005 . 1 . . . A 18 U H6 . 19039 3 189 . 1 1 18 18 U C1' C 13 90.127 0.050 . 1 . . . A 18 U C1' . 19039 3 190 . 1 1 18 18 U C2' C 13 75.951 0.050 . 1 . . . A 18 U C2' . 19039 3 191 . 1 1 18 18 U C3' C 13 77.927 0.050 . 1 . . . A 18 U C3' . 19039 3 192 . 1 1 18 18 U C4' C 13 85.296 0.050 . 1 . . . A 18 U C4' . 19039 3 193 . 1 1 18 18 U C5 C 13 106.003 0.050 . 1 . . . A 18 U C5 . 19039 3 194 . 1 1 18 18 U C5' C 13 68.299 0.050 . 1 . . . A 18 U C5' . 19039 3 195 . 1 1 18 18 U C6 C 13 143.775 0.050 . 1 . . . A 18 U C6 . 19039 3 196 . 1 1 19 19 U H1' H 1 5.763 0.005 . 1 . . . A 19 U H1' . 19039 3 197 . 1 1 19 19 U H2' H 1 4.469 0.005 . 1 . . . A 19 U H2' . 19039 3 198 . 1 1 19 19 U H3' H 1 4.545 0.005 . 1 . . . A 19 U H3' . 19039 3 199 . 1 1 19 19 U H4' H 1 4.533 0.005 . 1 . . . A 19 U H4' . 19039 3 200 . 1 1 19 19 U H5 H 1 5.859 0.005 . 1 . . . A 19 U H5 . 19039 3 201 . 1 1 19 19 U H5' H 1 4.303 0.005 . 1 . . . A 19 U H5' . 19039 3 202 . 1 1 19 19 U H5'' H 1 4.252 0.005 . 1 . . . A 19 U H5'' . 19039 3 203 . 1 1 19 19 U H6 H 1 7.855 0.005 . 1 . . . A 19 U H6 . 19039 3 204 . 1 1 19 19 U C1' C 13 92.809 0.050 . 1 . . . A 19 U C1' . 19039 3 205 . 1 1 19 19 U C2' C 13 75.128 0.050 . 1 . . . A 19 U C2' . 19039 3 206 . 1 1 19 19 U C3' C 13 72.517 0.050 . 1 . . . A 19 U C3' . 19039 3 207 . 1 1 19 19 U C4' C 13 83.888 0.050 . 1 . . . A 19 U C4' . 19039 3 208 . 1 1 19 19 U C5 C 13 104.508 0.050 . 1 . . . A 19 U C5 . 19039 3 209 . 1 1 19 19 U C5' C 13 68.135 0.050 . 1 . . . A 19 U C5' . 19039 3 210 . 1 1 19 19 U C6 C 13 143.849 0.050 . 1 . . . A 19 U C6 . 19039 3 211 . 1 1 20 20 C H1' H 1 5.605 0.005 . 1 . . . A 20 C H1' . 19039 3 212 . 1 1 20 20 C H2' H 1 4.449 0.005 . 1 . . . A 20 C H2' . 19039 3 213 . 1 1 20 20 C H3' H 1 4.485 0.005 . 1 . . . A 20 C H3' . 19039 3 214 . 1 1 20 20 C H4' H 1 4.471 0.005 . 1 . . . A 20 C H4' . 19039 3 215 . 1 1 20 20 C H5 H 1 5.868 0.005 . 1 . . . A 20 C H5 . 19039 3 216 . 1 1 20 20 C H5' H 1 4.530 0.005 . 1 . . . A 20 C H5' . 19039 3 217 . 1 1 20 20 C H5'' H 1 4.215 0.005 . 1 . . . A 20 C H5'' . 19039 3 218 . 1 1 20 20 C H6 H 1 7.963 0.005 . 1 . . . A 20 C H6 . 19039 3 219 . 1 1 20 20 C C1' C 13 93.668 0.050 . 1 . . . A 20 C C1' . 19039 3 220 . 1 1 20 20 C C2' C 13 75.624 0.050 . 1 . . . A 20 C C2' . 19039 3 221 . 1 1 20 20 C C5 C 13 98.100 0.050 . 1 . . . A 20 C C5 . 19039 3 222 . 1 1 20 20 C C5' C 13 66.123 0.050 . 1 . . . A 20 C C5' . 19039 3 223 . 1 1 20 20 C C6 C 13 142.456 0.050 . 1 . . . A 20 C C6 . 19039 3 224 . 1 1 21 21 C H1' H 1 5.520 0.005 . 1 . . . A 21 C H1' . 19039 3 225 . 1 1 21 21 C H2' H 1 4.587 0.005 . 1 . . . A 21 C H2' . 19039 3 226 . 1 1 21 21 C H3' H 1 4.466 0.005 . 1 . . . A 21 C H3' . 19039 3 227 . 1 1 21 21 C H4' H 1 4.467 0.005 . 1 . . . A 21 C H4' . 19039 3 228 . 1 1 21 21 C H5 H 1 5.598 0.005 . 1 . . . A 21 C H5 . 19039 3 229 . 1 1 21 21 C H5' H 1 4.496 0.005 . 1 . . . A 21 C H5' . 19039 3 230 . 1 1 21 21 C H5'' H 1 4.158 0.005 . 1 . . . A 21 C H5'' . 19039 3 231 . 1 1 21 21 C H6 H 1 7.717 0.005 . 1 . . . A 21 C H6 . 19039 3 232 . 1 1 21 21 C C1' C 13 94.090 0.050 . 1 . . . A 21 C C1' . 19039 3 233 . 1 1 21 21 C C2' C 13 75.385 0.050 . 1 . . . A 21 C C2' . 19039 3 234 . 1 1 21 21 C C5 C 13 98.371 0.050 . 1 . . . A 21 C C5 . 19039 3 235 . 1 1 21 21 C C5' C 13 65.698 0.050 . 1 . . . A 21 C C5' . 19039 3 236 . 1 1 21 21 C C6 C 13 141.144 0.050 . 1 . . . A 21 C C6 . 19039 3 237 . 1 1 22 22 G H1' H 1 5.690 0.005 . 1 . . . A 22 G H1' . 19039 3 238 . 1 1 22 22 G H2' H 1 4.499 0.005 . 1 . . . A 22 G H2' . 19039 3 239 . 1 1 22 22 G H3' H 1 4.510 0.005 . 1 . . . A 22 G H3' . 19039 3 240 . 1 1 22 22 G H4' H 1 4.458 0.005 . 1 . . . A 22 G H4' . 19039 3 241 . 1 1 22 22 G H5' H 1 4.473 0.005 . 1 . . . A 22 G H5' . 19039 3 242 . 1 1 22 22 G H5'' H 1 4.103 0.005 . 1 . . . A 22 G H5'' . 19039 3 243 . 1 1 22 22 G H8 H 1 7.573 0.005 . 1 . . . A 22 G H8 . 19039 3 244 . 1 1 22 22 G C1' C 13 92.693 0.050 . 1 . . . A 22 G C1' . 19039 3 245 . 1 1 22 22 G C8 C 13 136.075 0.050 . 1 . . . A 22 G C8 . 19039 3 246 . 1 1 22 22 G N7 N 15 234.590 0.050 . 1 . . . A 22 G N7 . 19039 3 247 . 1 1 23 23 C H1' H 1 5.425 0.005 . 1 . . . A 23 C H1' . 19039 3 248 . 1 1 23 23 C H2' H 1 4.387 0.005 . 1 . . . A 23 C H2' . 19039 3 249 . 1 1 23 23 C H3' H 1 4.422 0.005 . 1 . . . A 23 C H3' . 19039 3 250 . 1 1 23 23 C H5 H 1 5.177 0.005 . 1 . . . A 23 C H5 . 19039 3 251 . 1 1 23 23 C H5'' H 1 4.062 0.005 . 1 . . . A 23 C H5'' . 19039 3 252 . 1 1 23 23 C H6 H 1 7.509 0.005 . 1 . . . A 23 C H6 . 19039 3 253 . 1 1 23 23 C C1' C 13 93.399 0.050 . 1 . . . A 23 C C1' . 19039 3 254 . 1 1 23 23 C C2' C 13 75.421 0.050 . 1 . . . A 23 C C2' . 19039 3 255 . 1 1 23 23 C C3' C 13 72.381 0.050 . 1 . . . A 23 C C3' . 19039 3 256 . 1 1 23 23 C C5 C 13 97.091 0.050 . 1 . . . A 23 C C5 . 19039 3 257 . 1 1 23 23 C C5' C 13 64.612 0.050 . 1 . . . A 23 C C5' . 19039 3 258 . 1 1 23 23 C C6 C 13 140.392 0.050 . 1 . . . A 23 C C6 . 19039 3 259 . 1 1 24 24 A H1' H 1 5.879 0.005 . 1 . . . A 24 A H1' . 19039 3 260 . 1 1 24 24 A H2 H 1 7.195 0.005 . 1 . . . A 24 A H2 . 19039 3 261 . 1 1 24 24 A H2' H 1 4.249 0.005 . 1 . . . A 24 A H2' . 19039 3 262 . 1 1 24 24 A H3' H 1 4.532 0.005 . 1 . . . A 24 A H3' . 19039 3 263 . 1 1 24 24 A H4' H 1 4.420 0.005 . 1 . . . A 24 A H4' . 19039 3 264 . 1 1 24 24 A H5'' H 1 4.074 0.005 . 1 . . . A 24 A H5'' . 19039 3 265 . 1 1 24 24 A H8 H 1 7.934 0.005 . 1 . . . A 24 A H8 . 19039 3 266 . 1 1 24 24 A C1' C 13 92.213 0.050 . 1 . . . A 24 A C1' . 19039 3 267 . 1 1 24 24 A C2 C 13 153.926 0.050 . 1 . . . A 24 A C2 . 19039 3 268 . 1 1 24 24 A C2' C 13 76.241 0.050 . 1 . . . A 24 A C2' . 19039 3 269 . 1 1 24 24 A C3' C 13 73.330 0.050 . 1 . . . A 24 A C3' . 19039 3 270 . 1 1 24 24 A C4' C 13 82.198 0.050 . 1 . . . A 24 A C4' . 19039 3 271 . 1 1 24 24 A C5' C 13 65.402 0.050 . 1 . . . A 24 A C5' . 19039 3 272 . 1 1 24 24 A C8 C 13 139.648 0.050 . 1 . . . A 24 A C8 . 19039 3 273 . 1 1 25 25 C H1' H 1 5.576 0.005 . 1 . . . A 25 C H1' . 19039 3 274 . 1 1 25 25 C H2' H 1 4.114 0.005 . 1 . . . A 25 C H2' . 19039 3 275 . 1 1 25 25 C H3' H 1 4.488 0.005 . 1 . . . A 25 C H3' . 19039 3 276 . 1 1 25 25 C H4' H 1 4.364 0.005 . 1 . . . A 25 C H4' . 19039 3 277 . 1 1 25 25 C H5 H 1 5.418 0.005 . 1 . . . A 25 C H5 . 19039 3 278 . 1 1 25 25 C H5' H 1 4.522 0.005 . 1 . . . A 25 C H5' . 19039 3 279 . 1 1 25 25 C H5'' H 1 4.072 0.005 . 1 . . . A 25 C H5'' . 19039 3 280 . 1 1 25 25 C H6 H 1 7.470 0.005 . 1 . . . A 25 C H6 . 19039 3 281 . 1 1 25 25 C C1' C 13 91.616 0.050 . 1 . . . A 25 C C1' . 19039 3 282 . 1 1 25 25 C C2' C 13 75.847 0.050 . 1 . . . A 25 C C2' . 19039 3 283 . 1 1 25 25 C C3' C 13 72.284 0.050 . 1 . . . A 25 C C3' . 19039 3 284 . 1 1 25 25 C C5 C 13 98.140 0.050 . 1 . . . A 25 C C5 . 19039 3 285 . 1 1 25 25 C C5' C 13 66.434 0.050 . 1 . . . A 25 C C5' . 19039 3 286 . 1 1 25 25 C C6 C 13 141.944 0.050 . 1 . . . A 25 C C6 . 19039 3 287 . 1 1 26 26 G H1' H 1 5.624 0.005 . 1 . . . A 26 G H1' . 19039 3 288 . 1 1 26 26 G H2' H 1 4.696 0.005 . 1 . . . A 26 G H2' . 19039 3 289 . 1 1 26 26 G H3' H 1 4.585 0.005 . 1 . . . A 26 G H3' . 19039 3 290 . 1 1 26 26 G H4' H 1 4.456 0.005 . 1 . . . A 26 G H4' . 19039 3 291 . 1 1 26 26 G H5' H 1 4.263 0.005 . 1 . . . A 26 G H5' . 19039 3 292 . 1 1 26 26 G H5'' H 1 4.145 0.005 . 1 . . . A 26 G H5'' . 19039 3 293 . 1 1 26 26 G H8 H 1 7.842 0.005 . 1 . . . A 26 G H8 . 19039 3 294 . 1 1 26 26 G C1' C 13 91.066 0.050 . 1 . . . A 26 G C1' . 19039 3 295 . 1 1 26 26 G C2' C 13 75.138 0.050 . 1 . . . A 26 G C2' . 19039 3 296 . 1 1 26 26 G C8 C 13 139.071 0.050 . 1 . . . A 26 G C8 . 19039 3 297 . 1 1 26 26 G N7 N 15 235.699 0.050 . 1 . . . A 26 G N7 . 19039 3 298 . 1 1 27 27 U H1' H 1 5.702 0.005 . 1 . . . A 27 U H1' . 19039 3 299 . 1 1 27 27 U H2' H 1 4.516 0.005 . 1 . . . A 27 U H2' . 19039 3 300 . 1 1 27 27 U H3' H 1 4.612 0.005 . 1 . . . A 27 U H3' . 19039 3 301 . 1 1 27 27 U H4' H 1 4.445 0.005 . 1 . . . A 27 U H4' . 19039 3 302 . 1 1 27 27 U H5 H 1 5.582 0.005 . 1 . . . A 27 U H5 . 19039 3 303 . 1 1 27 27 U H5'' H 1 4.202 0.005 . 1 . . . A 27 U H5'' . 19039 3 304 . 1 1 27 27 U H6 H 1 7.851 0.005 . 1 . . . A 27 U H6 . 19039 3 305 . 1 1 27 27 U C1' C 13 92.790 0.050 . 1 . . . A 27 U C1' . 19039 3 306 . 1 1 27 27 U C5 C 13 104.147 0.050 . 1 . . . A 27 U C5 . 19039 3 307 . 1 1 27 27 U C5' C 13 65.874 0.050 . 1 . . . A 27 U C5' . 19039 3 308 . 1 1 27 27 U C6 C 13 142.304 0.050 . 1 . . . A 27 U C6 . 19039 3 309 . 1 1 28 28 A H1' H 1 6.009 0.005 . 1 . . . A 28 A H1' . 19039 3 310 . 1 1 28 28 A H2 H 1 7.271 0.005 . 1 . . . A 28 A H2 . 19039 3 311 . 1 1 28 28 A H2' H 1 4.580 0.005 . 1 . . . A 28 A H2' . 19039 3 312 . 1 1 28 28 A H3' H 1 4.707 0.005 . 1 . . . A 28 A H3' . 19039 3 313 . 1 1 28 28 A H4' H 1 4.535 0.005 . 1 . . . A 28 A H4' . 19039 3 314 . 1 1 28 28 A H5' H 1 4.552 0.005 . 1 . . . A 28 A H5' . 19039 3 315 . 1 1 28 28 A H5'' H 1 4.219 0.005 . 1 . . . A 28 A H5'' . 19039 3 316 . 1 1 28 28 A H8 H 1 8.267 0.005 . 1 . . . A 28 A H8 . 19039 3 317 . 1 1 28 28 A C1' C 13 92.724 0.050 . 1 . . . A 28 A C1' . 19039 3 318 . 1 1 28 28 A C2 C 13 153.461 0.050 . 1 . . . A 28 A C2 . 19039 3 319 . 1 1 28 28 A C2' C 13 75.501 0.050 . 1 . . . A 28 A C2' . 19039 3 320 . 1 1 28 28 A C3' C 13 73.286 0.050 . 1 . . . A 28 A C3' . 19039 3 321 . 1 1 28 28 A C4' C 13 82.246 0.050 . 1 . . . A 28 A C4' . 19039 3 322 . 1 1 28 28 A C5' C 13 65.221 0.050 . 1 . . . A 28 A C5' . 19039 3 323 . 1 1 28 28 A C8 C 13 140.173 0.050 . 1 . . . A 28 A C8 . 19039 3 324 . 1 1 28 28 A N7 N 15 229.165 0.050 . 1 . . . A 28 A N7 . 19039 3 325 . 1 1 29 29 C H1' H 1 5.436 0.005 . 1 . . . A 29 C H1' . 19039 3 326 . 1 1 29 29 C H2' H 1 4.433 0.005 . 1 . . . A 29 C H2' . 19039 3 327 . 1 1 29 29 C H3' H 1 4.415 0.005 . 1 . . . A 29 C H3' . 19039 3 328 . 1 1 29 29 C H4' H 1 4.428 0.005 . 1 . . . A 29 C H4' . 19039 3 329 . 1 1 29 29 C H5 H 1 5.178 0.005 . 1 . . . A 29 C H5 . 19039 3 330 . 1 1 29 29 C H5' H 1 4.499 0.005 . 1 . . . A 29 C H5' . 19039 3 331 . 1 1 29 29 C H5'' H 1 4.099 0.005 . 1 . . . A 29 C H5'' . 19039 3 332 . 1 1 29 29 C H6 H 1 7.474 0.005 . 1 . . . A 29 C H6 . 19039 3 333 . 1 1 29 29 C C1' C 13 93.641 0.050 . 1 . . . A 29 C C1' . 19039 3 334 . 1 1 29 29 C C2' C 13 75.601 0.050 . 1 . . . A 29 C C2' . 19039 3 335 . 1 1 29 29 C C3' C 13 72.262 0.050 . 1 . . . A 29 C C3' . 19039 3 336 . 1 1 29 29 C C5 C 13 97.232 0.050 . 1 . . . A 29 C C5 . 19039 3 337 . 1 1 29 29 C C5' C 13 64.496 0.050 . 1 . . . A 29 C C5' . 19039 3 338 . 1 1 29 29 C C6 C 13 140.392 0.050 . 1 . . . A 29 C C6 . 19039 3 339 . 1 1 30 30 G H1' H 1 5.691 0.005 . 1 . . . A 30 G H1' . 19039 3 340 . 1 1 30 30 G H2' H 1 4.611 0.005 . 1 . . . A 30 G H2' . 19039 3 341 . 1 1 30 30 G H3' H 1 4.494 0.005 . 1 . . . A 30 G H3' . 19039 3 342 . 1 1 30 30 G H4' H 1 4.475 0.005 . 1 . . . A 30 G H4' . 19039 3 343 . 1 1 30 30 G H5' H 1 4.475 0.005 . 1 . . . A 30 G H5' . 19039 3 344 . 1 1 30 30 G H5'' H 1 4.101 0.005 . 1 . . . A 30 G H5'' . 19039 3 345 . 1 1 30 30 G H8 H 1 7.449 0.005 . 1 . . . A 30 G H8 . 19039 3 346 . 1 1 30 30 G C1' C 13 92.873 0.050 . 1 . . . A 30 G C1' . 19039 3 347 . 1 1 30 30 G C8 C 13 136.069 0.050 . 1 . . . A 30 G C8 . 19039 3 348 . 1 1 30 30 G N7 N 15 234.916 0.050 . 1 . . . A 30 G N7 . 19039 3 349 . 1 1 31 31 G H1' H 1 5.688 0.005 . 1 . . . A 31 G H1' . 19039 3 350 . 1 1 31 31 G H3' H 1 4.603 0.005 . 1 . . . A 31 G H3' . 19039 3 351 . 1 1 31 31 G H4' H 1 4.440 0.005 . 1 . . . A 31 G H4' . 19039 3 352 . 1 1 31 31 G H5' H 1 4.511 0.005 . 1 . . . A 31 G H5' . 19039 3 353 . 1 1 31 31 G H5'' H 1 4.100 0.005 . 1 . . . A 31 G H5'' . 19039 3 354 . 1 1 31 31 G H8 H 1 7.261 0.005 . 1 . . . A 31 G H8 . 19039 3 355 . 1 1 31 31 G C1' C 13 92.799 0.050 . 1 . . . A 31 G C1' . 19039 3 356 . 1 1 31 31 G C4' C 13 82.555 0.050 . 1 . . . A 31 G C4' . 19039 3 357 . 1 1 31 31 G C8 C 13 136.498 0.050 . 1 . . . A 31 G C8 . 19039 3 358 . 1 1 31 31 G N7 N 15 233.898 0.050 . 1 . . . A 31 G N7 . 19039 3 359 . 1 1 32 32 A H1' H 1 6.057 0.005 . 1 . . . A 32 A H1' . 19039 3 360 . 1 1 32 32 A H8 H 1 7.978 0.005 . 1 . . . A 32 A H8 . 19039 3 361 . 1 1 32 32 A C2 C 13 154.612 0.050 . 1 . . . A 32 A C2 . 19039 3 362 . 1 1 33 33 U C1' C 13 94.106 0.050 . 1 . . . A 33 U C1' . 19039 3 363 . 1 1 33 33 U C5 C 13 104.186 0.050 . 1 . . . A 33 U C5 . 19039 3 364 . 1 1 34 34 C H1' H 1 5.661 0.005 . 1 . . . A 34 C H1' . 19039 3 365 . 1 1 34 34 C H2' H 1 4.339 0.005 . 1 . . . A 34 C H2' . 19039 3 366 . 1 1 34 34 C H3' H 1 4.352 0.005 . 1 . . . A 34 C H3' . 19039 3 367 . 1 1 34 34 C H5 H 1 5.578 0.005 . 1 . . . A 34 C H5 . 19039 3 368 . 1 1 34 34 C H5'' H 1 4.011 0.005 . 1 . . . A 34 C H5'' . 19039 3 369 . 1 1 34 34 C H6 H 1 7.808 0.005 . 1 . . . A 34 C H6 . 19039 3 370 . 1 1 34 34 C C1' C 13 93.084 0.050 . 1 . . . A 34 C C1' . 19039 3 371 . 1 1 34 34 C C2' C 13 75.322 0.050 . 1 . . . A 34 C C2' . 19039 3 372 . 1 1 34 34 C C5 C 13 97.421 0.050 . 1 . . . A 34 C C5 . 19039 3 373 . 1 1 34 34 C C5' C 13 64.534 0.050 . 1 . . . A 34 C C5' . 19039 3 374 . 1 1 34 34 C C6 C 13 141.613 0.050 . 1 . . . A 34 C C6 . 19039 3 375 . 1 1 35 35 U H1' H 1 5.725 0.005 . 1 . . . A 35 U H1' . 19039 3 376 . 1 1 35 35 U H2' H 1 4.004 0.005 . 1 . . . A 35 U H2' . 19039 3 377 . 1 1 35 35 U H3' H 1 4.170 0.005 . 1 . . . A 35 U H3' . 19039 3 378 . 1 1 35 35 U H4' H 1 4.163 0.005 . 1 . . . A 35 U H4' . 19039 3 379 . 1 1 35 35 U H5 H 1 5.625 0.005 . 1 . . . A 35 U H5 . 19039 3 380 . 1 1 35 35 U H5' H 1 4.527 0.005 . 1 . . . A 35 U H5' . 19039 3 381 . 1 1 35 35 U H6 H 1 7.774 0.005 . 1 . . . A 35 U H6 . 19039 3 382 . 1 1 35 35 U C5 C 13 104.633 0.050 . 1 . . . A 35 U C5 . 19039 3 383 . 1 1 35 35 U C6 C 13 142.147 0.050 . 1 . . . A 35 U C6 . 19039 3 stop_ save_ save_chem_shifts_pH7.8_275K _Assigned_chem_shift_list.Sf_category assigned_chemical_shifts _Assigned_chem_shift_list.Sf_framecode chem_shifts_pH7.8_275K _Assigned_chem_shift_list.Entry_ID 19039 _Assigned_chem_shift_list.ID 4 _Assigned_chem_shift_list.Sample_condition_list_ID 2 _Assigned_chem_shift_list.Sample_condition_list_label $275K_h2o_pH7.8 _Assigned_chem_shift_list.Chem_shift_reference_ID 1 _Assigned_chem_shift_list.Chem_shift_reference_label $DSS _Assigned_chem_shift_list.Chem_shift_1H_err . _Assigned_chem_shift_list.Chem_shift_13C_err . _Assigned_chem_shift_list.Chem_shift_15N_err . _Assigned_chem_shift_list.Chem_shift_31P_err . _Assigned_chem_shift_list.Chem_shift_2H_err . _Assigned_chem_shift_list.Chem_shift_19F_err . _Assigned_chem_shift_list.Error_derivation_method . _Assigned_chem_shift_list.Details . _Assigned_chem_shift_list.Text_data_format . _Assigned_chem_shift_list.Text_data . loop_ _Chem_shift_experiment.Experiment_ID _Chem_shift_experiment.Experiment_name _Chem_shift_experiment.Sample_ID _Chem_shift_experiment.Sample_label _Chem_shift_experiment.Sample_state _Chem_shift_experiment.Entry_ID _Chem_shift_experiment.Assigned_chem_shift_list_ID 3 '2D 1H-1H NOESY' . . . 19039 4 5 '2D 1H-15N HSQC' . . . 19039 4 8 '2D JNN HNN COSY' . . . 19039 4 stop_ loop_ _Atom_chem_shift.ID _Atom_chem_shift.Assembly_atom_ID _Atom_chem_shift.Entity_assembly_ID _Atom_chem_shift.Entity_ID _Atom_chem_shift.Comp_index_ID _Atom_chem_shift.Seq_ID _Atom_chem_shift.Comp_ID _Atom_chem_shift.Atom_ID _Atom_chem_shift.Atom_type _Atom_chem_shift.Atom_isotope_number _Atom_chem_shift.Val _Atom_chem_shift.Val_err _Atom_chem_shift.Assign_fig_of_merit _Atom_chem_shift.Ambiguity_code _Atom_chem_shift.Occupancy _Atom_chem_shift.Resonance_ID _Atom_chem_shift.Auth_entity_assembly_ID _Atom_chem_shift.Auth_asym_ID _Atom_chem_shift.Auth_seq_ID _Atom_chem_shift.Auth_comp_ID _Atom_chem_shift.Auth_atom_ID _Atom_chem_shift.Details _Atom_chem_shift.Entry_ID _Atom_chem_shift.Assigned_chem_shift_list_ID 1 . 1 1 1 1 G H1 H 1 10.910 0.005 . 1 . . . A 1 G H1 . 19039 4 2 . 1 1 1 1 G N1 N 15 143.336 0.050 . 1 . . . A 1 G N1 . 19039 4 3 . 1 1 2 2 G H1 H 1 12.608 0.005 . 1 . . . A 2 G H1 . 19039 4 4 . 1 1 2 2 G N1 N 15 146.888 0.050 . 1 . . . A 2 G N1 . 19039 4 5 . 1 1 4 4 G H1 H 1 11.165 0.005 . 1 . . . A 4 G H1 . 19039 4 6 . 1 1 4 4 G N1 N 15 145.936 0.050 . 1 . . . A 4 G N1 . 19039 4 7 . 1 1 5 5 C H41 H 1 8.498 0.005 . 1 . . . A 5 C H41 . 19039 4 8 . 1 1 5 5 C H42 H 1 6.912 0.005 . 1 . . . A 5 C H42 . 19039 4 9 . 1 1 5 5 C N3 N 15 197.671 0.050 . 1 . . . A 5 C N3 . 19039 4 10 . 1 1 5 5 C N4 N 15 97.659 0.050 . 1 . . . A 5 C N4 . 19039 4 11 . 1 1 6 6 C H41 H 1 8.306 0.005 . 1 . . . A 6 C H41 . 19039 4 12 . 1 1 6 6 C H42 H 1 6.812 0.005 . 1 . . . A 6 C H42 . 19039 4 13 . 1 1 6 6 C N3 N 15 195.837 0.050 . 1 . . . A 6 C N3 . 19039 4 14 . 1 1 6 6 C N4 N 15 97.992 0.050 . 1 . . . A 6 C N4 . 19039 4 15 . 1 1 7 7 G H1 H 1 12.735 0.005 . 1 . . . A 7 G H1 . 19039 4 16 . 1 1 7 7 G H21 H 1 8.145 0.005 . 1 . . . A 7 G H21 . 19039 4 17 . 1 1 7 7 G H22 H 1 6.016 0.005 . 1 . . . A 7 G H22 . 19039 4 18 . 1 1 7 7 G N1 N 15 147.159 0.050 . 1 . . . A 7 G N1 . 19039 4 19 . 1 1 8 8 U H3 H 1 13.575 0.005 . 1 . . . A 8 U H3 . 19039 4 20 . 1 1 8 8 U N3 N 15 161.746 0.050 . 1 . . . A 8 U N3 . 19039 4 21 . 1 1 10 10 U H3 H 1 11.527 0.005 . 1 . . . A 10 U H3 . 19039 4 22 . 1 1 11 11 G H1 H 1 12.542 0.005 . 1 . . . A 11 G H1 . 19039 4 23 . 1 1 11 11 G H21 H 1 8.149 0.005 . 1 . . . A 11 G H21 . 19039 4 24 . 1 1 11 11 G H22 H 1 6.029 0.005 . 1 . . . A 11 G H22 . 19039 4 25 . 1 1 11 11 G N1 N 15 147.760 0.050 . 1 . . . A 11 G N1 . 19039 4 26 . 1 1 12 12 C H41 H 1 8.413 0.005 . 1 . . . A 12 C H41 . 19039 4 27 . 1 1 12 12 C H42 H 1 6.734 0.005 . 1 . . . A 12 C H42 . 19039 4 28 . 1 1 12 12 C N3 N 15 196.800 0.050 . 1 . . . A 12 C N3 . 19039 4 29 . 1 1 12 12 C N4 N 15 97.794 0.050 . 1 . . . A 12 C N4 . 19039 4 30 . 1 1 13 13 G H1 H 1 12.345 0.005 . 1 . . . A 13 G H1 . 19039 4 31 . 1 1 13 13 G H21 H 1 7.983 0.005 . 1 . . . A 13 G H21 . 19039 4 32 . 1 1 13 13 G H22 H 1 5.832 0.005 . 1 . . . A 13 G H22 . 19039 4 33 . 1 1 13 13 G N1 N 15 146.657 0.050 . 1 . . . A 13 G N1 . 19039 4 34 . 1 1 14 14 G H1 H 1 13.294 0.005 . 1 . . . A 14 G H1 . 19039 4 35 . 1 1 14 14 G H21 H 1 8.724 0.005 . 1 . . . A 14 G H21 . 19039 4 36 . 1 1 14 14 G H22 H 1 6.004 0.005 . 1 . . . A 14 G H22 . 19039 4 37 . 1 1 14 14 G N1 N 15 148.488 0.050 . 1 . . . A 14 G N1 . 19039 4 38 . 1 1 15 15 U H3 H 1 10.660 0.005 . 1 . . . A 15 U H3 . 19039 4 39 . 1 1 15 15 U N3 N 15 157.347 0.050 . 1 . . . A 15 U N3 . 19039 4 40 . 1 1 17 17 G H1 H 1 10.878 0.005 . 1 . . . A 17 G H1 . 19039 4 41 . 1 1 17 17 G N1 N 15 147.098 0.050 . 1 . . . A 17 G N1 . 19039 4 42 . 1 1 20 20 C H41 H 1 8.462 0.005 . 1 . . . A 20 C H41 . 19039 4 43 . 1 1 20 20 C H42 H 1 7.279 0.005 . 1 . . . A 20 C H42 . 19039 4 44 . 1 1 20 20 C N3 N 15 197.289 0.050 . 1 . . . A 20 C N3 . 19039 4 45 . 1 1 20 20 C N4 N 15 99.114 0.050 . 1 . . . A 20 C N4 . 19039 4 46 . 1 1 21 21 C H41 H 1 8.491 0.005 . 1 . . . A 21 C H41 . 19039 4 47 . 1 1 21 21 C H42 H 1 6.804 0.005 . 1 . . . A 21 C H42 . 19039 4 48 . 1 1 21 21 C N3 N 15 196.627 0.050 . 1 . . . A 21 C N3 . 19039 4 49 . 1 1 21 21 C N4 N 15 97.594 0.050 . 1 . . . A 21 C N4 . 19039 4 50 . 1 1 22 22 G H1 H 1 12.870 0.005 . 1 . . . A 22 G H1 . 19039 4 51 . 1 1 22 22 G H21 H 1 8.207 0.005 . 1 . . . A 22 G H21 . 19039 4 52 . 1 1 22 22 G H22 H 1 5.846 0.005 . 1 . . . A 22 G H22 . 19039 4 53 . 1 1 22 22 G N1 N 15 147.489 0.050 . 1 . . . A 22 G N1 . 19039 4 54 . 1 1 23 23 C H41 H 1 8.188 0.005 . 1 . . . A 23 C H41 . 19039 4 55 . 1 1 23 23 C H42 H 1 6.919 0.005 . 1 . . . A 23 C H42 . 19039 4 56 . 1 1 23 23 C N3 N 15 196.067 0.050 . 1 . . . A 23 C N3 . 19039 4 57 . 1 1 23 23 C N4 N 15 98.221 0.050 . 1 . . . A 23 C N4 . 19039 4 58 . 1 1 26 26 G H1 H 1 11.113 0.005 . 1 . . . A 26 G H1 . 19039 4 59 . 1 1 28 28 A H61 H 1 7.890 0.005 . 1 . . . A 28 A H61 . 19039 4 60 . 1 1 28 28 A H62 H 1 6.522 0.005 . 1 . . . A 28 A H62 . 19039 4 61 . 1 1 28 28 A N1 N 15 222.078 0.050 . 1 . . . A 28 A N1 . 19039 4 62 . 1 1 28 28 A N6 N 15 84.597 0.050 . 1 . . . A 28 A N6 . 19039 4 63 . 1 1 29 29 C H41 H 1 8.157 0.005 . 1 . . . A 29 C H41 . 19039 4 64 . 1 1 29 29 C H42 H 1 6.845 0.005 . 1 . . . A 29 C H42 . 19039 4 65 . 1 1 29 29 C N3 N 15 196.654 0.050 . 1 . . . A 29 C N3 . 19039 4 66 . 1 1 29 29 C N4 N 15 98.291 0.050 . 1 . . . A 29 C N4 . 19039 4 67 . 1 1 30 30 G H1 H 1 12.447 0.005 . 1 . . . A 30 G H1 . 19039 4 68 . 1 1 30 30 G H21 H 1 7.974 0.005 . 1 . . . A 30 G H21 . 19039 4 69 . 1 1 30 30 G H22 H 1 5.768 0.005 . 1 . . . A 30 G H22 . 19039 4 70 . 1 1 30 30 G N1 N 15 146.721 0.050 . 1 . . . A 30 G N1 . 19039 4 71 . 1 1 31 31 G H1 H 1 12.619 0.005 . 1 . . . A 31 G H1 . 19039 4 72 . 1 1 31 31 G N1 N 15 147.755 0.050 . 1 . . . A 31 G N1 . 19039 4 73 . 1 1 34 34 C H41 H 1 8.472 0.005 . 1 . . . A 34 C H41 . 19039 4 74 . 1 1 34 34 C H42 H 1 7.105 0.005 . 1 . . . A 34 C H42 . 19039 4 75 . 1 1 34 34 C N4 N 15 99.181 0.050 . 1 . . . A 34 C N4 . 19039 4 76 . 1 1 35 35 U H3 H 1 11.933 0.005 . 1 . . . A 35 U H3 . 19039 4 77 . 1 1 35 35 U N3 N 15 157.883 0.050 . 1 . . . A 35 U N3 . 19039 4 stop_ save_ save_chem_shifts_pH5.2_275K _Assigned_chem_shift_list.Sf_category assigned_chemical_shifts _Assigned_chem_shift_list.Sf_framecode chem_shifts_pH5.2_275K _Assigned_chem_shift_list.Entry_ID 19039 _Assigned_chem_shift_list.ID 5 _Assigned_chem_shift_list.Sample_condition_list_ID 5 _Assigned_chem_shift_list.Sample_condition_list_label $275K_h2o_pH5.2 _Assigned_chem_shift_list.Chem_shift_reference_ID 1 _Assigned_chem_shift_list.Chem_shift_reference_label $DSS _Assigned_chem_shift_list.Chem_shift_1H_err . _Assigned_chem_shift_list.Chem_shift_13C_err . _Assigned_chem_shift_list.Chem_shift_15N_err . _Assigned_chem_shift_list.Chem_shift_31P_err . _Assigned_chem_shift_list.Chem_shift_2H_err . _Assigned_chem_shift_list.Chem_shift_19F_err . _Assigned_chem_shift_list.Error_derivation_method . _Assigned_chem_shift_list.Details . _Assigned_chem_shift_list.Text_data_format . _Assigned_chem_shift_list.Text_data . loop_ _Chem_shift_experiment.Experiment_ID _Chem_shift_experiment.Experiment_name _Chem_shift_experiment.Sample_ID _Chem_shift_experiment.Sample_label _Chem_shift_experiment.Sample_state _Chem_shift_experiment.Entry_ID _Chem_shift_experiment.Assigned_chem_shift_list_ID 11 '2D 1H-1H NOESY' . . . 19039 5 16 '2D 1H-15N HSQC' . . . 19039 5 18 '2D JNN HNN COSY' . . . 19039 5 stop_ loop_ _Atom_chem_shift.ID _Atom_chem_shift.Assembly_atom_ID _Atom_chem_shift.Entity_assembly_ID _Atom_chem_shift.Entity_ID _Atom_chem_shift.Comp_index_ID _Atom_chem_shift.Seq_ID _Atom_chem_shift.Comp_ID _Atom_chem_shift.Atom_ID _Atom_chem_shift.Atom_type _Atom_chem_shift.Atom_isotope_number _Atom_chem_shift.Val _Atom_chem_shift.Val_err _Atom_chem_shift.Assign_fig_of_merit _Atom_chem_shift.Ambiguity_code _Atom_chem_shift.Occupancy _Atom_chem_shift.Resonance_ID _Atom_chem_shift.Auth_entity_assembly_ID _Atom_chem_shift.Auth_asym_ID _Atom_chem_shift.Auth_seq_ID _Atom_chem_shift.Auth_comp_ID _Atom_chem_shift.Auth_atom_ID _Atom_chem_shift.Details _Atom_chem_shift.Entry_ID _Atom_chem_shift.Assigned_chem_shift_list_ID 1 . 1 1 1 1 G H1 H 1 10.850 0.005 . 1 . . . A 1 G H1 . 19039 5 2 . 1 1 1 1 G N1 N 15 144.760 0.050 . 1 . . . A 1 G N1 . 19039 5 3 . 1 1 2 2 G H1 H 1 12.564 0.005 . 1 . . . A 2 G H1 . 19039 5 4 . 1 1 2 2 G N1 N 15 146.776 0.050 . 1 . . . A 2 G N1 . 19039 5 5 . 1 1 3 3 A H61 H 1 7.807 0.005 . 1 . . . A 3 A H61 . 19039 5 6 . 1 1 3 3 A H62 H 1 6.881 0.005 . 1 . . . A 3 A H62 . 19039 5 7 . 1 1 3 3 A N1 N 15 222.001 0.050 . 1 . . . A 3 A N1 . 19039 5 8 . 1 1 3 3 A N6 N 15 83.553 0.050 . 1 . . . A 3 A N6 . 19039 5 9 . 1 1 4 4 G H1 H 1 11.136 0.005 . 1 . . . A 4 G H1 . 19039 5 10 . 1 1 4 4 G N1 N 15 145.662 0.050 . 1 . . . A 4 G N1 . 19039 5 11 . 1 1 5 5 C H41 H 1 8.446 0.005 . 1 . . . A 5 C H41 . 19039 5 12 . 1 1 5 5 C H42 H 1 7.043 0.005 . 1 . . . A 5 C H42 . 19039 5 13 . 1 1 5 5 C N3 N 15 196.449 0.050 . 1 . . . A 5 C N3 . 19039 5 14 . 1 1 5 5 C N4 N 15 99.240 0.050 . 1 . . . A 5 C N4 . 19039 5 15 . 1 1 6 6 C H41 H 1 8.288 0.005 . 1 . . . A 6 C H41 . 19039 5 16 . 1 1 6 6 C H42 H 1 6.871 0.005 . 1 . . . A 6 C H42 . 19039 5 17 . 1 1 6 6 C N3 N 15 196.514 0.050 . 1 . . . A 6 C N3 . 19039 5 18 . 1 1 6 6 C N4 N 15 97.811 0.050 . 1 . . . A 6 C N4 . 19039 5 19 . 1 1 7 7 G H1 H 1 12.884 0.005 . 1 . . . A 7 G H1 . 19039 5 20 . 1 1 7 7 G N1 N 15 147.245 0.050 . 1 . . . A 7 G N1 . 19039 5 21 . 1 1 8 8 U H3 H 1 13.582 0.005 . 1 . . . A 8 U H3 . 19039 5 22 . 1 1 8 8 U N3 N 15 162.089 0.050 . 1 . . . A 8 U N3 . 19039 5 23 . 1 1 11 11 G H1 H 1 12.492 0.005 . 1 . . . A 11 G H1 . 19039 5 24 . 1 1 11 11 G N1 N 15 147.538 0.050 . 1 . . . A 11 G N1 . 19039 5 25 . 1 1 12 12 C H41 H 1 8.386 0.005 . 1 . . . A 12 C H41 . 19039 5 26 . 1 1 12 12 C H42 H 1 6.823 0.005 . 1 . . . A 12 C H42 . 19039 5 27 . 1 1 12 12 C N4 N 15 98.293 0.050 . 1 . . . A 12 C N4 . 19039 5 28 . 1 1 13 13 G H1 H 1 12.386 0.005 . 1 . . . A 13 G H1 . 19039 5 29 . 1 1 13 13 G N1 N 15 146.853 0.050 . 1 . . . A 13 G N1 . 19039 5 30 . 1 1 14 14 G H1 H 1 13.272 0.005 . 1 . . . A 14 G H1 . 19039 5 31 . 1 1 14 14 G H21 H 1 8.706 0.005 . 1 . . . A 14 G H21 . 19039 5 32 . 1 1 14 14 G N1 N 15 148.476 0.050 . 1 . . . A 14 G N1 . 19039 5 33 . 1 1 15 15 U H3 H 1 10.708 0.005 . 1 . . . A 15 U H3 . 19039 5 34 . 1 1 15 15 U N3 N 15 157.463 0.050 . 1 . . . A 15 U N3 . 19039 5 35 . 1 1 17 17 G H1 H 1 10.843 0.005 . 1 . . . A 17 G H1 . 19039 5 36 . 1 1 17 17 G N1 N 15 146.929 0.050 . 1 . . . A 17 G N1 . 19039 5 37 . 1 1 20 20 C H41 H 1 8.454 0.005 . 1 . . . A 20 C H41 . 19039 5 38 . 1 1 20 20 C H42 H 1 7.282 0.005 . 1 . . . A 20 C H42 . 19039 5 39 . 1 1 20 20 C N4 N 15 98.961 0.050 . 1 . . . A 20 C N4 . 19039 5 40 . 1 1 21 21 C H41 H 1 8.466 0.005 . 1 . . . A 21 C H41 . 19039 5 41 . 1 1 21 21 C H42 H 1 6.850 0.005 . 1 . . . A 21 C H42 . 19039 5 42 . 1 1 21 21 C N3 N 15 196.653 0.050 . 1 . . . A 21 C N3 . 19039 5 43 . 1 1 21 21 C N4 N 15 97.551 0.050 . 1 . . . A 21 C N4 . 19039 5 44 . 1 1 22 22 G H1 H 1 12.827 0.005 . 1 . . . A 22 G H1 . 19039 5 45 . 1 1 22 22 G N1 N 15 147.612 0.050 . 1 . . . A 22 G N1 . 19039 5 46 . 1 1 23 23 C H41 H 1 8.335 0.005 . 1 . . . A 23 C H41 . 19039 5 47 . 1 1 23 23 C H42 H 1 6.924 0.005 . 1 . . . A 23 C H42 . 19039 5 48 . 1 1 23 23 C N4 N 15 98.372 0.050 . 1 . . . A 23 C N4 . 19039 5 49 . 1 1 29 29 C H41 H 1 8.155 0.005 . 1 . . . A 29 C H41 . 19039 5 50 . 1 1 29 29 C H42 H 1 6.849 0.005 . 1 . . . A 29 C H42 . 19039 5 51 . 1 1 29 29 C N4 N 15 98.375 0.050 . 1 . . . A 29 C N4 . 19039 5 52 . 1 1 30 30 G H1 H 1 12.272 0.005 . 1 . . . A 30 G H1 . 19039 5 53 . 1 1 30 30 G N1 N 15 146.696 0.050 . 1 . . . A 30 G N1 . 19039 5 54 . 1 1 31 31 G H1 H 1 12.385 0.005 . 1 . . . A 31 G H1 . 19039 5 55 . 1 1 31 31 G N1 N 15 146.789 0.050 . 1 . . . A 31 G N1 . 19039 5 56 . 1 1 32 32 A H61 H 1 10.387 0.005 . 1 . . . A 32 A H61 . 19039 5 57 . 1 1 32 32 A H62 H 1 9.206 0.005 . 1 . . . A 32 A H62 . 19039 5 58 . 1 1 32 32 A N6 N 15 95.780 0.050 . 1 . . . A 32 A N6 . 19039 5 59 . 1 1 33 33 U H3 H 1 14.464 0.005 . 1 . . . A 33 U H3 . 19039 5 60 . 1 1 33 33 U N3 N 15 162.879 0.050 . 1 . . . A 33 U N3 . 19039 5 61 . 1 1 34 34 C H41 H 1 8.455 0.005 . 1 . . . A 34 C H41 . 19039 5 62 . 1 1 34 34 C H42 H 1 7.135 0.005 . 1 . . . A 34 C H42 . 19039 5 63 . 1 1 34 34 C N3 N 15 196.526 0.050 . 1 . . . A 34 C N3 . 19039 5 64 . 1 1 34 34 C N4 N 15 99.366 0.050 . 1 . . . A 34 C N4 . 19039 5 65 . 1 1 35 35 U H3 H 1 11.773 0.005 . 1 . . . A 35 U H3 . 19039 5 66 . 1 1 35 35 U N3 N 15 158.144 0.050 . 1 . . . A 35 U N3 . 19039 5 stop_ save_ save_chem_shifts_pH6.7_275K _Assigned_chem_shift_list.Sf_category assigned_chemical_shifts _Assigned_chem_shift_list.Sf_framecode chem_shifts_pH6.7_275K _Assigned_chem_shift_list.Entry_ID 19039 _Assigned_chem_shift_list.ID 6 _Assigned_chem_shift_list.Sample_condition_list_ID 6 _Assigned_chem_shift_list.Sample_condition_list_label $275K_h2o_pH6.7 _Assigned_chem_shift_list.Chem_shift_reference_ID 1 _Assigned_chem_shift_list.Chem_shift_reference_label $DSS _Assigned_chem_shift_list.Chem_shift_1H_err . _Assigned_chem_shift_list.Chem_shift_13C_err . _Assigned_chem_shift_list.Chem_shift_15N_err . _Assigned_chem_shift_list.Chem_shift_31P_err . _Assigned_chem_shift_list.Chem_shift_2H_err . _Assigned_chem_shift_list.Chem_shift_19F_err . _Assigned_chem_shift_list.Error_derivation_method . _Assigned_chem_shift_list.Details . _Assigned_chem_shift_list.Text_data_format . _Assigned_chem_shift_list.Text_data . loop_ _Chem_shift_experiment.Experiment_ID _Chem_shift_experiment.Experiment_name _Chem_shift_experiment.Sample_ID _Chem_shift_experiment.Sample_label _Chem_shift_experiment.Sample_state _Chem_shift_experiment.Entry_ID _Chem_shift_experiment.Assigned_chem_shift_list_ID 12 '2D 1H-1H NOESY' . . . 19039 6 17 '2D 1H-15N HSQC' . . . 19039 6 19 '2D JNN HNN COSY' . . . 19039 6 stop_ loop_ _Atom_chem_shift.ID _Atom_chem_shift.Assembly_atom_ID _Atom_chem_shift.Entity_assembly_ID _Atom_chem_shift.Entity_ID _Atom_chem_shift.Comp_index_ID _Atom_chem_shift.Seq_ID _Atom_chem_shift.Comp_ID _Atom_chem_shift.Atom_ID _Atom_chem_shift.Atom_type _Atom_chem_shift.Atom_isotope_number _Atom_chem_shift.Val _Atom_chem_shift.Val_err _Atom_chem_shift.Assign_fig_of_merit _Atom_chem_shift.Ambiguity_code _Atom_chem_shift.Occupancy _Atom_chem_shift.Resonance_ID _Atom_chem_shift.Auth_entity_assembly_ID _Atom_chem_shift.Auth_asym_ID _Atom_chem_shift.Auth_seq_ID _Atom_chem_shift.Auth_comp_ID _Atom_chem_shift.Auth_atom_ID _Atom_chem_shift.Details _Atom_chem_shift.Entry_ID _Atom_chem_shift.Assigned_chem_shift_list_ID 1 . 1 1 1 1 G H1 H 1 10.864 0.005 . 1 . . . A 1 G H1 . 19039 6 2 . 1 1 2 2 G H1 H 1 12.482 0.005 . 1 . . . A 2 G H1 . 19039 6 3 . 1 1 2 2 G N1 N 15 146.822 0.050 . 1 . . . A 2 G N1 . 19039 6 4 . 1 1 4 4 G H1 H 1 11.099 0.005 . 1 . . . A 4 G H1 . 19039 6 5 . 1 1 5 5 C H41 H 1 8.454 0.005 . 1 . . . A 5 C H41 . 19039 6 6 . 1 1 5 5 C H42 H 1 6.884 0.005 . 1 . . . A 5 C H42 . 19039 6 7 . 1 1 5 5 C N3 N 15 197.887 0.050 . 1 . . . A 5 C N3 . 19039 6 8 . 1 1 6 6 C H41 H 1 8.283 0.005 . 1 . . . A 6 C H41 . 19039 6 9 . 1 1 6 6 C H42 H 1 6.763 0.005 . 1 . . . A 6 C H42 . 19039 6 10 . 1 1 6 6 C N3 N 15 195.951 0.050 . 1 . . . A 6 C N3 . 19039 6 11 . 1 1 7 7 G H1 H 1 12.779 0.005 . 1 . . . A 7 G H1 . 19039 6 12 . 1 1 7 7 G H22 H 1 6.001 0.005 . 1 . . . A 7 G H22 . 19039 6 13 . 1 1 7 7 G N1 N 15 147.180 0.050 . 1 . . . A 7 G N1 . 19039 6 14 . 1 1 8 8 U H3 H 1 13.545 0.005 . 1 . . . A 8 U H3 . 19039 6 15 . 1 1 8 8 U N3 N 15 161.711 0.050 . 1 . . . A 8 U N3 . 19039 6 16 . 1 1 11 11 G H1 H 1 12.544 0.005 . 1 . . . A 11 G H1 . 19039 6 17 . 1 1 11 11 G N1 N 15 147.832 0.050 . 1 . . . A 11 G N1 . 19039 6 18 . 1 1 12 12 C H41 H 1 8.405 0.005 . 1 . . . A 12 C H41 . 19039 6 19 . 1 1 12 12 C H42 H 1 6.697 0.005 . 1 . . . A 12 C H42 . 19039 6 20 . 1 1 12 12 C N3 N 15 196.973 0.050 . 1 . . . A 12 C N3 . 19039 6 21 . 1 1 13 13 G H1 H 1 12.366 0.005 . 1 . . . A 13 G H1 . 19039 6 22 . 1 1 13 13 G H21 H 1 8.013 0.005 . 1 . . . A 13 G H21 . 19039 6 23 . 1 1 13 13 G N1 N 15 146.683 0.050 . 1 . . . A 13 G N1 . 19039 6 24 . 1 1 14 14 G H1 H 1 13.302 0.005 . 1 . . . A 14 G H1 . 19039 6 25 . 1 1 14 14 G H21 H 1 8.715 0.005 . 1 . . . A 14 G H21 . 19039 6 26 . 1 1 14 14 G H22 H 1 5.995 0.005 . 1 . . . A 14 G H22 . 19039 6 27 . 1 1 14 14 G N1 N 15 148.517 0.050 . 1 . . . A 14 G N1 . 19039 6 28 . 1 1 15 15 U H3 H 1 10.635 0.005 . 1 . . . A 15 U H3 . 19039 6 29 . 1 1 15 15 U N3 N 15 157.404 0.050 . 1 . . . A 15 U N3 . 19039 6 30 . 1 1 17 17 G H1 H 1 10.828 0.005 . 1 . . . A 17 G H1 . 19039 6 31 . 1 1 20 20 C H41 H 1 8.423 0.005 . 1 . . . A 20 C H41 . 19039 6 32 . 1 1 20 20 C H42 H 1 7.253 0.005 . 1 . . . A 20 C H42 . 19039 6 33 . 1 1 20 20 C N3 N 15 197.597 0.050 . 1 . . . A 20 C N3 . 19039 6 34 . 1 1 21 21 C H41 H 1 8.459 0.005 . 1 . . . A 21 C H41 . 19039 6 35 . 1 1 21 21 C H42 H 1 6.783 0.005 . 1 . . . A 21 C H42 . 19039 6 36 . 1 1 21 21 C N3 N 15 196.792 0.050 . 1 . . . A 21 C N3 . 19039 6 37 . 1 1 22 22 G H1 H 1 12.873 0.005 . 1 . . . A 22 G H1 . 19039 6 38 . 1 1 22 22 G H21 H 1 8.173 0.005 . 1 . . . A 22 G H21 . 19039 6 39 . 1 1 22 22 G N1 N 15 147.543 0.050 . 1 . . . A 22 G N1 . 19039 6 40 . 1 1 23 23 C H41 H 1 8.190 0.005 . 1 . . . A 23 C H41 . 19039 6 41 . 1 1 23 23 C H42 H 1 6.880 0.005 . 1 . . . A 23 C H42 . 19039 6 42 . 1 1 23 23 C N3 N 15 196.340 0.050 . 1 . . . A 23 C N3 . 19039 6 43 . 1 1 28 28 A H61 H 1 7.848 0.005 . 1 . . . A 28 A H61 . 19039 6 44 . 1 1 28 28 A H62 H 1 6.435 0.005 . 1 . . . A 28 A H62 . 19039 6 45 . 1 1 28 28 A N1 N 15 222.176 0.050 . 1 . . . A 28 A N1 . 19039 6 46 . 1 1 29 29 C H41 H 1 8.133 0.005 . 1 . . . A 29 C H41 . 19039 6 47 . 1 1 29 29 C H42 H 1 6.757 0.005 . 1 . . . A 29 C H42 . 19039 6 48 . 1 1 29 29 C N3 N 15 196.840 0.050 . 1 . . . A 29 C N3 . 19039 6 49 . 1 1 30 30 G H1 H 1 12.481 0.005 . 1 . . . A 30 G H1 . 19039 6 50 . 1 1 30 30 G N1 N 15 146.720 0.050 . 1 . . . A 30 G N1 . 19039 6 51 . 1 1 31 31 G H1 H 1 12.649 0.005 . 1 . . . A 31 G H1 . 19039 6 52 . 1 1 31 31 G N1 N 15 147.810 0.050 . 1 . . . A 31 G N1 . 19039 6 53 . 1 1 34 34 C H41 H 1 8.371 0.005 . 1 . . . A 34 C H41 . 19039 6 54 . 1 1 34 34 C H42 H 1 7.061 0.005 . 1 . . . A 34 C H42 . 19039 6 55 . 1 1 34 34 C N3 N 15 195.959 0.050 . 1 . . . A 34 C N3 . 19039 6 56 . 1 1 35 35 U H3 H 1 11.945 0.005 . 1 . . . A 35 U H3 . 19039 6 stop_ save_