3,"3","1995-01-01",\N,"Secondary Structure of Acyl Carrier Protein as Derived from Two-Dimensional 1H NMR Spectroscopy",\N
4,"4","1995-01-01",\N,"High-Resolution 1H NMR Study of the Solution Structure of Alamethicin",\N
5,"5","1995-01-01",\N,"Specific assignment of resonances in the 1H nuclear magnetic resonance spectrum of the polypeptide cardiac stimulant anthopleurin-A",\N
6,"6","1995-01-01",\N,"Structure of Apamin in Solution: A Two-Dimensional Nuclear Magnetic Resonance Study",\N
7,"7","1995-01-01",\N,"The conformation of bombesin in solution as determined by two-dimensional 1H-NMR techniques",\N
8,"8","1995-01-01",\N,"Structural Studies of alpha-Bungarotoxin. 1. Sequence-Specific 1H NMR Resonance Assignments",\N
9,"9","1995-01-01",\N,"Three-Dimensional Structure of Potato Carboxypeptidase Inhibitor in Solution. A Study Using Nuclear Magnetic Resonance, Distance Geometry, and Restrained Molecular Dynamics",\N
18,"18","1995-01-01",\N,"Stereospecific assignments of side-chain protons and characterization of torsion angles in Eglin c",\N
19,"19","1995-01-01",\N,"Secondary Structure Determination of Human Beta-Endorphin by 1H NMR Spectroscopy",\N
21,"21","1995-01-01",\N,"Structural and dynamical comparison of alpha, beta, and gamma forms of murine epidermal growth factor",\N
23,"23","1995-01-01",\N,"Sequential Resonance Assignments in Protein 1H Nuclear Magnetic Resonance Spectra (Glucagon Bound to Perdeuterated Dodecylphosphocholine Micelles)",\N
24,"24","1995-01-01",\N,"Solution Structure of Human Growth Hormone Releasing Factor (Combined Use of Circular Dichroism and Nuclear Magnetic Resonance Spectroscopy)",\N
25,"25","1995-01-01",\N,"Assignment of Resonances in the 1H Nuclear Magnetic Resonance Spectrum of the Carbon Monoxide Complex of Human Hemoglobin alpha-Chains",\N
26,"26","1995-01-01",\N,"1H-NMR assignment and secondary structure of a Herpes simplex virus glycoprotein D-1 antigenic domain",\N
27,"27","1995-01-01",\N,"Proton Nuclear Magnetic Resonance Study of Hirudin: Resonance Assignment and Secondary Structure",\N
29,"29","1995-01-01",\N,"Two-Dimensional 1H NMR studies of Histidine-Containing Protein from Escherichia coli. 1. Sequential Resonance Assignments",\N
30,"30","1995-01-01",\N,"Nuclear magnetic resonance study of the globular domain of chicken histone H5: Resonance assignment and secondary structure",\N
32,"32","1995-01-01",\N,"Sequence-specific resonance assignments in the 1H nuclear-magnetic-resonance spectrum of the Lac repressor DNA-binding domain 1-51 from Escherichia coli by two-dimensional spectroscopy",\N
36,"36","1995-01-01",\N,"High Resolution Nuclear Magnetic Resonance Studies of the Conformation and Orientation of Melittin Bound to a Lipid-Water Interface",\N
39,"39","1995-01-01",\N,"Sequence-specific 1H-NMR assignments in rat-liver metallothionein-2",\N
40,"40","1995-01-01",\N,"Assignment of Resonances in the 1H Nuclear Magnetic Resonance Spectrum of the Carbon Monoxide Complex of the Sperm Whale Myoglobin by Phase-sensitive Two-dimensional Techniques",\N
41,"41","1995-01-01",\N,"Two-Dimensional NMR Studies of the Antimicrobial Peptide NP-5",\N
42,"42","1995-01-01",\N,"Two-Dimensional NMR Studies of Kazal Proteinase Inhibitors. 1. Sequence-Specific Assignments and Secondary Structure of Turkey Ovomucoid Third Domain",\N
44,"44","1995-01-01",\N,"Two-Dimensional NMR Studies of Kazal Proteinase Inhibitors. 2. Sequence-Specific Assignments and Secondary Structure of Reactive Site Modified Turkey Ovomucoid Third Domain",\N
45,"45","1995-01-01",\N,"Sequential Resonance Assignments in Protein 1H Nuclear Magnetic Resonance Spectra (Basic Pancreatic Trypsin Inhibitor)",\N
46,"46","1995-01-01",\N,"Toward the Complete Assignment of the Carbon Nuclear Magnetic Resonance Spectrum of the Basic Pancreatic Trypsin Inhibitor",\N
48,"48","1995-01-01",\N,"Protein Structures in Solution by Nuclear Magnetic Resonance and Distance Geometry (The Polypeptide Fold of the Basic Pancreatic Trypsin Inhibitor Determined using Two Different Algorithms, DISGEO and DISMAN)",\N
49,"49","1995-01-01",\N,"Comparative studies of conformation and internal mobility in native and circular basic pancreatic trypsin inhibitor by 1H nuclear magnetic resonance in solution",\N
50,"50","1995-01-01",\N,"Proton magnetic resonance characterization of phoratoxins and homologous proteins related to crambin",\N
53,"53","1995-01-01",\N,"Assignment of the 1H Nuclear Magnetic Resonance Spectrum of the Proteinase Inhibitor IIA from Bull Seminal Plasma by Two-dimensional Nuclear Magnetic Resonance at 500 MHz",\N
55,"55","1995-01-01",\N,"Nuclear Magnetic Resonance Study of the Solution Structure of alpha 1-Purothionin (Sequential Resonance Assignment, Secondary Structure and Low Resolution Tertiary Structure)",\N
58,"58","1995-01-01",\N,"Residue-specific Assignments of Resonances in the 1H Nuclear Magnetic Resonance Spectrum of Ribosomal Protein E-L30 by Systematic Application of Two-dimensional Fourier Transform Nuclear Magnetic Resonance Methods",\N
60,"60","1995-01-01",\N,"Complete Sequence-specific 1H Nuclear Magnetic Resonance Assignments for the alpha-Amylase Polypeptide Inhibitor Tendamistat from Streptomyces tendae",\N
62,"62","1995-01-01",\N,"NMR Sequential Assignment of Escherichia coli Thioredoxin Utilizing Random Fractional Deuteriation",\N
63,"63","1995-01-01",\N,"NMR Analysis and Sequence of Toxin II from the Sea Anemone Radianthus paumotensis",\N
64,"64","1995-01-01",\N,"Conformational Studies by 1H Nuclear Magnetic Resonance of the Trypsin-Chymotrypsin Inhibitor B-III from Peanuts and Its Enzymatically Modified Derivative",\N
65,"65","1995-01-01",\N,"Assignment of the 1H Nuclear Magnetic Resonance Spectrum of the Trypsin Inhibitor E from Dendroaspis polylepis polylepis Two-dimensional Nuclear Magnetic Resonance at 500MHz",\N
66,"66","1995-01-01",\N,"Assignment of the 1H Nuclear Magnetic Resonance Spectrum of the Trypsin Inhibitor Homologue K from Dendroaspis polylepis polylepis. Two-dimensional Nuclear Magnetic Resonance at 360 and 500 MHz.",\N
68,"68","1995-01-01",\N,"Sequential 1H NMR Assignments and Secondary Structure Identification of Human Ubiquitin",\N
76,"76","1995-01-01",\N,"Assignment of resonances in the 1H NMR spectrum of human lysozyme",\N
77,"77","1995-01-01",\N,"NMR solution conformation of gramicidin A double helix",\N
79,"79","1995-01-01",\N,"1H-NMR sequential assignments and cation-binding studies of spinach plastocyanin",\N
80,"80","1995-01-01",\N,"The Secondary Structure of the Toxin ATX Ia from Anemonia sulcata in Aqueous Solution Determined on the Basis of Complete Sequence-specific 1H NMR Assignments",\N
81,"81","1995-01-01",\N,"NMR of a Peptic Peptide Spanning the Triprolyl Sequence in Myelin Basic Protein",\N
86,"86","1995-01-01",\N,"High-Resolution 1H NMR Study of the Solution Structure of Alamethicin",\N
87,"87","1995-01-01",\N,"The conformation of bombesin in solution as determined by two-dimensional 1H-NMR techniques",\N
88,"88","1995-01-01",\N,"Sequence-specific 1H-NMR assignments and determination of the secondary structure in aqueous solution of the cardiotoxins CTXIIa and CTXIIb from Naja mossambica mossambica",\N
90,"90","1995-01-01",\N,"Analysis of the Methyl 1H-NMR Spectrum of Crambin, a Hydrophobic Protein",\N
94,"94","1995-01-01",\N,"Structural and dynamical comparison of alpha, beta, and gamma forms of murine epidermal growth factor",\N
95,"95","1995-01-01",\N,"Structural and dynamical comparison of alpha, beta, and gamma forms of murine epidermal growth factor",\N
96,"96","1995-01-01",\N,"Sequence-specific resonance assignments in the 1H nuclear-magnetic-resonance spectrum of the Lac repressor DNA-binding domain 1-51 from Escherichia coli by two-dimensional spectroscopy",\N
97,"97","1995-01-01",\N,"Sequence-specific 1H-NMR assignments in rat-liver metallothionein-2",\N
102,"102","1995-01-01",\N,"Conformational Studies by 1H Nuclear Magnetic Resonance of the Trypsin-Chymotrypsin Inhibitor B-III from Peanuts and Its Enzymatically Modified Derivative",\N
103,"103","1995-01-01",\N,"Conformational Studies by 1H Nuclear Magnetic Resonance of the Trypsin-Chymotrypsin Inhibitor B-III from Peanuts and Its Enzymatically Modified Derivative",\N
104,"104","1995-01-01",\N,"Conformational Studies by 1H Nuclear Magnetic Resonance of the Trypsin-Chymotrypsin Inhibitor B-III from Peanuts and Its Enzymatically Modified Derivative",\N
105,"105","1995-01-01",\N,"Conformational Studies by 1H Nuclear Magnetic Resonance of the Trypsin-Chymotrypsin Inhibitor B-III from Peanuts and Its Enzymatically Modified Derivative",\N
106,"106","1995-01-01",\N,"Conformational Studies by 1H Nuclear Magnetic Resonance of the Trypsin-Chymotrypsin Inhibitor B-III from Peanuts and Its Enzymatically Modified Derivative",\N
107,"107","1995-01-01",\N,"Conformational Studies by 1H Nuclear Magnetic Resonance of the Trypsin-Chymotrypsin Inhibitor B-III from Peanuts and Its Enzymatically Modified Derivative",\N
108,"108","1995-01-01",\N,"Conformational Studies by 1H Nuclear Magnetic Resonance of the Trypsin-Chymotrypsin Inhibitor B-III from Peanuts and Its Enzymatically Modified Derivative",\N
109,"109","1995-01-01",\N,"Conformational Studies by 1H Nuclear Magnetic Resonance of the Trypsin-Chymotrypsin Inhibitor B-III from Peanuts and Its Enzymatically Modified Derivative",\N
112,"112","1995-01-01",\N,"Conformational Studies by 1H Nuclear Magnetic Resonance of the Trypsin-Chymotrypsin Inhibitor B-III from Peanuts and Its Enzymatically Modified Derivative",\N
114,"114","1995-01-01",\N,"Three-dimensional structure of natural charybdotoxin in aqueous solution by 1H-NMR Charybdotoxin possesses a structural motif found in other scorpion toxins",\N
115,"115","1995-01-01",\N,"Assignment of the 1H Nuclear Magnetic Resonance Spectrum of the Trypsin Inhibitor E from Dendroaspis polylepis polylepis Two-dimensional Nuclear Magnetic Resonance at 500MHz",\N
116,"116","1995-01-01",\N,"Assignment of the 1H Nuclear Magnetic Resonance Spectrum of the Trypsin Inhibitor E from Dendroaspis polylepis polylepis Two-dimensional Nuclear Magnetic Resonance at 500MHz",\N
117,"117","1995-01-01",\N,"Assignment of the 1H Nuclear Magnetic Resonance Spectrum of the Trypsin Inhibitor Homologue K from Dendroaspis polylepis polylepis. Two-dimensional Nuclear Magnetic Resonance at 360 and 500 MHz.",\N
119,"119","1995-01-01",\N,"The conformation of gramicidin A in dimethylsulphoxide solution A full analysis of the one- and two-dimensional 1H, 13C, and 15N nuclear-magnetic-resonance spectra",\N
120,"120","1995-01-01",\N,"1H-NMR sequential assignments and cation-binding studies of spinach plastocyanin",\N
121,"121","1995-01-01",\N,"1H-NMR sequential assignments and cation-binding studies of spinach plastocyanin",\N
122,"122","1995-01-01",\N,"1H-NMR sequential assignments and cation-binding studies of spinach plastocyanin",\N
123,"123","1995-01-01",\N,"The Secondary Structure of the Toxin ATX Ia from Anemonia sulcata in Aqueous Solution Determined on the Basis of Complete Sequence-specific 1H NMR Assignments",\N
126,"126","1995-01-01",\N,"Some structural features of the iron-uptake regulation protein",\N
127,"127","1995-01-01",\N,"Sequence-specific resonance assignments in the 1H nuclear-magnetic-resonance spectrum of the Lac repressor DNA-binding domain 1-51 from Escherichia coli by two-dimensional spectroscopy",\N
131,"131","1995-01-01",\N,"Proton-NMR studies show that the Thr-102 mutant of yeast iso-1-cytochrome is a typical member of the eukaryotic cytochrome c family",\N
132,"132","1995-01-01",\N,"Secondary structure determination for alpha-neurotoxin from Dendroaspis polylepis polylepis based on sequence-specific 1H-nuclear-magnetic-resonance assignments",\N
133,"133","1995-01-01",\N,"Two-dimensional 1H-NMR investigation of ribonuclease T1 (Resonance assignments, secondary and low-resolution tertiary structures of ribonuclease T1)",\N
136,"136","1995-01-01",\N,"NMR Signal Assignments of Amide Protons in the alpha-Helical Domains of Staphylococcal Nuclease",\N
139,"139","1995-01-01",\N,"Structure of the Toxic Domain of the Escherichia coli Heat-Stable Enterotoxin ST I",\N
140,"140","1995-01-01",\N,"A 1H-NMR study of the solution conformation of secretin Resonance assignment and secondary structure",\N
141,"141","1995-01-01",\N,"The Solution Conformation of the Antibacterial Peptide Cecropin A: A Nuclear Magnetic Resonance and Dynamical Simulated Annealing Study",\N
142,"142","1995-01-01",\N,"NMR Study of the Solution Conformation of Rat Atrial Natriuretic Factor 7-23 in Sodium Dodecyl Sulfate Micelles",\N
144,"144","1995-01-01",\N,"Two-dimensional 1H Nuclear Magnetic Resonance Study of Pike pI 5.0 Parvalbumin (Esox lucius) Sequential Resonance Assignments and Folding of the Polypeptide Chain",\N
146,"146","1995-01-01",\N,"Assignment of the 1H Nuclear Magnetic Resonance Spectrum of the Proteinase Inhibitor IIA from Bull Seminal Plasma by Two-dimensional Nuclear Magnetic Resonance at 500 MHz",\N
148,"148","1995-01-01",\N,"Specific assignment of resonances in the 1H nuclear magnetic resonance spectrum of the polypeptide cardiac stimulant anthopleurin-A",\N
149,"149","1995-01-01",\N,"Specific assignment of resonances in the 1H nuclear magnetic resonance spectrum of the polypeptide cardiac stimulant anthopleurin-A",\N
150,"150","1995-01-01",\N,"Specific assignment of resonances in the 1H nuclear magnetic resonance spectrum of the polypeptide cardiac stimulant anthopleurin-A",\N
151,"151","1995-01-01",\N,"Specific assignment of resonances in the 1H nuclear magnetic resonance spectrum of the polypeptide cardiac stimulant anthopleurin-A",\N
161,"161","1995-01-01",\N,"NMR studies of the conformations of leghemoglobins from soybean and lupin",\N
162,"162","1995-01-01",\N,"1H NMR Assignment and Secondary Structural Elements of Human Transforming Growth Factor alpha",\N
169,"169","1995-01-01",\N,"Proton NMR Studies of Plastocyanin: Assignment of Aromatic and Methyl Group Resonances from Two-Dimensional Spectra",\N
171,"171","1995-01-01",\N,"The assignment of the 1H nuclear magnetic resonance spectrum of azurin (An investigation of the 1H NMR spectrum of the blue copper protein, azurin, from Pseudomonas aeruginosa, with reference to the previously determined crystal structure)",\N
180,"180","1995-01-01",\N,"NMR studies of the conformations of leghemoglobins from soybean and lupin",\N
181,"181","1995-01-01",\N,"NMR studies of the conformations of leghemoglobins from soybean and lupin",\N
182,"182","1995-01-01",\N,"NMR studies of the conformations of leghemoglobins from soybean and lupin",\N
183,"183","1995-01-01",\N,"1H NMR Assignment and Secondary Structural Elements of Human Transforming Growth Factor alpha",\N
185,"185","1995-01-01",\N,"Proton NMR Studies of Plastocyanin: Assignment of Aromatic and Methyl Group Resonances from Two-Dimensional Spectra",\N
186,"186","1995-01-01",\N,"Proton NMR Studies of Plastocyanin: Assignment of Aromatic and Methyl Group Resonances from Two-Dimensional Spectra",\N
187,"187","1995-01-01",\N,"Proton NMR Studies of Plastocyanin: Assignment of Aromatic and Methyl Group Resonances from Two-Dimensional Spectra",\N
188,"188","1995-01-01",\N,"NMR Signal Assignments of Amide Protons in the alpha-Helical Domains of Staphylococcal Nuclease",\N
189,"189","1995-01-01",\N,"NMR Signal Assignments of Amide Protons in the alpha-Helical Domains of Staphylococcal Nuclease",\N
190,"190","1995-01-01",\N,"Proton-NMR studies show that the Thr-102 mutant of yeast iso-1-cytochrome is a typical member of the eukaryotic cytochrome c family",\N
191,"191","1995-01-01",\N,"One- and two-dimensional NMR studies of yeast phosphoglycerate kinase",\N
192,"192","1995-01-01",\N,"Determination of the Three-Dimensional Solution Structure of the C-Terminal Domain of CellobiohydrolOCe I from Trichodermi reesi. A Study using NMR and Hybrid distance Geometry-Dynamical Simulated Annealing.",\N
193,"193","1995-01-01",\N,"Solution conformation of endothelin determined by nuclear magnetic resonance and distance geometry.",\N
194,"194","1995-01-01",\N,"1H-NMR study of endothelin, sequence-specific assignment of the spectrum and a solution structure",\N
195,"195","1995-01-01",\N,"Stereospecific Nuclear Magnetic Resonance Assignments of the Methyl Groups of Valine and Leucine in the DNA-Binding Domain of the 434 Repressor by Biosynthetically Directed Fractional 13C Labeling",\N
196,"196","1995-01-01",\N,"Determination of the Three-Dimensional Solution Structure of the C-Terminal Domain of CellobiohydrolOCe I from Trichodermi reesi. A Study using NMR and Hybrid distance Geometry-Dynamical Simulated Annealing.",\N
199,"199","1995-01-01",\N,"Determination of the Complete Three-dimensional Structure of the Trypsin Inhibitor from Squash Seeds in Aqueous Solution by Nuclear Magnetic Resonance and a Combination of Distance Geometry and Dynamical Simulated Annealing",\N
200,"200","1995-01-01",\N,"Proton NMR and CD solution conformation determination and opioid receptor binding studies of a dynorphin A(1-17) model peptide",\N
216,"216","1995-01-01",\N,"1H NMR Studies of Eukaryotic Cytochrome c Resonance Assignments and Iron-Hexacyanide-Mediated Electron Exchange",\N
217,"217","1995-01-01",\N,"1H NMR Studies of Eukaryotic Cytochrome c Resonance Assignments and Iron-Hexacyanide-Mediated Electron Exchange",\N
218,"218","1995-01-01",\N,"1H NMR Studies of Eukaryotic Cytochrome c Resonance Assignments and Iron-Hexacyanide-Mediated Electron Exchange",\N
219,"219","1995-01-01",\N,"1H NMR Studies of Eukaryotic Cytochrome c Resonance Assignments and Iron-Hexacyanide-Mediated Electron Exchange",\N
220,"220","1995-01-01",\N,"1H NMR Studies of Eukaryotic Cytochrome c Resonance Assignments and Iron-Hexacyanide-Mediated Electron Exchange",\N
221,"221","1995-01-01",\N,"1H NMR Studies of Eukaryotic Cytochrome c Resonance Assignments and Iron-Hexacyanide-Mediated Electron Exchange",\N
222,"222","1995-01-01",\N,"1H NMR Studies of Eukaryotic Cytochrome c Resonance Assignments and Iron-Hexacyanide-Mediated Electron Exchange",\N
223,"223","1995-01-01",\N,"1H NMR Studies of Eukaryotic Cytochrome c Resonance Assignments and Iron-Hexacyanide-Mediated Electron Exchange",\N
224,"224","1995-01-01",\N,"1H NMR Studies of Eukaryotic Cytochrome c Resonance Assignments and Iron-Hexacyanide-Mediated Electron Exchange",\N
225,"225","1995-01-01",\N,"1H NMR Studies of Eukaryotic Cytochrome c Resonance Assignments and Iron-Hexacyanide-Mediated Electron Exchange",\N
226,"226","1995-01-01",\N,"1H NMR Studies of Eukaryotic Cytochrome c Resonance Assignments and Iron-Hexacyanide-Mediated Electron Exchange",\N
227,"227","1995-01-01",\N,"Determination of the Coordination Geometry at the Heme Iron in Three Cytochromes c from Saccharomyces cerevisiae and from Candida krusei Based on Individual 1H-NMR Assignments for Heme c and the Axially Coordinated Amino Acids",\N
228,"228","1995-01-01",\N,"Determination of the Coordination Geometry at the Heme Iron in Three Cytochromes c from Saccharomyces cerevisiae and from Candida krusei Based on Individual 1H-NMR Assignments for Heme c and the Axially Coordinated Amino Acids",\N
229,"229","1995-01-01",\N,"Determination of the Coordination Geometry at the Heme Iron in Three Cytochromes c from Saccharomyces cerevisiae and from Candida krusei Based on Individual 1H-NMR Assignments for Heme c and the Axially Coordinated Amino Acids",\N
233,"233","1995-01-01",\N,"Determination of the Coordination Geometry at the Heme Iron in Three Cytochromes c from Saccharomyces cerevisiae and from Candida krusei Based on Individual 1H-NMR Assignments for Heme c and the Axially Coordinated Amino Acids",\N
234,"234","1995-01-01",\N,"Determination of the Coordination Geometry at the Heme Iron in Three Cytochromes c from Saccharomyces cerevisiae and from Candida krusei Based on Individual 1H-NMR Assignments for Heme c and the Axially Coordinated Amino Acids",\N
235,"235","1995-01-01",\N,"Determination of the Coordination Geometry at the Heme Iron in Three Cytochromes c from Saccharomyces cerevisiae and from Candida krusei Based on Individual 1H-NMR Assignments for Heme c and the Axially Coordinated Amino Acids",\N
236,"236","1995-01-01",\N,"Individual Assignments of Amide Protein Resonances in the Proton NMR Spectrum of the Basic Pancreatic Trypsin Inhibitor",\N
237,"237","1995-01-01",\N,"Systematic Application of Two-Dimensional 1H Nuclear-Magnetic-Resonance Techniques for Studies of Proteins 1. Combined Use of Spin-Echo-Correlated Spectroscopy and J-Resolved Spectroscopy for the Identification of Complete Spin Systems of",\N
238,"238","1995-01-01",\N,"Assignment of Aromatic Resonances in the H1 Nuclear Magnetic Resonance Spectra of Cardioactive Polypeptides from Sea Anemones",\N
239,"239","1995-01-01",\N,"Assignment of Aromatic Resonances in the H1 Nuclear Magnetic Resonance Spectra of Cardioactive Polypeptides from Sea Anemones",\N
240,"240","1995-01-01",\N,"Assignment of Aromatic Resonances in the H1 Nuclear Magnetic Resonance Spectra of Cardioactive Polypeptides from Sea Anemones",\N
241,"241","1995-01-01",\N,"Assignment of Aromatic Resonances in the H1 Nuclear Magnetic Resonance Spectra of Cardioactive Polypeptides from Sea Anemones",\N
242,"242","1995-01-01",\N,"Assignment of Aromatic Resonances in the H1 Nuclear Magnetic Resonance Spectra of Cardioactive Polypeptides from Sea Anemones",\N
243,"243","1995-01-01",\N,"Two-Dimensional 1H NMR Studies of Cytochrome c: Assignment of the N-Terminal Helix",\N
244,"244","1995-01-01",\N,"Two-Dimensional 1H NMR Studies of Cytochrome c: Assignment of the N-Terminal Helix",\N
245,"245","1995-01-01",\N,"Structure of Melittin Bound to Perdeuterated Dodecylphosphocholine Micelles As Studied by Two-Dimensional NMR and Distance Geometry Calculations",\N
246,"246","1995-01-01",\N,"Polypeptide Chain Fold of Human Transforming Growth Factor alpha Analogous to Those of Mouse and Human Epidermal Growth Factors as Studied by Two-Dimensional 1H NMR",\N
247,"247","1995-01-01",\N,"1H NMR Sequential Resonance Assignments, Secondary Structure, and Global Fold in Solution of the Major (trans-Pro43) Form of Bovine Calbindin D9k",\N
248,"248","1995-01-01",\N,"Proton NMR Studies of a Metallothionein from Neurospora crassa: Sequence-Specific Assignments by NOE Measurements in the Rotating Frame",\N
249,"249","1995-01-01",\N,"Sequential 1H Assignment and Secondary Structure Determination of Salmon Calcitonin in Solution",\N
250,"250","1995-01-01",\N,"Solution Structures of alpha-Conotoxin G1 Determined by Two-Dimensional NMR Spectroscopy",\N
252,"252","1995-01-01",\N,"High-Resolution Structure of an HIV Zinc Fingerlike Domain via a New NMR-Based Distance Geometry Approach",\N
253,"253","1995-01-01",\N,"A Proton Nuclear Magnetic Resonance Assignment and Secondary Structure Determination of Recombinant Human Thioredoxin",\N
254,"254","1995-01-01",\N,"A Proton Nuclear Magnetic Resonance Assignment and Secondary Structure Determination of Recombinant Human Thioredoxin",\N
255,"255","1995-01-01",\N,"A Proton Nuclear Magnetic Resonance Assignment and Secondary Structure Determination of Recombinant Human Thioredoxin",\N
256,"256","1995-01-01",\N,"A Proton Nuclear Magnetic Resonance Assignment and Secondary Structure Determination of Recombinant Human Thioredoxin",\N
257,"257","1995-01-01",\N,"A Proton Nuclear Magnetic Resonance Assignment and Secondary Structure Determination of Recombinant Human Thioredoxin",\N
258,"258","1995-01-01",\N,"Nuclear Magnetic Resonance Study on Rabbit Skeletal Troponin C: Calcium-Induced Conformational Change",\N
259,"259","1995-01-01",\N,"Nuclear Magnetic Resonance Study on Rabbit Skeletal Troponin C: Calcium-Induced Conformational Change",\N
260,"260","1995-01-01",\N,"Complete Assignment of the 1H Nuclear Magnetic Resonance Spectrum of French Bean Plastocyanin: Sequential Resonance Assignments, Secondary Structure and Global Fold",\N
261,"261","1995-01-01",\N,"Complete Assignment of the 1H Nuclear Magnetic Resonance Spectrum of French Bean Plastocyanin: Sequential Resonance Assignments, Secondary Structure and Global Fold",\N
262,"262","1995-01-01",\N,"Carbonyl 13C NMR Spectrum of Basic Pancreatic Trypsin Inhibitor: Resonance Assignments by Selective Amide Hydrogen Isotope Labeling and Detection of Isotope Effects on 13C Nuclear Shielding",\N
263,"263","1995-01-01",\N,"Carbonyl 13C NMR Spectrum of Basic Pancreatic Trypsin Inhibitor: Resonance Assignments by Selective Amide Hydrogen Isotope Labeling and Detection of Isotope Effects on 13C Nuclear Shielding",\N
264,"264","1995-01-01",\N,"Carbonyl 13C NMR Spectrum of Basic Pancreatic Trypsin Inhibitor: Resonance Assignments by Selective Amide Hydrogen Isotope Labeling and Detection of Isotope Effects on 13C Nuclear Shielding",\N
274,"274","1995-01-01",\N,"Proton Resonance Assignments of Horse Ferricytochrome c",\N
275,"275","1995-01-01",\N,"Sequence-Specific 1H NMR Assignments and Secondary Structure in the Sea Anemone Stichodactyla helianthus Neurotoxin I",\N
276,"276","1995-01-01",\N,"1H NMR Study of the Solution Properties of the Polypeptide Neurotoxin I from the Sea Anemone Stichodactyla helianthus",\N
280,"280","1995-01-01",\N,"Determination of the Secondary Structure of Interleukin-8 by Nuclear Magnetic Resonance Spectroscopy",\N
283,"283","1995-01-01",\N,"Studies on the Solution Structure of Human Thioredoxin Using Heteronuclear 15N-1H Nuclear Magnetic Resonance Spectroscopy",\N
284,"284","1995-01-01",\N,"Studies on the Solution Structure of Human Thioredoxin Using Heteronuclear 15N-1H Nuclear Magnetic Resonance Spectroscopy",\N
285,"285","1995-01-01",\N,"Assignment of paramagnetically shifted resonances in the 1H NMR spectrum of horse ferricytochrome c",\N
286,"286","1995-01-01",\N,"Assignment of paramagnetically shifted resonances in the 1H NMR spectrum of horse ferricytochrome c",\N
287,"287","1995-01-01",\N,"Determination of The Secondary Structure of the DNA Binding Protein Ner from Phage Mu Using 1H Homonuclear and 15N-1H Heteronuclear NMR Spectroscopy",\N
288,"288","1995-01-01",\N,"Determination of The Secondary Structure of the DNA Binding Protein Ner from Phage Mu Using 1H Homonuclear and 15N-1H Heteronuclear NMR Spectroscopy",\N
289,"289","1995-01-01",\N,"Sequence-Specific 1H NMR Assignments and Secondary Structure of Eglin c",\N
290,"290","1995-01-01",\N,"A 1H NMR Determination of the Solution Conformation of a Synthetic Peptide Analogue of Calcium-Binding Site III of Rabbit Skeletal Troponin C",\N
291,"291","1995-01-01",\N,"Solution Structural Characterization of Cyanometmyoglobin: Resonance Assignment of Heme Cavity Residues by Two-Dimensional NMR",\N
292,"292","1995-01-01",\N,"Solution Structural Characterization of Cyanometmyoglobin: Resonance Assignment of Heme Cavity Residues by Two-Dimensional NMR",\N
293,"293","1995-01-01",\N,"Solution Structural Characterization of Cyanometmyoglobin: Resonance Assignment of Heme Cavity Residues by Two-Dimensional NMR",\N
294,"294","1995-01-01",\N,"Structural Studies of Cytochrome b5: Complete Sequence-Specific Resonance Assignments for the Trypsin-Solubilized Microsomal Ferrocytochrome b5 Obtained from Pig and Calf",\N
295,"295","1995-01-01",\N,"Structural Studies of Cytochrome b5: Complete Sequence-Specific Resonance Assignments for the Trypsin-Solubilized Microsomal Ferrocytochrome b5 Obtained from Pig and Calf",\N
298,"298","1995-01-01",\N,"Structure-function relationships in the polypeptide cardiac stimulant, anthopleurin-A (Effects of limited proteolysis by trypsin)",\N
300,"300","1995-01-01",\N,"NMR Studies of Toxin III from the Sea Anemone Radianthus paumotensis and Comparison of Its Secondary Structure with related Toxins",\N
301,"301","1995-01-01",\N,"Conformation of secretin in dimethyl sulfoxide solution",\N
302,"302","1995-01-01",\N,"1H NMR Studies of the Solution Conformation of an Analogue of the C-Peptide of Ribonuclease A",\N
306,"306","1995-01-01",\N,"N-Terminal Half of a Mitochondrial Presequence Peptide Takes a Helical Conformation When Bound to Dodecylphosphocholine Micelles: A Proton Nuclear Magnetic Resonance Study",\N
307,"307","1995-01-01",\N,"N-Terminal Half of a Mitochondrial Presequence Peptide Takes a Helical Conformation When Bound to Dodecylphosphocholine Micelles: A Proton Nuclear Magnetic Resonance Study",\N
308,"308","1995-01-01",\N,"Structural Properties of Apocytochrome b5: Presence of a Stable Native Core",\N
309,"309","1995-01-01",\N,"Structural Properties of Apocytochrome b5: Presence of a Stable Native Core",\N
311,"311","1995-01-01",\N,"Structural Properties of Apocytochrome b5: Presence of a Stable Native Core",\N
314,"314","1995-01-01",\N,"1H-n.m.r. studies of squash seed trypsin inhibitor",\N
316,"316","1995-01-01",\N,"Proton NMR studies of horse ferricytochrome c Completion of the assignment of the well resolved hyperfine shifted resonances",\N
317,"317","1995-01-01",\N,"Proton NMR studies of horse ferricytochrome c Completion of the assignment of the well resolved hyperfine shifted resonances",\N
321,"321","1995-01-01",\N,"NMR study of a 34-residue N-terminal fragment of the parathyroid-hormone-related protein secreted during humoral hypercalcemia of malignancy",\N
325,"325","1995-01-01",\N,"The Rate and Structural Consequences of Proline Cis-Trans Isomerization in Calbindin D9k: NMR Studies of the Minor (cis-pro43) Isoform and the Pro43Gly Mutant",\N
326,"326","1995-01-01",\N,"The Rate and Structural Consequences of Proline Cis-Trans Isomerization in Calbindin D9k: NMR Studies of the Minor (cis-pro43) Isoform and the Pro43Gly Mutant",\N
327,"327","1995-01-01",\N,"1H NMR Resonance Assignments, Secondary Structure, and Global Fold of Apo Bovine Calbindin D9k",\N
329,"329","1995-01-01",\N,"Identification and Description of beta-Structure in Horse Muscle Acylphosphatase by Nuclear Magnetic Resonance Spectroscopy",\N
330,"330","1995-01-01",\N,"Proton NMR Comparison of the Saccharomyces cerevisiae Ferricytochrome c Isozyme-1 Monomer and Covalent Disulfide Dimer",\N
331,"331","1995-01-01",\N,"Proton NMR Comparison of the Saccharomyces cerevisiae Ferricytochrome c Isozyme-1 Monomer and Covalent Disulfide Dimer",\N
332,"332","1995-01-01",\N,"Proton NMR Comparison of the Saccharomyces cerevisiae Ferricytochrome c Isozyme-1 Monomer and Covalent Disulfide Dimer",\N
335,"335","1995-01-01",\N,"Conformation of a Heptadecapeptide Comprising the Segment Encephalitogenic in Rhesus Monkeys",\N
336,"336","1995-01-01",\N,"1H-NMR studies of structural homologies between the heme environments in horse cytochrome c and in cytochrome c-552 from Euglena gracilis",\N
337,"337","1995-01-01",\N,"1H-NMR studies of structural homologies between the heme environments in horse cytochrome c and in cytochrome c-552 from Euglena gracilis",\N
338,"338","1995-01-01",\N,"15N Chemical Shifts of Backbone Amides in Bovine Pancreatic Trypsin Inhibitor",\N
339,"339","1995-01-01",\N,"15N Chemical Shifts of Backbone Amides in Bovine Pancreatic Trypsin Inhibitor",\N
340,"340","1995-01-01",\N,"15N Chemical Shifts of Backbone Amides in Bovine Pancreatic Trypsin Inhibitor",\N
341,"341","1995-01-01",\N,"15N Chemical Shifts of Backbone Amides in Bovine Pancreatic Trypsin Inhibitor",\N
342,"342","1995-01-01",\N,"15N Chemical Shifts of Backbone Amides in Bovine Pancreatic Trypsin Inhibitor",\N
345,"345","1995-01-01",\N,"Comparison of Reduced and Oxidized Yeast Iso-1-cytochrome c Using Proton Paramagnetic Shifts",\N
346,"346","1995-01-01",\N,"Comparison of Reduced and Oxidized Yeast Iso-1-cytochrome c Using Proton Paramagnetic Shifts",\N
349,"349","1995-01-01",\N,"Kringle-2 domain of the tissue-type plasminogen activator",\N
350,"350","1995-01-01",\N,"Kringle-2 domain of the tissue-type plasminogen activator",\N
351,"351","1995-01-01",\N,"Kringle-2 domain of the tissue-type plasminogen activator",\N
353,"353","1995-01-01",\N,"Hydrogen Exchange of the Tryptophan Residues in Bovine, Goat, Guinea Pig, and Human alpha-Lactalbumin",\N
354,"354","1995-01-01",\N,"Hydrogen Exchange of the Tryptophan Residues in Bovine, Goat, Guinea Pig, and Human alpha-Lactalbumin",\N
355,"355","1995-01-01",\N,"Hydrogen Exchange of the Tryptophan Residues in Bovine, Goat, Guinea Pig, and Human alpha-Lactalbumin",\N
356,"356","1995-01-01",\N,"Conformational behavior of fragments of adrenocorticotropin and their antisense peptides determined by NMR spectroscopy and CD spectropolarimetry",\N
357,"357","1995-01-01",\N,"Conformational behavior of fragments of adrenocorticotropin and their antisense peptides determined by NMR spectroscopy and CD spectropolarimetry",\N
358,"358","1995-01-01",\N,"Sequential Resonance Assignment and Secondary Structure Determination of the Ascaris Trypsin Inhibitor, a Member of a Novel Class of Proteinase Inhibitors",\N
359,"359","1995-01-01",\N,"Proton magnetic resonance characterization of phoratoxins and homologous proteins related to crambin",\N
360,"360","1995-01-01",\N,"Proton magnetic resonance characterization of phoratoxins and homologous proteins related to crambin",\N
361,"361","1995-01-01",\N,"Proton magnetic resonance characterization of phoratoxins and homologous proteins related to crambin",\N
362,"362","1995-01-01",\N,"Proton magnetic resonance characterization of phoratoxins and homologous proteins related to crambin",\N
363,"363","1995-01-01",\N,"Rearrangement of the Distal Pocket Accompanying E7 His->Gln Substitution in Elephant Carbonmonoxy- and Oxymyoglobin: 1H NMR Identification of a New Aromatic Residue in the Heme Pocket",\N
364,"364","1995-01-01",\N,"Rearrangement of the Distal Pocket Accompanying E7 His->Gln Substitution in Elephant Carbonmonoxy- and Oxymyoglobin: 1H NMR Identification of a New Aromatic Residue in the Heme Pocket",\N
367,"367","1995-01-01",\N,"Assignments of 15N and 1H NMR Resonances and a Neutral pH Ionization in Rhodospirillum Rubrum Cytochrome c2",\N
369,"369","1995-01-01",\N,"Characterization of pH-Dependent Conformational Heterogeneity in Rhodospirillum rubrum Cytochrome c2 Using 15N and 1H NMR",\N
371,"371","1995-01-01",\N,"Secondary Structure of a Leucine Zipper Determined by Nuclear Magnetic Resonance Spectroscopy",\N
372,"372","1995-01-01",\N,"A 1H NMR study of the solution conformation of the neuropeptide Galanin",\N
373,"373","1995-01-01",\N,"A 1H NMR study of the solution conformation of the neuropeptide Galanin",\N
374,"374","1995-01-01",\N,"Sequential 1H-NMR assignments and secondary structure of the sea anemone polypeptide anthopleurin-A",\N
375,"375","1995-01-01",\N,"Sequential 1H-NMR assignments and secondary structure of the sea anemone polypeptide anthopleurin-A",\N
376,"376","1995-01-01",\N,"A two-dimensional 1H NMR study on Megasphaera elsdenii flavodoxin in the reduced state",\N
385,"385","1995-01-01",\N,"Proton NMR Assignments and Regular Backbone Structure of Bovine Pancreatic Ribonuclease A in Aqueous Solution",\N
386,"386","1995-01-01",\N,"1H NMR Studies of Bovine and Porcine Phospholipase A2: Assignment of Aromatic Resonances and Evidence for a Conformational Equilibrium in Solution",\N
387,"387","1995-01-01",\N,"1H NMR Studies of Bovine and Porcine Phospholipase A2: Assignment of Aromatic Resonances and Evidence for a Conformational Equilibrium in Solution",\N
388,"388","1995-01-01",\N,"1H NMR Studies of Bovine and Porcine Phospholipase A2: Assignment of Aromatic Resonances and Evidence for a Conformational Equilibrium in Solution",\N
389,"389","1995-01-01",\N,"1H NMR Studies of Bovine and Porcine Phospholipase A2: Assignment of Aromatic Resonances and Evidence for a Conformational Equilibrium in Solution",\N
390,"390","1995-01-01",\N,"1H NMR Studies of Porcine Calbindin D9k in Solution: Sequential Resonance Assignment, Secondary Structure, and Global Fold",\N
391,"391","1995-01-01",\N,"Structural Characterization of the Interactions between Calmodulin and Skeletal Muscle Myosin Light Chain Kinase: Effect of Peptide (576-594)G Binding on the Ca2+-Binding Domains",\N
392,"392","1995-01-01",\N,"Structural Characterization of the Interactions between Calmodulin and Skeletal Muscle Myosin Light Chain Kinase: Effect of Peptide (576-594)G Binding on the Ca2+-Binding Domains",\N
393,"393","1995-01-01",\N,"NMR Assignments for the Amino-Terminal Residues of trp Repressor and Their Role in DNA Binding",\N
394,"394","1995-01-01",\N,"NMR Studies of Arc Repressor Mutants: Proton Assignments, Secondary Structure, and Long-Range Contacts for the Thermostable Proline-8 -> Leucine Variant of Arc",\N
395,"395","1995-01-01",\N,"Sequence-Specific 1H NMR Assignment and Secondary Structure of the Arc Repressor of Bacteriophage P22, As Determined by Two-Dimensional 1H NMR Spectroscopy",\N
397,"397","1995-01-01",\N,"Solution structure of EETI-II, a Squash Inhibitor Knottin from Ecballium elaterium.",\N
398,"398","1995-01-01",\N,"Experimental Evidence of an alpha Helix in Desulfovibrio desulfuricans Norway Ferredoxin I: A Two-Dimensional NMR Study",\N
401,"401","1995-01-01",\N,"High-Resolution NMR Studies of Fibrinogen-like Peptides in Solution: Structural Basis for the Bleeding Disorder Caused by a Single Mutation of Gly(12) to Val(12) in the Aalpha Chain of Human Fibrinogen Rouen",\N
402,"402","1995-01-01",\N,"High-Resolution NMR Studies of Fibrinogen-like Peptides in Solution: Structural Basis for the Bleeding Disorder Caused by a Single Mutation of Gly(12) to Val(12) in the Aalpha Chain of Human Fibrinogen Rouen",\N
405,"405","1995-01-01",\N,"Two-Dimensional 1H NMR of Gene 5 Protein Indicates That Only Two Aromatic Rings Interact Significantly with Oligodeoxynucleotide Bases",\N
407,"407","1995-01-01",\N,"NMR identification of a partial helical conformation for bombesin in solution",\N
408,"408","1995-01-01",\N,"Solution conformation of leiurotoxin I (scyllatoxin) by 1H nuclear magnetic resonance Resonance assignment and secondary structure",\N
410,"410","1995-01-01",\N,"Two-dimensional 1H NMR spectroscopy of two chemically modified analogs of the basic pancreatic trypsin inhibitor Sequence-specific resonance assignments and sequence location of conformation changes relative to the native protein",\N
411,"411","1995-01-01",\N,"The Influence of a Single Salt Bridge on Static and Dynamic Features of the Globular Solution Conformation of the Basic Pancreatic Trypsin Inhibitor 1H and 13C Nuclear-Magnetic-Resonance Studies of the Native and the Transaminated Inhibitor",\N
412,"412","1995-01-01",\N,"The Influence of a Single Salt Bridge on Static and Dynamic Features of the Globular Solution Conformation of the Basic Pancreatic Trypsin Inhibitor 1H and 13C Nuclear-Magnetic-Resonance Studies of the Native and the Transaminated Inhibitor",\N
413,"413","1995-01-01",\N,"The Influence of a Single Salt Bridge on Static and Dynamic Features of the Globular Solution Conformation of the Basic Pancreatic Trypsin Inhibitor 1H and 13C Nuclear-Magnetic-Resonance Studies of the Native and the Transaminated Inhibitor",\N
414,"414","1995-01-01",\N,"The Influence of a Single Salt Bridge on Static and Dynamic Features of the Globular Solution Conformation of the Basic Pancreatic Trypsin Inhibitor 1H and 13C Nuclear-Magnetic-Resonance Studies of the Native and the Transaminated Inhibitor",\N
415,"415","1995-01-01",\N,"The Influence of a Single Salt Bridge on Static and Dynamic Features of the Globular Solution Conformation of the Basic Pancreatic Trypsin Inhibitor 1H and 13C Nuclear-Magnetic-Resonance Studies of the Native and the Transaminated Inhibitor",\N
416,"416","1995-01-01",\N,"The Influence of a Single Salt Bridge on Static and Dynamic Features of the Globular Solution Conformation of the Basic Pancreatic Trypsin Inhibitor 1H and 13C Nuclear-Magnetic-Resonance Studies of the Native and the Transaminated Inhibitor",\N
417,"417","1995-01-01",\N,"High-Resolution NMR Studies of Fibrinogen-like Peptides in Solution: Structural Basis for the Bleeding Disorder Caused by a Single Mutation of Gly(12) to Val(12) in the Aalpha Chain of Human Fibrinogen Rouen",\N
418,"418","1995-01-01",\N,"Solution Structure of Apamin Determined by Nuclear Magnetic Resonance and Distance Geometry",\N
419,"419","1995-01-01",\N,"Systematic Application of Two-Dimensional 1H Nuclear-Magnetic-Resonance Techniques for Studies of Proteins 2. Combined Use of Correlated Spectroscopy and Nuclear Overhauser Spectroscopy for Sequential Assignments of Backbone Resonances and",\N
420,"420","1995-01-01",\N,"Complete assignment of the 1H NMR spectrum of a synthetic zinc finger from Xfin Sequential resonance assignments and secondary structure",\N
421,"421","1995-01-01",\N,"1H Nuclear Magnetic Resonance Assignments and Secondary Structure of Porcine C5ades Arg",\N
422,"422","1995-01-01",\N,"Solution Conformation of Conotoxin GI Determined by 1H Nuclear Magnetic Resonance Spectroscopy and Distance Geometry Calculations",\N
423,"423","1995-01-01",\N,"Solution Conformation of Conotoxin GI Determined by 1H Nuclear Magnetic Resonance Spectroscopy and Distance Geometry Calculations",\N
426,"426","1995-01-01",\N,"Proton nuclear Overhauser effect investigation of the heme pocket expansion in trimethyl phosphine sperm whale myoglobin",\N
428,"428","1995-01-01",\N,"Solution Conformation of the Type I Collagen alpha-1 Chain N-Telopeptide Studied by 1H NMR Spectroscopy",\N
429,"429","1995-01-01",\N,"Solution Conformation of the Type I Collagen alpha-1 Chain N-Telopeptide Studied by 1H NMR Spectroscopy",\N
430,"430","1995-01-01",\N,"Solution Conformation of the Type I Collagen alpha-1 Chain N-Telopeptide Studied by 1H NMR Spectroscopy",\N
432,"432","1995-01-01",\N,"NMR Study of the Phosphoryl Binding Loop in Purine Nucleotide Proteins: Evidence for a Strong Hydrogen Bonding in Human N-ras p21",\N
433,"433","1995-01-01",\N,"NMR Study of the Phosphoryl Binding Loop in Purine Nucleotide Proteins: Evidence for a Strong Hydrogen Bonding in Human N-ras p21",\N
434,"434","1995-01-01",\N,"Complete Resonance Assignment for the Polypeptide Backbone of Interleukin 1beta Using Three-Dimensional Heteronuclear NMR Spectroscopy",\N
435,"435","1995-01-01",\N,"Complete Resonance Assignment for the Polypeptide Backbone of Interleukin 1beta Using Three-Dimensional Heteronuclear NMR Spectroscopy",\N
436,"436","1995-01-01",\N,"Salt-Dependent Structure Change and Ion Binding in Cytochrome c Studied by Two-Dimensional Proton NMR",\N
437,"437","1995-01-01",\N,"Salt-Dependent Structure Change and Ion Binding in Cytochrome c Studied by Two-Dimensional Proton NMR",\N
438,"438","1995-01-01",\N,"Salt-Dependent Structure Change and Ion Binding in Cytochrome c Studied by Two-Dimensional Proton NMR",\N
439,"439","1995-01-01",\N,"Salt-Dependent Structure Change and Ion Binding in Cytochrome c Studied by Two-Dimensional Proton NMR",\N
440,"440","1995-01-01",\N,"Secondary structure of complement component C3a anaphylatoxin in solution as determined by NMR spectroscopy: Differences between crystal and solution conformations",\N
441,"441","1995-01-01",\N,"NMR studies of the Escherichia coli trp aporepressor Sequence-specific assignment of the aromatic proton residues",\N
442,"442","1995-01-01",\N,"NMR studies of the Escherichia coli trp aporepressor Sequence-specific assignment of the aromatic proton residues",\N
443,"443","1995-01-01",\N,"Sequential 1H-NMR assignment and solution structure of bovine pancreatic ribonuclease A",\N
444,"444","1995-01-01",\N,"Structure of the DNA binding wing of the gene-V encoded single-stranded DNA binding protein of the filamentous bacteriophage M13",\N
447,"447","1995-01-01",\N,"Multinuclear Magnetic Resonance Studies of the 2Fe-2S, Ferredoxin from Anabaena Species Strain PCC 7120. 1. Sequence-Specific Hydrogen-1 Resonance Assignments and Secondary Structure in Solution of the Oxidized Form",\N
448,"448","1995-01-01",\N,"Helix Formation and Stability in a Signal Sequence",\N
449,"449","1995-01-01",\N,"Characterization of Selectively 13C-Labeled Synthetic Melittin and Melittin Analogues in Isotropic Solvents by Circular Dichroism, Fluorescence, and NMR Spectroscopy",\N
450,"450","1995-01-01",\N,"Characterization of Selectively 13C-Labeled Synthetic Melittin and Melittin Analogues in Isotropic Solvents by Circular Dichroism, Fluorescence, and NMR Spectroscopy",\N
451,"451","1995-01-01",\N,"Characterization of Selectively 13C-Labeled Synthetic Melittin and Melittin Analogues in Isotropic Solvents by Circular Dichroism, Fluorescence, and NMR Spectroscopy",\N
452,"452","1995-01-01",\N,"Characterization of Selectively 13C-Labeled Synthetic Melittin and Melittin Analogues in Isotropic Solvents by Circular Dichroism, Fluorescence, and NMR Spectroscopy",\N
453,"453","1995-01-01",\N,"Characterization of Selectively 13C-Labeled Synthetic Melittin and Melittin Analogues in Isotropic Solvents by Circular Dichroism, Fluorescence, and NMR Spectroscopy",\N
454,"454","1995-01-01",\N,"Characterization of Selectively 13C-Labeled Synthetic Melittin and Melittin Analogues in Isotropic Solvents by Circular Dichroism, Fluorescence, and NMR Spectroscopy",\N
455,"455","1995-01-01",\N,"Characterization of Selectively 13C-Labeled Synthetic Melittin and Melittin Analogues in Isotropic Solvents by Circular Dichroism, Fluorescence, and NMR Spectroscopy",\N
456,"456","1995-01-01",\N,"Characterization of Selectively 13C-Labeled Synthetic Melittin and Melittin Analogues in Isotropic Solvents by Circular Dichroism, Fluorescence, and NMR Spectroscopy",\N
457,"457","1995-01-01",\N,"Characterization of Selectively 13C-Labeled Synthetic Melittin and Melittin Analogues in Isotropic Solvents by Circular Dichroism, Fluorescence, and NMR Spectroscopy",\N
458,"458","1995-01-01",\N,"Characterization of Selectively 13C-Labeled Synthetic Melittin and Melittin Analogues in Isotropic Solvents by Circular Dichroism, Fluorescence, and NMR Spectroscopy",\N
459,"459","1995-01-01",\N,"Characterization of Selectively 13C-Labeled Synthetic Melittin and Melittin Analogues in Isotropic Solvents by Circular Dichroism, Fluorescence, and NMR Spectroscopy",\N
460,"460","1995-01-01",\N,"Characterization of Selectively 13C-Labeled Synthetic Melittin and Melittin Analogues in Isotropic Solvents by Circular Dichroism, Fluorescence, and NMR Spectroscopy",\N
461,"461","1995-01-01",\N,"Characterization of Selectively 13C-Labeled Synthetic Melittin and Melittin Analogues in Isotropic Solvents by Circular Dichroism, Fluorescence, and NMR Spectroscopy",\N
462,"462","1995-01-01",\N,"Characterization of Selectively 13C-Labeled Synthetic Melittin and Melittin Analogues in Isotropic Solvents by Circular Dichroism, Fluorescence, and NMR Spectroscopy",\N
463,"463","1995-01-01",\N,"Characterization of Selectively 13C-Labeled Synthetic Melittin and Melittin Analogues in Isotropic Solvents by Circular Dichroism, Fluorescence, and NMR Spectroscopy",\N
464,"464","1995-01-01",\N,"Characterization of Selectively 13C-Labeled Synthetic Melittin and Melittin Analogues in Isotropic Solvents by Circular Dichroism, Fluorescence, and NMR Spectroscopy",\N
465,"465","1995-01-01",\N,"Characterization of Selectively 13C-Labeled Synthetic Melittin and Melittin Analogues in Isotropic Solvents by Circular Dichroism, Fluorescence, and NMR Spectroscopy",\N
466,"466","1995-01-01",\N,"Characterization of Selectively 13C-Labeled Synthetic Melittin and Melittin Analogues in Isotropic Solvents by Circular Dichroism, Fluorescence, and NMR Spectroscopy",\N
467,"467","1995-01-01",\N,"Characterization of Selectively 13C-Labeled Synthetic Melittin and Melittin Analogues in Isotropic Solvents by Circular Dichroism, Fluorescence, and NMR Spectroscopy",\N
468,"468","1995-01-01",\N,"Characterization of Selectively 13C-Labeled Synthetic Melittin and Melittin Analogues in Isotropic Solvents by Circular Dichroism, Fluorescence, and NMR Spectroscopy",\N
469,"469","1995-01-01",\N,"Characterization of Selectively 13C-Labeled Synthetic Melittin and Melittin Analogues in Isotropic Solvents by Circular Dichroism, Fluorescence, and NMR Spectroscopy",\N
470,"470","1995-01-01",\N,"Characterization of Selectively 13C-Labeled Synthetic Melittin and Melittin Analogues in Isotropic Solvents by Circular Dichroism, Fluorescence, and NMR Spectroscopy",\N
471,"471","1995-01-01",\N,"Characterization of Selectively 13C-Labeled Synthetic Melittin and Melittin Analogues in Isotropic Solvents by Circular Dichroism, Fluorescence, and NMR Spectroscopy",\N
472,"472","1995-01-01",\N,"Characterization of Selectively 13C-Labeled Synthetic Melittin and Melittin Analogues in Isotropic Solvents by Circular Dichroism, Fluorescence, and NMR Spectroscopy",\N
473,"473","1995-01-01",\N,"Characterization of Selectively 13C-Labeled Synthetic Melittin and Melittin Analogues in Isotropic Solvents by Circular Dichroism, Fluorescence, and NMR Spectroscopy",\N
474,"474","1995-01-01",\N,"Characterization of Selectively 13C-Labeled Synthetic Melittin and Melittin Analogues in Isotropic Solvents by Circular Dichroism, Fluorescence, and NMR Spectroscopy",\N
475,"475","1995-01-01",\N,"Characterization of Selectively 13C-Labeled Synthetic Melittin and Melittin Analogues in Isotropic Solvents by Circular Dichroism, Fluorescence, and NMR Spectroscopy",\N
476,"476","1995-01-01",\N,"1H NMR Sequential Assignments and Secondary Structure Analysis of Human Fibrinogen gamma-Chain C-Terminal Residues 385-411",\N
477,"477","1995-01-01",\N,"1H NMR Sequential Assignments and Secondary Structure Analysis of Human Fibrinogen gamma-Chain C-Terminal Residues 385-411",\N
478,"478","1995-01-01",\N,"Structural and Dynamic Differences between Normal and Transforming N-ras Gene Products: A 31P and Isotope-Edited 1H NMR Study",\N
479,"479","1995-01-01",\N,"Structural and Dynamic Differences between Normal and Transforming N-ras Gene Products: A 31P and Isotope-Edited 1H NMR Study",\N
480,"480","1995-01-01",\N,"A Proton Nuclear Magnetic Resonance Study of the Antihypertensive and Antiviral Protein BDS-I from the Sea Anemone Anemonia sulcata: Sequential and Stereospecific Resonance Assignment and Secondary Structure",\N
481,"481","1995-01-01",\N,"A Proton Nuclear Magnetic Resonance Study of the Antihypertensive and Antiviral Protein BDS-I from the Sea Anemone Anemonia sulcata: Sequential and Stereospecific Resonance Assignment and Secondary Structure",\N
485,"485","1995-01-01",\N,"15N Chemical Shifts of Backbone Amides in Bovine Pancreatic Trypsin Inhibitor and Apamin [Additions and Corrections to J. Am. Chem. Soc. 1989 111,7716-7722]",\N
486,"486","1995-01-01",\N,"1H and 13C NMR Chemical Shifts of the Diastereotopic Methyl Groups of Valyl and Leucyl Residues in Peptides and Proteins",\N
488,"488","1995-01-01",\N,"Structure-function relationships in the polypeptide cardiac stimulant, anthopleurin-A (Effects of limited proteolysis by trypsin)",\N
489,"489","1995-01-01",\N,"Structure-function relationships in the polypeptide cardiac stimulant, anthopleurin-A (Effects of limited proteolysis by trypsin)",\N
490,"490","1995-01-01",\N,"Thrombin-Bound Conformation of the C-Terminal Fragments of Hirudin Determined by Transferred Nuclear Overhauser Effects",\N
491,"491","1995-01-01",\N,"Nuclear magnetic resonance studies of recombinant Escherichia coli glutaredoxin (Sequence-specific assignments and secondary structure determination of the oxidized form)",\N
494,"494","1995-01-01",\N,"Two-Dimensional NMR Studies of Staphylococcal Nuclease. 1. Sequence-Specific Assignments of Hydrogen-1 Signals and Solution Structure of the Nuclease H124L-Thymidine 3',5'-Bisphosphate-Ca2+ Ternary Complex",\N
495,"495","1995-01-01",\N,"Two-Dimensional NMR Studies of Staphylococcal Nuclease. 1. Sequence-Specific Assignments of Hydrogen-1 Signals and Solution Structure of the Nuclease H124L-Thymidine 3',5'-Bisphosphate-Ca2+ Ternary Complex",\N
496,"496","1995-01-01",\N,"Two-Dimensional NMR Studies of Staphylococcal Nuclease. 2. Sequence-Specific Assignments of Carbon-13 and Nitrogen-15 Signals from the Nuclease H124L-Thymidine 3',5'-Bisphosphate-Ca2+ Ternary Complex",\N
497,"497","1995-01-01",\N,"Two-Dimensional NMR Studies of Staphylococcal Nuclease. 2. Sequence-Specific Assignments of Carbon-13 and Nitrogen-15 Signals from the Nuclease H124L-Thymidine 3',5'-Bisphosphate-Ca2+ Ternary Complex",\N
498,"498","1995-01-01",\N,"Characterization of pH-Dependent Conformational Heterogeneity in Rhodospirillum rubrum Cytochrome c2 Using 15N and 1H NMR",\N
499,"499","1995-01-01",\N,"Proton hyperfine resonance assignments using the nuclear Overhauser effect for ferric forms of horse and tuna cytochrome c",\N
500,"500","1995-01-01",\N,"Proton hyperfine resonance assignments using the nuclear Overhauser effect for ferric forms of horse and tuna cytochrome c",\N
505,"505","1995-01-01",\N,"1H NOE Studies on Dicopper(II) Dicobalt(II)Superoxide Dismutase",\N
506,"506","1995-01-01",\N,"1H NOE Studies on Dicopper(II) Dicobalt(II)Superoxide Dismutase",\N
507,"507","1995-01-01",\N,"Assignment of the 13C-NMR Spectra of Virgin and Reactive-Site Modified Turkey Ovomucoid Third Domain",\N
508,"508","1995-01-01",\N,"Assignment of the 13C-NMR Spectra of Virgin and Reactive-Site Modified Turkey Ovomucoid Third Domain",\N
509,"509","1995-01-01",\N,"Conformational analysis of PKI(5-22)amide, the active inhibitory fragment of the inhibitor protein of the cyclic AMP-dependent protein kinase",\N
510,"510","1995-01-01",\N,"Conformational analysis of PKI(5-22)amide, the active inhibitory fragment of the inhibitor protein of the cyclic AMP-dependent protein kinase",\N
511,"511","1995-01-01",\N,"Conformational analysis of PKI(5-22)amide, the active inhibitory fragment of the inhibitor protein of the cyclic AMP-dependent protein kinase",\N
512,"512","1995-01-01",\N,"Conformational analysis of PKI(5-22)amide, the active inhibitory fragment of the inhibitor protein of the cyclic AMP-dependent protein kinase",\N
513,"513","1995-01-01",\N,"Conformational analysis of PKI(5-22)amide, the active inhibitory fragment of the inhibitor protein of the cyclic AMP-dependent protein kinase",\N
514,"514","1995-01-01",\N,"Conformational analysis of PKI(5-22)amide, the active inhibitory fragment of the inhibitor protein of the cyclic AMP-dependent protein kinase",\N
515,"515","1995-01-01",\N,"Conformational analysis of PKI(5-22)amide, the active inhibitory fragment of the inhibitor protein of the cyclic AMP-dependent protein kinase",\N
516,"516","1995-01-01",\N,"Secondary Structure of the Human Growth Hormone Releasing Factor (GRF 1-29) by Two-Dimensional 1H-NMR Spectroscopy",\N
517,"517","1995-01-01",\N,"Conformation of the Second Disulfide Loop in Human Transforming Growth Factor-alpha Studied by Two-Dimensional NMR Spectroscopy",\N
528,"528","1995-01-01",\N,"Confirmation of the Structure of Nisin by Complete 1H N.m.r. Resonance Assignment in Aqueous and Dimethyl Sulphoxide Solution",\N
529,"529","1995-01-01",\N,"Confirmation of the Structure of Nisin by Complete 1H N.m.r. Resonance Assignment in Aqueous and Dimethyl Sulphoxide Solution",\N
530,"530","1995-01-01",\N,"Two-Dimensional NMR Studies of Staphylococcal Nuclease: Evidence for Conformational Heterogeneity from Hydrogen-1, Carbon-13, and Nitrogen-15 Spin System Assignments of the Aromatic Amino Acids in the Nuclease H124L-Thymidine 3',5'-Bisphosp",\N
531,"531","1995-01-01",\N,"1H NMR Studies on Bovine Cyclophilin: Preliminary Structural Characterization of Its Complex with Cyclosporin A",\N
532,"532","1995-01-01",\N,"1H NMR Studies on Bovine Cyclophilin: Preliminary Structural Characterization of Its Complex with Cyclosporin A",\N
537,"537","1995-01-01",\N,"13C NMR Studies of the Binding of Soybean Trypsin Inhibitor to Trypsin",\N
538,"538","1995-01-01",\N,"13C NMR Studies of the Binding of Soybean Trypsin Inhibitor to Trypsin",\N
539,"539","1995-01-01",\N,"13C NMR Studies of the Binding of Soybean Trypsin Inhibitor to Trypsin",\N
540,"540","1995-01-01",\N,"13C NMR Studies of the Binding of Soybean Trypsin Inhibitor to Trypsin",\N
541,"541","1995-01-01",\N,"13C NMR Studies of the Binding of Soybean Trypsin Inhibitor to Trypsin",\N
543,"543","1995-01-01",\N,"Nuclear-Magnetic-Resonance Studies of Eucaryotic Cytochrome c Assignment of Resonances of Aliphatic Amino Acids",\N
544,"544","1995-01-01",\N,"Nuclear-Magnetic-Resonance Studies of Eucaryotic Cytochrome c Assignment of Resonances of Aliphatic Amino Acids",\N
545,"545","1995-01-01",\N,"Nuclear-Magnetic-Resonance Studies of Eucaryotic Cytochrome c Assignment of Resonances of Aliphatic Amino Acids",\N
546,"546","1995-01-01",\N,"Nuclear-Magnetic-Resonance Studies of Eucaryotic Cytochrome c Assignment of Resonances of Aliphatic Amino Acids",\N
547,"547","1995-01-01",\N,"A Novel Approach for Sequential Assignment of 1H, 13C, and 15N Spectra of Larger Proteins: Heteronuclear Triple-Resonance Three-Dimensional NMR Spectroscopy. Application to Calmodulin",\N
548,"548","1995-01-01",\N,"Sequence-Specific 1H NMR Assignment and Secondary Structure of Neuropeptide Y in Aqueous Solution",\N
554,"554","1995-01-01",\N,"Complete Sequence-Specific 1H NMR Assignments for Human Insulin",\N
555,"555","1995-01-01",\N,"Complete Sequence-Specific 1H NMR Assignments for Human Insulin",\N
556,"556","1995-01-01",\N,"Two-Dimensional NMR and Photo-CIDNP Studies of the Insulin Monomer: Assignment of Aromatic Resonances with Application to Protein Folding, Structure, and Dynamics",\N
557,"557","1995-01-01",\N,"Two-Dimensional NMR and Photo-CIDNP Studies of the Insulin Monomer: Assignment of Aromatic Resonances with Application to Protein Folding, Structure, and Dynamics",\N
558,"558","1995-01-01",\N,"Soybean Trypsin Inhibitor (Kunitz) and Its Complex with Trypsin. Carbon-13 Nuclear Magnetic Resonance Studies of the Reactive Site Arginine",\N
559,"559","1995-01-01",\N,"Soybean Trypsin Inhibitor (Kunitz) and Its Complex with Trypsin. Carbon-13 Nuclear Magnetic Resonance Studies of the Reactive Site Arginine",\N
560,"560","1995-01-01",\N,"Soybean Trypsin Inhibitor (Kunitz) and Its Complex with Trypsin. Carbon-13 Nuclear Magnetic Resonance Studies of the Reactive Site Arginine",\N
561,"561","1995-01-01",\N,"Soybean Trypsin Inhibitor (Kunitz) and Its Complex with Trypsin. Carbon-13 Nuclear Magnetic Resonance Studies of the Reactive Site Arginine",\N
562,"562","1995-01-01",\N,"Soybean Trypsin Inhibitor (Kunitz) and Its Complex with Trypsin. Carbon-13 Nuclear Magnetic Resonance Studies of the Reactive Site Arginine",\N
563,"563","1995-01-01",\N,"Soybean Trypsin Inhibitor (Kunitz) and Its Complex with Trypsin. Carbon-13 Nuclear Magnetic Resonance Studies of the Reactive Site Arginine",\N
568,"568","1995-01-01",\N,"Applications of Natural-Abundance Carbon-13 NMR to Studies of Proteins and Glycoproteins",\N
569,"569","1995-01-01",\N,"A Structural Study of the Hydrophobic Box Region of Lysozyme in Solution Using Nuclear Overhauser Effects",\N
573,"573","1995-01-01",\N,"GAL4 transcription factor is not a \"zinc finger\" but forms a Zn(II)2Cys6 binuclear cluster",\N
595,"595","1995-01-01",\N,"1H Nuclear-Magnetic-Resonance Studies of the Conformation of Cardiotoxin VII2 from Naja mossambica mossambica",\N
596,"596","1995-01-01",\N,"1H Nuclear-Magnetic-Resonance Studies of the Conformation of Cardiotoxin VII2 from Naja mossambica mossambica",\N
597,"597","1995-01-01",\N,"1H Nuclear-Magnetic-Resonance Studies of the Conformation of Cardiotoxin VII2 from Naja mossambica mossambica",\N
598,"598","1995-01-01",\N,"1H Nuclear-Magnetic-Resonance Studies of the Conformation of Cardiotoxin VII2 from Naja mossambica mossambica",\N
599,"599","1995-01-01",\N,"1H Nuclear-Magnetic-Resonance Studies of the Conformation of Cardiotoxin VII2 from Naja mossambica mossambica",\N
600,"600","1995-01-01",\N,"1H Nuclear-Magnetic-Resonance Studies of the Conformation of Cardiotoxin VII2 from Naja mossambica mossambica",\N
606,"606","1995-01-01",\N,"Melittin Bound to Dodecylphosphocholine Micelles 1H-NMR Assignments and Global Conformational Features",\N
611,"611","1995-01-01",\N,"A Proton-Magnetic-Resonance Study on the Molecular Conformation and Structure-Function Relationship of a Long Neurotoxin, Laticauda Semifasciata III from Laticauda semifasciata",\N
613,"613","1995-01-01",\N,"The 1H Nuclear-Magnetic-Resonance Spectra and Spatial Structure of the Naja mossambica mossambica Neurotoxin III",\N
614,"614","1995-01-01",\N,"The 1H Nuclear-Magnetic-Resonance Spectra and Spatial Structure of the Naja mossambica mossambica Neurotoxin III",\N
623,"623","1995-01-01",\N,"Conformation of a Heptadecapeptide Comprising the Segment Encephalitogenic in Rhesus Monkeys",\N
630,"630","1995-01-01",\N,"The Stability of Ferricytochrome c Temperature Dependence of Its NMR Spectrum",\N
644,"644","1995-01-01",\N,"Proline Assignments and Identification of the Cis K116/P117 Peptide Bond in Liganded Staphylococcal Nuclease Using Isotope Edited 2D NMR Spectroscopy",\N
645,"645","1995-01-01",\N,"N.m.r. and e.p.r. characterization of [4-carboxy-2,6-dinitrophenyllysine]cytochromes c",\N
646,"646","1995-01-01",\N,"N.m.r. and e.p.r. characterization of [4-carboxy-2,6-dinitrophenyllysine]cytochromes c",\N
647,"647","1995-01-01",\N,"N.m.r. and e.p.r. characterization of [4-carboxy-2,6-dinitrophenyllysine]cytochromes c",\N
648,"648","1995-01-01",\N,"N.m.r. and e.p.r. characterization of [4-carboxy-2,6-dinitrophenyllysine]cytochromes c",\N
649,"649","1995-01-01",\N,"N.m.r. and e.p.r. characterization of [4-carboxy-2,6-dinitrophenyllysine]cytochromes c",\N
653,"653","1995-01-01",\N,"Assignment of tyrosine resonances in the 1H-NMR spectrum of tryptophan synthase alpha-subunit Monitoring conformational changes due to substitutions at position 49",\N
660,"660","1995-01-01",\N,"Secondary and tertiary structure characteristics of Megasphaera elsdenii flavodoxin in the reduced state as determined by two-dimensional 1H NMR",\N
661,"661","1995-01-01",\N,"A Folded Structure for the Lac-Repressor Headpiece",\N
662,"662","1995-01-01",\N,"High-Resolution 13C-NMR Study of the Topography and Dynamics of Methionine Residues in Detergent-Solubilized Bacteriorhodopsin",\N
664,"664","1995-01-01",\N,"Solution Structure of Mitochondrial Cytochrome c I. H1 Nuclear Magnetic Resonance of Ferricytochrome c",\N
665,"665","1995-01-01",\N,"Solution Structure of Mitochondrial Cytochrome c I. H1 Nuclear Magnetic Resonance of Ferricytochrome c",\N
666,"666","1995-01-01",\N,"Solution Structure of Mitochondrial Cytochrome c I. H1 Nuclear Magnetic Resonance of Ferricytochrome c",\N
667,"667","1995-01-01",\N,"Solution Structure of Mitochondrial Cytochrome c I. H1 Nuclear Magnetic Resonance of Ferricytochrome c",\N
668,"668","1995-01-01",\N,"Solution Structure of Mitochondrial Cytochrome c I. H1 Nuclear Magnetic Resonance of Ferricytochrome c",\N
672,"672","1995-01-01",\N,"Cobalt-Cytochrome c. II. Magnetic Resonance Spectra and Conformational Transitions",\N
673,"673","1995-01-01",\N,"Cobalt-Cytochrome c. II. Magnetic Resonance Spectra and Conformational Transitions",\N
674,"674","1995-01-01",\N,"Physicochemical Characterization of Glucagon-Containing Lipid Micelles",\N
676,"676","1995-01-01",\N,"1H NMR Study of Rabbit Skeletal Muscle Troponin C: Mg2+-Induced Conformational Change",\N
677,"677","1995-01-01",\N,"1H NMR Study of Rabbit Skeletal Muscle Troponin C: Mg2+-Induced Conformational Change",\N
682,"682","1995-01-01",\N,"Solution structure of the isolated ribonuclease C-terminal 112-124 fragment",\N
695,"695","1995-01-01",\N,"Proton NMR studies of apo-neocarzinostatin from Streptomyces carzinostaticus Sequence-specific assignment and secondary structure",\N
699,"699","1995-01-01",\N,"Sequential Resonance Assignments as a Basis for the Determination of a Three-dimensional Structure of Protein E-L30 of Escherichia coli",\N
700,"700","1995-01-01",\N,"Proton Nuclear Magnetic Resonance Studies of Intact Native Bovine Parathyroid Hormone",\N
704,"704","1995-01-01",\N,"Two-Dimensional 1H NMR of Gene 5 Protein Indicates That Only Two Aromatic Rings Interact Significantly with Oligodeoxynucleotide Bases",\N
705,"705","1995-01-01",\N,"Two-Dimensional 1H NMR of Gene 5 Protein Indicates That Only Two Aromatic Rings Interact Significantly with Oligodeoxynucleotide Bases",\N
706,"706","1995-01-01",\N,"Two-Dimensional 1H NMR of Gene 5 Protein Indicates That Only Two Aromatic Rings Interact Significantly with Oligodeoxynucleotide Bases",\N
707,"707","1995-01-01",\N,"Two-Dimensional 1H NMR of Gene 5 Protein Indicates That Only Two Aromatic Rings Interact Significantly with Oligodeoxynucleotide Bases",\N
736,"736","1995-01-01",\N,"Complex of lac Repressor Headpiece with a 14 Base-pair lac Operator Fragment Studied by Two-dimensional Nuclear Magnetic Resonance",\N
749,"749","1995-01-01",\N,"Nuclear Magnetic Resonance Study on Rabbit Skeletal Troponin C: Calcium-Induced Conformational Change",\N
750,"750","1995-01-01",\N,"Nuclear Magnetic Resonance Study on Rabbit Skeletal Troponin C: Calcium-Induced Conformational Change",\N
753,"753","1995-01-01",\N,"1H NMR Resonance Assignments, Secondary Structure, and Global Fold of Apo Bovine Calbindin D9k",\N
754,"754","1995-01-01",\N,"Sequence-Specific 1H NMR Assignments and Secondary Structure of Porcine Motilin",\N
758,"758","1995-01-01",\N,"NMR Comparison of Prokaryotic and Eukaryotic Cytochromes c",\N
759,"759","1995-01-01",\N,"NMR Comparison of Prokaryotic and Eukaryotic Cytochromes c",\N
760,"760","1995-01-01",\N,"NMR Comparison of Prokaryotic and Eukaryotic Cytochromes c",\N
761,"761","1995-01-01",\N,"NMR Comparison of Prokaryotic and Eukaryotic Cytochromes c",\N
779,"779","1995-01-01",\N,"A 1H-NMR Study of the Solution Conformation of Icaria chemotactic peptide and its [Lys7] analog: Effects on the physiological activity of a substitution of proline to lysine at position 7",\N
780,"780","1995-01-01",\N,"Sequence-specific [1H]NMR resonance assignments and secondary structure identification for 1- and 2-zinc finger constructs from SWI5 A hydrophobic core involving four invariant residues",\N
781,"781","1995-01-01",\N,"Sequence-specific [1H]NMR resonance assignments and secondary structure identification for 1- and 2-zinc finger constructs from SWI5 A hydrophobic core involving four invariant residues",\N
791,"791","1995-01-01",\N,"Proton NMR Detection of Long-Range Heteronuclear Multiquantum Coherences in Proteins: The Complete Assignment of the Quaternary Aromatic 13C Shifts in Lysozyme",\N
810,"810","1995-01-01",\N,"Computer-aided assignment of the 1H-NMR spectrum of the viral-protein-genome-linked polypeptide from cowpea mosaic virus",\N
811,"811","1995-01-01",\N,"Investigation of Copper-Zinc Superoxide Dismutase Ser-137 and Ala-137 Mutants",\N
812,"812","1995-01-01",\N,"Investigation of Copper-Zinc Superoxide Dismutase Ser-137 and Ala-137 Mutants",\N
813,"813","1995-01-01",\N,"Investigation of Copper-Zinc Superoxide Dismutase Ser-137 and Ala-137 Mutants",\N
814,"814","1995-01-01",\N,"Investigation of Copper-Zinc Superoxide Dismutase Ser-137 and Ala-137 Mutants",\N
821,"821","1995-01-01",\N,"Identification of Localized Redox States in Plant-Type Two-Iron Ferredoxins Using the Nuclear Overhauser Effect",\N
822,"822","1995-01-01",\N,"Identification of Localized Redox States in Plant-Type Two-Iron Ferredoxins Using the Nuclear Overhauser Effect",\N
823,"823","1995-01-01",\N,"Assignment of heme and distal amino acid resonances in the 1H-NMR spectra of the carbon monoxide and oxygen complexes of sperm whale myoglobin",\N
824,"824","1995-01-01",\N,"Assignment of heme and distal amino acid resonances in the 1H-NMR spectra of the carbon monoxide and oxygen complexes of sperm whale myoglobin",\N
846,"846","1995-01-01",\N,"Hydrogen-1 Nuclear Magnetic Resonance Investigation of Bovine Cardiac Troponin C. Comparison of Tyrosyl Assignments and Calcium-Induced Structural Changes to Those of Two Homologous Proteins, Rabbit Skeletal Troponin C and Bovine Brain Calm",\N
848,"848","1995-01-01",\N,"High-Resolution Nuclear Magnetic Resonance Studies of the Lac Repressor. 1. Assignments of Tyrosine Resonances in the N-Terminal Headpiece",\N
849,"849","1995-01-01",\N,"High-Resolution Nuclear Magnetic Resonance Studies of the Lac Repressor. 2. Partial Analysis of the Aliphatic Region of the Lac Repressor Headpiece Spectrum",\N
862,"862","1995-01-01",\N,"Hydrogen-1 Nuclear Magnetic Resonance Investigation of Bovine Cardiac Troponin C. Comparison of Tyrosyl Assignments and Calcium-Induced Structural Changes to Those of Two Homologous Proteins, Rabbit Skeletal Troponin C and Bovine Brain Calm",\N
877,"877","1995-01-01",\N,"Carbon-13 Nuclear-Magnetic-Resonance Spectroscopy of Whole Cells and of Cytochrome c from Neurospora crassa Grown with [S-Me-13C]Methionine",\N
878,"878","1995-01-01",\N,"Carbon-13 Nuclear-Magnetic-Resonance Spectroscopy of Whole Cells and of Cytochrome c from Neurospora crassa Grown with [S-Me-13C]Methionine",\N
883,"883","1995-01-01",\N,"1H Nuclear Magnetic Resonance Study of the Histidine Residues of Insulin",\N
884,"884","1995-01-01",\N,"1H Nuclear Magnetic Resonance Study of the Histidine Residues of Insulin",\N
887,"887","1995-01-01",\N,"pH-Induced Denaturation of Proteins: A Single Salt Bridge Contributes 3-5 kcal/mol to the Free Energy of Folding of T4 Lysozyme",\N
888,"888","1995-01-01",\N,"pH-Induced Denaturation of Proteins: A Single Salt Bridge Contributes 3-5 kcal/mol to the Free Energy of Folding of T4 Lysozyme",\N
893,"893","1995-01-01",\N,"Proton Magnetic Resonance Spectra of Porcine Muscle Adenylate Kinase and Substrate Complexes",\N
907,"907","1995-01-01",\N,"Studies of Individual Carbon Sites of Hemoglobins in Solution by Natural Abundance Carbon 13 Nuclear Magnetic Resonance Spectroscopy",\N
908,"908","1995-01-01",\N,"Studies of Individual Carbon Sites of Hemoglobins in Solution by Natural Abundance Carbon 13 Nuclear Magnetic Resonance Spectroscopy",\N
909,"909","1995-01-01",\N,"Studies of Individual Carbon Sites of Hemoglobins in Solution by Natural Abundance Carbon 13 Nuclear Magnetic Resonance Spectroscopy",\N
910,"910","1995-01-01",\N,"Studies of Individual Carbon Sites of Hemoglobins in Solution by Natural Abundance Carbon 13 Nuclear Magnetic Resonance Spectroscopy",\N
911,"911","1995-01-01",\N,"Studies of Individual Carbon Sites of Hemoglobins in Solution by Natural Abundance Carbon 13 Nuclear Magnetic Resonance Spectroscopy",\N
912,"912","1995-01-01",\N,"Studies of Individual Carbon Sites of Hemoglobins in Solution by Natural Abundance Carbon 13 Nuclear Magnetic Resonance Spectroscopy",\N
913,"913","1995-01-01",\N,"Studies of Individual Carbon Sites of Hemoglobins in Solution by Natural Abundance Carbon 13 Nuclear Magnetic Resonance Spectroscopy",\N
914,"914","1995-01-01",\N,"Studies of Individual Carbon Sites of Hemoglobins in Solution by Natural Abundance Carbon 13 Nuclear Magnetic Resonance Spectroscopy",\N
915,"915","1995-01-01",\N,"Assignment of the Backbone 1H and 15N NMR Resonances of Bacteriophage T4 Lysozyme",\N
916,"916","1995-01-01",\N,"Sequence-Specific 1H NMR Assignments and Secondary Structure in Solution of Escherichia coli trp Repressor",\N
918,"918","1995-01-01",\N,"Mechanism of Adenylate Kinase. Structural and Functional Demonstration of Arginine-138 as a Key Catalytic Residue That Cannot Be Replaced by Lysine",\N
919,"919","1995-01-01",\N,"Mechanism of Adenylate Kinase. Structural and Functional Demonstration of Arginine-138 as a Key Catalytic Residue That Cannot Be Replaced by Lysine",\N
920,"920","1995-01-01",\N,"Mechanism of Adenylate Kinase. Structural and Functional Demonstration of Arginine-138 as a Key Catalytic Residue That Cannot Be Replaced by Lysine",\N
922,"922","1995-01-01",\N,"Assignment of Proton Resonances, Identification of Secondary Structural Elements, and Analysis of Backbone Chemical Shifts for the C102T Variant of Yeast Iso-1-cytochrome c and Horse Cytochrome c",\N
923,"923","1995-01-01",\N,"Assignment of Proton Resonances, Identification of Secondary Structural Elements, and Analysis of Backbone Chemical Shifts for the C102T Variant of Yeast Iso-1-cytochrome c and Horse Cytochrome c",\N
932,"932","1995-01-01",\N,"Sequence-Specific 1H NMR Resonance Assignments of Bacillus subtilis HPr: Use of Spectra Obtained from Mutants To Resolve Spectral Overlap",\N
934,"934","1995-01-01",\N,"A Proton Nuclear Magnetic Resonance and Molecular Modeling Study of Cardiac Troponin C Calcium Dependence and Aromatic Spectral Assignments",\N
936,"936","1995-01-01",\N,"Two-dimensional NMR studies on des-pentapeptide-insulin Proton resonance assignments and secondary structure analysis",\N
937,"937","1995-01-01",\N,"Two-dimensional NMR studies on des-pentapeptide-insulin Proton resonance assignments and secondary structure analysis",\N
939,"939","1995-01-01",\N,"Comparative Structural Analysis of the Calcium Free and Bound States of the Calcium Regulatory Protein Calbindin D9K",\N
940,"940","1995-01-01",\N,"Comparative Structural Analysis of the Calcium Free and Bound States of the Calcium Regulatory Protein Calbindin D9K",\N
944,"944","1995-01-01",\N,"Nuclear Magnetic Resonances Study of Exchangeable Protons in Ferrocytochrome c",\N
945,"945","1995-01-01",\N,"Nuclear Magnetic Resonances Study of Exchangeable Protons in Ferrocytochrome c",\N
946,"946","1995-01-01",\N,"Cytochrome c. Observation of Numerous Single-Carbon Sites of the Reduced and Oxidized Species by Means of Natural-Abundance 13C Nuclear Magnetic Resonance Spectroscopy",\N
947,"947","1995-01-01",\N,"Cytochrome c. Observation of Numerous Single-Carbon Sites of the Reduced and Oxidized Species by Means of Natural-Abundance 13C Nuclear Magnetic Resonance Spectroscopy",\N
948,"948","1995-01-01",\N,"Assignment of aromatic amino acid pmr resonances of horse ferricytochrome c",\N
949,"949","1995-01-01",\N,"Assignment of aromatic amino acid pmr resonances of horse ferricytochrome c",\N
956,"956","1995-01-01",\N,"Pulsed NMR Study of the Structure of Cytochrome c",\N
957,"957","1995-01-01",\N,"Pulsed NMR Study of the Structure of Cytochrome c",\N
960,"960","1995-01-01",\N,"High Resolution Nuclear Magnetic Resonance Studies of the Active Site of Chymotrypsin II. Polarization of Histidine 57 by Substrate Analogues and Competitive Inhibitors",\N
961,"961","1995-01-01",\N,"High Resolution Nuclear Magnetic Resonance Studies of the Active Site of Chymotrypsin II. Polarization of Histidine 57 by Substrate Analogues and Competitive Inhibitors",\N
962,"962","1995-01-01",\N,"High Resolution Nuclear Magnetic Resonance Studies of the Active Site of Chymotrypsin II. Polarization of Histidine 57 by Substrate Analogues and Competitive Inhibitors",\N
963,"963","1995-01-01",\N,"High Resolution Nuclear Magnetic Resonance Studies of the Active Site of Chymotrypsin II. Polarization of Histidine 57 by Substrate Analogues and Competitive Inhibitors",\N
964,"964","1995-01-01",\N,"High Resolution Nuclear Magnetic Resonance Studies of the Active Site of Chymotrypsin II. Polarization of Histidine 57 by Substrate Analogues and Competitive Inhibitors",\N
965,"965","1995-01-01",\N,"High Resolution Nuclear Magnetic Resonance Studies of the Active Site of Chymotrypsin II. Polarization of Histidine 57 by Substrate Analogues and Competitive Inhibitors",\N
966,"966","1995-01-01",\N,"High Resolution Nuclear Magnetic Resonance Studies of the Active Site of Chymotrypsin II. Polarization of Histidine 57 by Substrate Analogues and Competitive Inhibitors",\N
967,"967","1995-01-01",\N,"High Resolution Nuclear Magnetic Resonance Studies of the Active Site of Chymotrypsin II. Polarization of Histidine 57 by Substrate Analogues and Competitive Inhibitors",\N
968,"968","1995-01-01",\N,"15N NMR Spectroscopy of Pseudomonas Cytochrome c-551",\N
969,"969","1995-01-01",\N,"15N NMR Spectroscopy of Pseudomonas Cytochrome c-551",\N
970,"970","1995-01-01",\N,"15N NMR Spectroscopy of Pseudomonas Cytochrome c-551",\N
971,"971","1995-01-01",\N,"15N NMR Spectroscopy of Pseudomonas Cytochrome c-551",\N
975,"975","1995-01-01",\N,"Sequential Assignment of the 1H Nuclear Magnetic Resonance Spectrum of Barnase",\N
979,"979","1995-01-01",\N,"Sequence Specific 1H NMR Assignments and Determination of the Secondary Structure for the Activation Domain Isolated from Pancreatic Procarboxypeptidase B",\N
994,"994","1995-01-01",\N,"Sequence-specific 1H-NMR assignments for the aromatic region of several biologically active, monomeric insulins including native human insulin",\N
995,"995","1995-01-01",\N,"Sequence-specific 1H-NMR assignments for the aromatic region of several biologically active, monomeric insulins including native human insulin",\N
996,"996","1995-01-01",\N,"Sequence-specific 1H-NMR assignments for the aromatic region of several biologically active, monomeric insulins including native human insulin",\N
997,"997","1995-01-01",\N,"Sequence-specific 1H-NMR assignments for the aromatic region of several biologically active, monomeric insulins including native human insulin",\N
998,"998","1995-01-01",\N,"Sequence-specific 1H-NMR assignments for the aromatic region of several biologically active, monomeric insulins including native human insulin",\N
999,"999","1995-01-01",\N,"Sequence-specific 1H-NMR assignments for the aromatic region of several biologically active, monomeric insulins including native human insulin",\N
1000,"1000","1995-01-01",\N,"Sequence-specific 1H-NMR assignments for the aromatic region of several biologically active, monomeric insulins including native human insulin",\N
1001,"1001","1995-01-01",\N,"Sequence-specific 1H-NMR assignments for the aromatic region of several biologically active, monomeric insulins including native human insulin",\N
1002,"1002","1995-01-01",\N,"Sequence-specific 1H-NMR assignments for the aromatic region of several biologically active, monomeric insulins including native human insulin",\N
1003,"1003","1995-01-01",\N,"Sequence-specific 1H-NMR assignments for the aromatic region of several biologically active, monomeric insulins including native human insulin",\N
1004,"1004","1995-01-01",\N,"Sequence-specific 1H-NMR assignments for the aromatic region of several biologically active, monomeric insulins including native human insulin",\N
1005,"1005","1995-01-01",\N,"Sequence-specific 1H-NMR assignments for the aromatic region of several biologically active, monomeric insulins including native human insulin",\N
1006,"1006","1995-01-01",\N,"Sequence-specific 1H-NMR assignments for the aromatic region of several biologically active, monomeric insulins including native human insulin",\N
1007,"1007","1995-01-01",\N,"Sequence-specific 1H-NMR assignments for the aromatic region of several biologically active, monomeric insulins including native human insulin",\N
1008,"1008","1995-01-01",\N,"Sequence-specific 1H-NMR assignments for the aromatic region of several biologically active, monomeric insulins including native human insulin",\N
1009,"1009","1995-01-01",\N,"Sequence-specific 1H-NMR assignments for the aromatic region of several biologically active, monomeric insulins including native human insulin",\N
1010,"1010","1995-01-01",\N,"Sequence-specific 1H-NMR assignments for the aromatic region of several biologically active, monomeric insulins including native human insulin",\N
1011,"1011","1995-01-01",\N,"Sequence-specific 1H-NMR assignments for the aromatic region of several biologically active, monomeric insulins including native human insulin",\N
1012,"1012","1995-01-01",\N,"Sequence-specific 1H-NMR assignments for the aromatic region of several biologically active, monomeric insulins including native human insulin",\N
1013,"1013","1995-01-01",\N,"Sequence-specific 1H-NMR assignments for the aromatic region of several biologically active, monomeric insulins including native human insulin",\N
1014,"1014","1995-01-01",\N,"Sequence-specific 1H-NMR assignments for the aromatic region of several biologically active, monomeric insulins including native human insulin",\N
1015,"1015","1995-01-01",\N,"Sequence-specific 1H-NMR assignments for the aromatic region of several biologically active, monomeric insulins including native human insulin",\N
1016,"1016","1995-01-01",\N,"Sequence-specific 1H-NMR assignments for the aromatic region of several biologically active, monomeric insulins including native human insulin",\N
1017,"1017","1995-01-01",\N,"Sequence-specific 1H-NMR assignments for the aromatic region of several biologically active, monomeric insulins including native human insulin",\N
1018,"1018","1995-01-01",\N,"Sequence-specific 1H-NMR assignments for the aromatic region of several biologically active, monomeric insulins including native human insulin",\N
1019,"1019","1995-01-01",\N,"Sequence-specific 1H-NMR assignments for the aromatic region of several biologically active, monomeric insulins including native human insulin",\N
1020,"1020","1995-01-01",\N,"Sequence-specific 1H-NMR assignments for the aromatic region of several biologically active, monomeric insulins including native human insulin",\N
1021,"1021","1995-01-01",\N,"Sequence-specific 1H-NMR assignments for the aromatic region of several biologically active, monomeric insulins including native human insulin",\N
1022,"1022","1995-01-01",\N,"Sequence-specific 1H-NMR assignments for the aromatic region of several biologically active, monomeric insulins including native human insulin",\N
1023,"1023","1995-01-01",\N,"Sequence-specific 1H-NMR assignments for the aromatic region of several biologically active, monomeric insulins including native human insulin",\N
1024,"1024","1995-01-01",\N,"Sequence-specific 1H-NMR assignments for the aromatic region of several biologically active, monomeric insulins including native human insulin",\N
1025,"1025","1995-01-01",\N,"Sequence-specific 1H-NMR assignments for the aromatic region of several biologically active, monomeric insulins including native human insulin",\N
1027,"1027","1995-01-01",\N,"1H NMR Study of the Role of Individual Heme Propionates in Modulating Structural and Dynamic Properties of the Heme Pocket in Myoglobin",\N
1028,"1028","1995-01-01",\N,"1H NMR Study of the Role of Individual Heme Propionates in Modulating Structural and Dynamic Properties of the Heme Pocket in Myoglobin",\N
1029,"1029","1995-01-01",\N,"1H NMR Study of the Role of Individual Heme Propionates in Modulating Structural and Dynamic Properties of the Heme Pocket in Myoglobin",\N
1030,"1030","1995-01-01",\N,"1H NMR Study of the Role of Individual Heme Propionates in Modulating Structural and Dynamic Properties of the Heme Pocket in Myoglobin",\N
1031,"1031","1995-01-01",\N,"1H NMR Study of the Role of Individual Heme Propionates in Modulating Structural and Dynamic Properties of the Heme Pocket in Myoglobin",\N
1032,"1032","1995-01-01",\N,"1H NMR Study of the Role of Individual Heme Propionates in Modulating Structural and Dynamic Properties of the Heme Pocket in Myoglobin",\N
1033,"1033","1995-01-01",\N,"1H NMR Study of the Role of Individual Heme Propionates in Modulating Structural and Dynamic Properties of the Heme Pocket in Myoglobin",\N
1037,"1037","1995-01-01",\N,"Determination of the Three-dimensional Structure of the Antennapedia Homeodomain from Drosophila in Solution by 1H Nuclear Magnetic Resonance Spectroscopy",\N
1039,"1039","1995-01-01",\N,"Complete Tyrosine Assignments in the High Field 1H Nuclear Magnetic Resonance Spectrum of the Bovine Pancreatic Trypsin Inhibitor",\N
1042,"1042","1995-01-01",\N,"NMR Studies of Nickle(II)-Substituted Derivatives of Bovine Copper-Zinc Superoxide Dismutase with Nickle(II) Bound in the Copper Site",\N
1043,"1043","1995-01-01",\N,"NMR Studies of Nickle(II)-Substituted Derivatives of Bovine Copper-Zinc Superoxide Dismutase with Nickle(II) Bound in the Copper Site",\N
1044,"1044","1995-01-01",\N,"NMR Studies of Nickle(II)-Substituted Derivatives of Bovine Copper-Zinc Superoxide Dismutase with Nickle(II) Bound in the Copper Site",\N
1045,"1045","1995-01-01",\N,"NMR Studies of Nickle(II)-Substituted Derivatives of Bovine Copper-Zinc Superoxide Dismutase with Nickle(II) Bound in the Copper Site",\N
1046,"1046","1995-01-01",\N,"Solution conformation of endothelin-3 by 1H NMR and distance geometry calculations",\N
1049,"1049","1995-01-01",\N,"Solution Structure of Neurotoxin I from the Sea Anemone Stichodactyla helianthus",\N
1053,"1053","1995-01-01",\N,"Direct measurement of the pK Values of an Alkaline Bohr Group in Human Hemoglobin",\N
1056,"1056","1995-01-01",\N,"NMR Studies of Nickle(II)-Substituted Derivatives of Bovine Copper-Zinc Superoxide Dismutase with Nickle(II) Bound in the Copper Site",\N
1058,"1058","1995-01-01",\N,"Proton Magnetic Resonance Studies of Horse Cytochrome c",\N
1061,"1061","1995-01-01",\N,"Assignment of the Side-Chain 1H and 13C Resonances of Interleukin-1beta Using Double- and Triple-Resonance Heteronuclear Three-Dimensional NMR Spectroscopy",\N
1062,"1062","1995-01-01",\N,"Assignment of the Side-Chain 1H and 13C Resonances of Interleukin-1beta Using Double- and Triple-Resonance Heteronuclear Three-Dimensional NMR Spectroscopy",\N
1065,"1065","1995-01-01",\N,"Solution Conformation of Thymosin beta4: A Nuclear Magnetic Resonance and Simulated Annealing Study",\N
1066,"1066","1995-01-01",\N,"High-Resolution Nuclear Magnetic Resonance Studies of the Lac Repressor. 2. Partial Analysis of the Aliphatic Region of the Lac Repressor Headpiece Spectrum",\N
1071,"1071","1995-01-01",\N,"1H NMR Assignment and Secondary Structure of the Ca+2-Free Form of the Amino-Terminal Epidermal Growth Factor like Domain in Coagulation Factor X",\N
1072,"1072","1995-01-01",\N,"Nonnative Isomers of Proline-93 and -114 Predominate in Heat-Unfolded Ribonuclease A",\N
1093,"1093","1995-01-01",\N,"Sequential 1H NMR Assignments and Secondary Structure of Hen Egg White Lysozyme in Solution",\N
1095,"1095","1995-01-01",\N,"Two-dimensional NMR as a probe of structural similarity applied to mutants of cytochrome c",\N
1096,"1096","1995-01-01",\N,"The Influence of a Single Salt Bridge on Static and Dynamic Features of the Globular Solution Conformation of the Basic Pancreatic Trypsin Inhibitor 1H and 13C Nuclear-Magnetic-Resonance Studies of the Native and the Transaminated Inhibitor",\N
1097,"1097","1995-01-01",\N,"The Influence of a Single Salt Bridge on Static and Dynamic Features of the Globular Solution Conformation of the Basic Pancreatic Trypsin Inhibitor 1H and 13C Nuclear-Magnetic-Resonance Studies of the Native and the Transaminated Inhibitor",\N
1098,"1098","1995-01-01",\N,"The Influence of a Single Salt Bridge on Static and Dynamic Features of the Globular Solution Conformation of the Basic Pancreatic Trypsin Inhibitor 1H and 13C Nuclear-Magnetic-Resonance Studies of the Native and the Transaminated Inhibitor",\N
1099,"1099","1995-01-01",\N,"Proton Nuclear Magnetic Resonance Study of the Molecular and Electronic Structure of the Heme Cavity in Aplysia Cyanometmyoglobin",\N
1100,"1100","1995-01-01",\N,"Proton Nuclear Magnetic Resonance Study of the Molecular and Electronic Structure of the Heme Cavity in Aplysia Cyanometmyoglobin",\N
1101,"1101","1995-01-01",\N,"Resonance assignments in the proton-NMR spectrum of carbonmonoxy hemoglobin by two-dimensional methods",\N
1102,"1102","1995-01-01",\N,"Resonance assignments in the proton-NMR spectrum of carbonmonoxy hemoglobin by two-dimensional methods",\N
1104,"1104","1995-01-01",\N,"Studies of Individual Carbon Sites of Proteins in Solution by Natural Abundance Carbon 13 Nuclear Magnetic Resonance Spectroscopy",\N
1105,"1105","1995-01-01",\N,"Studies of Individual Carbon Sites of Proteins in Solution by Natural Abundance Carbon 13 Nuclear Magnetic Resonance Spectroscopy",\N
1107,"1107","1995-01-01",\N,"Studies of Individual Carbon Sites of Proteins in Solution by Natural Abundance Carbon 13 Nuclear Magnetic Resonance Spectroscopy",\N
1108,"1108","1995-01-01",\N,"Studies of Individual Carbon Sites of Proteins in Solution by Natural Abundance Carbon 13 Nuclear Magnetic Resonance Spectroscopy",\N
1109,"1109","1995-01-01",\N,"Studies of Individual Carbon Sites of Proteins in Solution by Natural Abundance Carbon 13 Nuclear Magnetic Resonance Spectroscopy",\N
1110,"1110","1995-01-01",\N,"Studies of Individual Carbon Sites of Proteins in Solution by Natural Abundance Carbon 13 Nuclear Magnetic Resonance Spectroscopy",\N
1111,"1111","1995-01-01",\N,"Studies of Individual Carbon Sites of Proteins in Solution by Natural Abundance Carbon 13 Nuclear Magnetic Resonance Spectroscopy",\N
1112,"1112","1995-01-01",\N,"Studies of Individual Carbon Sites of Proteins in Solution by Natural Abundance Carbon 13 Nuclear Magnetic Resonance Spectroscopy",\N
1113,"1113","1995-01-01",\N,"Studies of Individual Carbon Sites of Proteins in Solution by Natural Abundance Carbon 13 Nuclear Magnetic Resonance Spectroscopy",\N
1114,"1114","1995-01-01",\N,"Studies of Individual Carbon Sites of Proteins in Solution by Natural Abundance Carbon 13 Nuclear Magnetic Resonance Spectroscopy",\N
1115,"1115","1995-01-01",\N,"Studies of Individual Carbon Sites of Proteins in Solution by Natural Abundance Carbon 13 Nuclear Magnetic Resonance Spectroscopy",\N
1116,"1116","1995-01-01",\N,"Studies of Individual Carbon Sites of Proteins in Solution by Natural Abundance Carbon 13 Nuclear Magnetic Resonance Spectroscopy",\N
1117,"1117","1995-01-01",\N,"Studies of Individual Carbon Sites of Proteins in Solution by Natural Abundance Carbon 13 Nuclear Magnetic Resonance Spectroscopy",\N
1120,"1120","1995-01-01",\N,"Sequential 1H NMR Assignments and Secondary Structure of the B Domain of Staphylococcal Protein A: Structural Changes between the Free B Domain in Solution and the Fc-Bound B Domain in Crystal",\N
1127,"1127","1995-01-01",\N,"Static and Transient Hydrogen-Bonding Interactions in Recombinant Desulfatohirudin Studied by 1H Nuclear Magnetic Resonance Measurements of Amide Proton Exchange Rates and pH-Dependent Chemical Shifts",\N
1128,"1128","1995-01-01",\N,"Conformation of Recombinant Desulfatohirudin in Aqueous Solution Determined by Nuclear Magnetic Resonance",\N
1129,"1129","1995-01-01",\N,"Conformation of Recombinant Desulfatohirudin in Aqueous Solution Determined by Nuclear Magnetic Resonance",\N
1133,"1133","1995-01-01",\N,"The Downfield Resonances in the 1H NMR Spectra of Azotobacter vinelandii and Pseudomonas putida Seven-iron Ferredoxins",\N
1134,"1134","1995-01-01",\N,"The Downfield Resonances in the 1H NMR Spectra of Azotobacter vinelandii and Pseudomonas putida Seven-iron Ferredoxins",\N
1135,"1135","1995-01-01",\N,"Antimicrobial Peptide, Tachyplesin I, Isolated from Hemocytes of the Horseshoe Crab (Tachypleus tridentatus)",\N
1136,"1136","1995-01-01",\N,"15N nuclear magnetic resonance studies of the B domain of Staphylococcal protein A: Sequence specific assignments of the imide 15N resonances of the proline residues and the interaction with human immunoglobin G",\N
1137,"1137","1995-01-01",\N,"Conformational Requirement of Signal Sequences Functioning in Yeast: Circular Dichroism and 1H Nuclear Magnetic Resonance Studies of Synthetic Peptides",\N
1138,"1138","1995-01-01",\N,"Conformational Requirement of Signal Sequences Functioning in Yeast: Circular Dichroism and 1H Nuclear Magnetic Resonance Studies of Synthetic Peptides",\N
1139,"1139","1995-01-01",\N,"Conformational Requirement of Signal Sequences Functioning in Yeast: Circular Dichroism and 1H Nuclear Magnetic Resonance Studies of Synthetic Peptides",\N
1140,"1140","1995-01-01",\N,"Conformational Requirement of Signal Sequences Functioning in Yeast: Circular Dichroism and 1H Nuclear Magnetic Resonance Studies of Synthetic Peptides",\N
1144,"1144","1995-01-01",\N,"NMR studies of the conformations of leghemoglobins from soybean and lupin",\N
1145,"1145","1995-01-01",\N,"NMR studies of the conformations of leghemoglobins from soybean and lupin",\N
1147,"1147","1995-01-01",\N,"Structure and Heme Environment of Ferrocytochrome c553 from 1H NMR Studies",\N
1148,"1148","1995-01-01",\N,"Structure and Heme Environment of Ferrocytochrome c553 from 1H NMR Studies",\N
1149,"1149","1995-01-01",\N,"Structure and Heme Environment of Ferrocytochrome c553 from 1H NMR Studies",\N
1150,"1150","1995-01-01",\N,"Structure and Heme Environment of Ferrocytochrome c553 from 1H NMR Studies",\N
1151,"1151","1995-01-01",\N,"Structure-function relationships in the polypeptide cardiac stimulant, anthopleurin-A (Effects of limited proteolysis by trypsin)",\N
1152,"1152","1995-01-01",\N,"Conformational Change of Adrenodoxin Induced by Reduction of Iron-Sulfur Cluster",\N
1153,"1153","1995-01-01",\N,"Conformational Change of Adrenodoxin Induced by Reduction of Iron-Sulfur Cluster",\N
1154,"1154","1995-01-01",\N,"Three-dimensional Structure of Human (113Cd7)Metallothionein-2 in Solution Determined by Nuclear Magnetic Resonance Spectroscopy",\N
1155,"1155","1995-01-01",\N,"Three-dimensional Structure of Human (113Cd7)Metallothionein-2 in Solution Determined by Nuclear Magnetic Resonance Spectroscopy",\N
1156,"1156","1995-01-01",\N,"Protein Structures in Solution by Nuclear Magnetic Resonance and Distance Geometry (The Polypeptide Fold of the Basic Pancreatic Trypsin Inhibitor Determined using Two Different Algorithms, DISGEO and DISMAN)",\N
1158,"1158","1995-01-01",\N,"Nuclear Magnetic Resonance Investigation of the Interactions with Phospholipid of an Amphipathic alpha-Helix-forming Peptide of the Apolipoprotein Class",\N
1159,"1159","1995-01-01",\N,"Nuclear Magnetic Resonance Investigation of the Interactions with Phospholipid of an Amphipathic alpha-Helix-forming Peptide of the Apolipoprotein Class",\N
1160,"1160","1995-01-01",\N,"Nuclear Magnetic Resonance Investigation of the Interactions with Phospholipid of an Amphipathic alpha-Helix-forming Peptide of the Apolipoprotein Class",\N
1161,"1161","1995-01-01",\N,"Nuclear Magnetic Resonance Investigation of the Interactions with Phospholipid of an Amphipathic alpha-Helix-forming Peptide of the Apolipoprotein Class",\N
1162,"1162","1995-01-01",\N,"Sequence-specific 1H-NMR assignment and conformation of proteolytic fragment 163-231 of bacterioopsin",\N
1163,"1163","1995-01-01",\N,"The 1H-NMR assignments of the aromatic resonances in complexes of Lactobacillus casei dihydrofolate reductase and the origins of their chemical shifts",\N
1164,"1164","1995-01-01",\N,"The 1H-NMR assignments of the aromatic resonances in complexes of Lactobacillus casei dihydrofolate reductase and the origins of their chemical shifts",\N
1165,"1165","1995-01-01",\N,"The 1H-NMR assignments of the aromatic resonances in complexes of Lactobacillus casei dihydrofolate reductase and the origins of their chemical shifts",\N
1166,"1166","1995-01-01",\N,"The 1H-NMR assignments of the aromatic resonances in complexes of Lactobacillus casei dihydrofolate reductase and the origins of their chemical shifts",\N
1167,"1167","1995-01-01",\N,"The 1H-NMR assignments of the aromatic resonances in complexes of Lactobacillus casei dihydrofolate reductase and the origins of their chemical shifts",\N
1168,"1168","1995-01-01",\N,"The 1H-NMR assignments of the aromatic resonances in complexes of Lactobacillus casei dihydrofolate reductase and the origins of their chemical shifts",\N
1170,"1170","1995-01-01",\N,"Assignment of Proton Resonances, Identification of Secondary Structural Elements, and Analysis of Backbone Chemical Shifts for the C102T Variant of Yeast Iso-1-cytochrome c and Horse Cytochrome c",\N
1171,"1171","1995-01-01",\N,"Assignment of Proton Resonances, Identification of Secondary Structural Elements, and Analysis of Backbone Chemical Shifts for the C102T Variant of Yeast Iso-1-cytochrome c and Horse Cytochrome c",\N
1174,"1174","1995-01-01",\N,"NMR analysis of site-specific mutants of yeast phosphoglycerate kinase An investigation of the triose-binding site",\N
1175,"1175","1995-01-01",\N,"NMR analysis of site-specific mutants of yeast phosphoglycerate kinase An investigation of the triose-binding site",\N
1176,"1176","1995-01-01",\N,"NMR analysis of site-specific mutants of yeast phosphoglycerate kinase An investigation of the triose-binding site",\N
1177,"1177","1995-01-01",\N,"NMR analysis of site-specific mutants of yeast phosphoglycerate kinase An investigation of the triose-binding site",\N
1178,"1178","1995-01-01",\N,"Helix Formation and Stability in a Signal Sequence",\N
1179,"1179","1995-01-01",\N,"Sequential Resonance Assignments in Protein 1H Nuclear Magnetic Resonance Spectra (Basic Pancreatic Trypsin Inhibitor)",\N
1181,"1181","1995-01-01",\N,"Coupling of Tertiary and Quaternary Changes in Human Hemoglobin: A 1D and 2D NMR Study of Hemoglobin Saint Mande (betaN102Y)",\N
1182,"1182","1995-01-01",\N,"Coupling of Tertiary and Quaternary Changes in Human Hemoglobin: A 1D and 2D NMR Study of Hemoglobin Saint Mande (betaN102Y)",\N
1183,"1183","1995-01-01",\N,"Coupling of Tertiary and Quaternary Changes in Human Hemoglobin: A 1D and 2D NMR Study of Hemoglobin Saint Mande (betaN102Y)",\N
1184,"1184","1995-01-01",\N,"Coupling of Tertiary and Quaternary Changes in Human Hemoglobin: A 1D and 2D NMR Study of Hemoglobin Saint Mande (betaN102Y)",\N
1192,"1192","1995-01-01",\N,"One- and two-dimensional proton NMR studies of cys-102 S-methylated yeast isozyme-1 ferricytochrome c",\N
1194,"1194","1995-01-01",\N,"One- and two-dimensional proton NMR studies of cys-102 S-methylated yeast isozyme-1 ferricytochrome c",\N
1198,"1198","1995-01-01",\N,"Three-Dimensional Structure of an alpha-Amylase Inhibitor HAIM as Determined by Nuclear Magnetic Resonance Methods",\N
1200,"1200","1995-01-01",\N,"Nuclear-magnetic-resonance investigations of the biliverdin-apomyoglobin complex",\N
1201,"1201","1995-01-01",\N,"Conformation in solution of porcine brain natriuretic peptide determined by combined use of nuclear magnetic resonance and distance geometry",\N
1202,"1202","1995-01-01",\N,"Characterization of Hydrophobic Cores in Apomyoglobin: A Proton NMR Spectroscopy Study",\N
1203,"1203","1995-01-01",\N,"Structural Features of the Protoporphyrin-Apomyoglobin Complex: A Proton NMR Spectroscopy Study",\N
1204,"1204","1995-01-01",\N,"Structural Features of the Protoporphyrin-Apomyoglobin Complex: A Proton NMR Spectroscopy Study",\N
1205,"1205","1995-01-01",\N,"Structural Features of the Protoporphyrin-Apomyoglobin Complex: A Proton NMR Spectroscopy Study",\N
1206,"1206","1995-01-01",\N,"Three-Dimensional Structure of the Neurotoxin ATX Ia From Anemonia sulcata in Aqueous Solution Determined by Nuclear Magnetic Resonance Spectroscopy",\N
1207,"1207","1995-01-01",\N,"An analysis of pseudocontact shifts and their relationship to structural features of the redox states of cytochrome b5",\N
1208,"1208","1995-01-01",\N,"An analysis of pseudocontact shifts and their relationship to structural features of the redox states of cytochrome b5",\N
1209,"1209","1995-01-01",\N,"1H nuclear magnetic resonance study of the solution conformation of an antibacterial protein, sapecin",\N
1210,"1210","1995-01-01",\N,"Purification and characterization of a non-reconstitutable azurin, obtained by heterologous expression of the Pseudomonas aeruginosa azu gene in Escherichia coli",\N
1211,"1211","1995-01-01",\N,"Purification and characterization of a non-reconstitutable azurin, obtained by heterologous expression of the Pseudomonas aeruginosa azu gene in Escherichia coli",\N
1212,"1212","1995-01-01",\N,"Purification and characterization of a non-reconstitutable azurin, obtained by heterologous expression of the Pseudomonas aeruginosa azu gene in Escherichia coli",\N
1213,"1213","1995-01-01",\N,"Purification and characterization of a non-reconstitutable azurin, obtained by heterologous expression of the Pseudomonas aeruginosa azu gene in Escherichia coli",\N
1214,"1214","1995-01-01",\N,"Purification and characterization of a non-reconstitutable azurin, obtained by heterologous expression of the Pseudomonas aeruginosa azu gene in Escherichia coli",\N
1215,"1215","1995-01-01",\N,"Purification and characterization of a non-reconstitutable azurin, obtained by heterologous expression of the Pseudomonas aeruginosa azu gene in Escherichia coli",\N
1216,"1216","1995-01-01",\N,"Purification and characterization of a non-reconstitutable azurin, obtained by heterologous expression of the Pseudomonas aeruginosa azu gene in Escherichia coli",\N
1217,"1217","1995-01-01",\N,"Purification and characterization of a non-reconstitutable azurin, obtained by heterologous expression of the Pseudomonas aeruginosa azu gene in Escherichia coli",\N
1218,"1218","1995-01-01",\N,"Purification and characterization of a non-reconstitutable azurin, obtained by heterologous expression of the Pseudomonas aeruginosa azu gene in Escherichia coli",\N
1219,"1219","1995-01-01",\N,"Purification and characterization of a non-reconstitutable azurin, obtained by heterologous expression of the Pseudomonas aeruginosa azu gene in Escherichia coli",\N
1220,"1220","1995-01-01",\N,"High Mobility of N-Terminal Parts of A and B Subunits of Ricin",\N
1221,"1221","1995-01-01",\N,"High Mobility of N-Terminal Parts of A and B Subunits of Ricin",\N
1222,"1222","1995-01-01",\N,"Laser Photochemically Induced Dynamic Nuclear Polarization Proton Nuclear Magnetic Resonance Studies on Three Homologous Calcium Binding Proteins: Cardiac Troponin-C, Skeletal Troponin-C, and Calmodulin",\N
1225,"1225","1995-01-01",\N,"Ca2+ and Mg2+ Dependent Conformations of Troponin C as Determined by 1H and 19F Nuclear Magnetic Resonance",\N
1226,"1226","1995-01-01",\N,"Ca2+ and Mg2+ Dependent Conformations of Troponin C as Determined by 1H and 19F Nuclear Magnetic Resonance",\N
1227,"1227","1995-01-01",\N,"Nuclear Magnetic Resonance Studied of a Ca2+-Binding Fragment of Troponin C.",\N
1228,"1228","1995-01-01",\N,"Nuclear Magnetic Resonance Studied of a Ca2+-Binding Fragment of Troponin C.",\N
1230,"1230","1995-01-01",\N,"Partial 1H NMR Assignments of the Escherichia coli Dihydrofolate Reductase Complex with Folate: Evidence for a Unique Conformation of Bound Folate",\N
1323,"1323","1995-01-01",\N,"Investigation of the solution structures and mobility of oxidised and reduced cytochrome b5 by 2D NMR spectroscopy",\N
1324,"1324","1995-01-01",\N,"Investigation of the solution structures and mobility of oxidised and reduced cytochrome b5 by 2D NMR spectroscopy",\N
1333,"1333","1995-01-01",\N,"Sequential 1H NMR Assignments of Iron(II) Cytochrome c551 from Pseudomonas aeruginosa",\N
1334,"1334","1995-01-01",\N,"Sequential 1H NMR Assignments of Iron(II) Cytochrome c551 from Pseudomonas aeruginosa",\N
1336,"1336","1995-01-01",\N,"High-Resolution Three-Dimensional Structure of a Single Zinc Finger from a Human Enhancer Binding Protein Solution",\N
1337,"1337","1995-01-01",\N,"High-Resolution Three-Dimensional Structure of a Single Zinc Finger from a Human Enhancer Binding Protein Solution",\N
1338,"1338","1995-01-01",\N,"Interaction Mechanism between Microtubule-Associated Proteins and Microtubules. A Proton Nuclear Resonance Analysis on the Binding of Synthetic Peptide to Tubulin",\N
1339,"1339","1995-01-01",\N,"Interaction Mechanism between Microtubule-Associated Proteins and Microtubules. A Proton Nuclear Resonance Analysis on the Binding of Synthetic Peptide to Tubulin",\N
1343,"1343","1995-01-01",\N,"2D NMR and Structural Model for a Mitochondrial Signal Peptide Bound to a Micelle",\N
1344,"1344","1995-01-01",\N,"Toward the Solution Structure of Human Insulin: Sequential 2D 1H NMR Assignment of a Des-pentapeptide Analogue and Comparison with Crystal Structure",\N
1346,"1346","1995-01-01",\N,"NMR Studies of Multiple Conformations in Complexes of Lactobacillus casei Dihydrofolate Reductase with Analogues of Pyrimethamine",\N
1347,"1347","1995-01-01",\N,"NMR Studies of Multiple Conformations in Complexes of Lactobacillus casei Dihydrofolate Reductase with Analogues of Pyrimethamine",\N
1348,"1348","1995-01-01",\N,"NMR Studies of Multiple Conformations in Complexes of Lactobacillus casei Dihydrofolate Reductase with Analogues of Pyrimethamine",\N
1358,"1358","1995-01-01",\N,"NH resonances of Ribonuclease S-peptide in aqueous solution",\N
1360,"1360","1995-01-01",\N,"NH resonances of Ribonuclease S-peptide in aqueous solution",\N
1374,"1374","1995-01-01",\N,"Two-Dimensional NMR Studies of Kazal Proteinase Inhibitors. 2. Sequence-Specific Assignments and Secondary Structure of Reactive Site Modified Turkey Ovomucoid Third Domain",\N
1375,"1375","1995-01-01",\N,"Assignment of the 13C-NMR Spectra of Virgin and Reactive-Site Modified Turkey Ovomucoid Third Domain",\N
1376,"1376","1995-01-01",\N,"Sequence-specific 1H-NMR assignments and determination of the secondary structure in aqueous solution of the cardiotoxins CTXIIa and CTXIIb from Naja mossambica mossambica",\N
1377,"1377","1995-01-01",\N,"Nuclear-magnetic-resonance studies of human epidermal growth factor",\N
1378,"1378","1995-01-01",\N,"Nuclear-magnetic-resonance studies of human epidermal growth factor",\N
1379,"1379","1995-01-01",\N,"A two-dimensional 1H-NMR study on Megasphaera elsdenii flavodoxin in the oxidized state and some comparisons with the two-electron-reduced state",\N
1381,"1381","1995-01-01",\N,"Two-dimensional NMR studies and secondary structure of cobrotoxin in aqueous solution",\N
1393,"1393","1995-01-01",\N,"Identification and Description of alpha-Helical Regions in Horse Muscle Acylphosphatase by 1H Nuclear Magnetic Resonance Spectroscopy",\N
1394,"1394","1995-01-01",\N,"The sequence-specific assignment of the 1H-NMR spectrum of an enzyme, horse-muscle acylphosphatase",\N
1396,"1396","1995-01-01",\N,"Solution structure of the DNA-binding domain of the yeast transcriptional activator protein GCN4",\N
1397,"1397","1995-01-01",\N,"Solution structure of the DNA-binding domain of the yeast transcriptional activator protein GCN4",\N
1398,"1398","1995-01-01",\N,"Solution structure of the DNA-binding domain of the yeast transcriptional activator protein GCN4",\N
1399,"1399","1995-01-01",\N,"Solution structure of the DNA-binding domain of the yeast transcriptional activator protein GCN4",\N
1400,"1400","1995-01-01",\N,"A Proton Nuclear Magnetic Resonance Assignment and Secondary Structure Determination of Recombinant Human Thioredoxin",\N
1403,"1403","1995-01-01",\N,"Solution Structure of Human Calcitonin Gene-Related Peptide by 1H NMR and Distance Geometry with Restrained Molecular Dynamics",\N
1404,"1404","1995-01-01",\N,"A systematic approach towards the complete assignment of 13C resonances for horse ferrocytochrome c",\N
1413,"1413","1995-01-01",\N,"1H NMR Resonance Assignment of the Active Site Residues of Paramagnetic Proteins by 2D Bond Correlation Spectroscopy: Metcyanomyoglobin",\N
1414,"1414","1995-01-01",\N,"1H Resonance Assignment and Secondary Structure Determination of the Dimerization Domain of Transcription Factor LFB1",\N
1416,"1416","1995-01-01",\N,"Rates and Energetics of Tyrosine Ring Flips in Yeast Iso-2-cytochrome c",\N
1439,"1439","1995-01-01",\N,"Two-Dimensional Magnetization Exchange Spectroscopy of Anabaena 7120 Ferredoxin. Nuclear Overhauser Effect and Electron Self Exchange Cross Peaks from Amino Acid Residues Surrounding the 2Fe-2S, Cluster",\N
1440,"1440","1995-01-01",\N,"Two-Dimensional Magnetization Exchange Spectroscopy of Anabaena 7120 Ferredoxin. Nuclear Overhauser Effect and Electron Self Exchange Cross Peaks from Amino Acid Residues Surrounding the 2Fe-2S, Cluster",\N
1441,"1441","1995-01-01",\N,"Two-Dimensional Magnetization Exchange Spectroscopy of Anabaena 7120 Ferredoxin. Nuclear Overhauser Effect and Electron Self Exchange Cross Peaks from Amino Acid Residues Surrounding the 2Fe-2S, Cluster",\N
1442,"1442","1995-01-01",\N,"2D 1H NMR Studies of Monomeric Insulin",\N
1443,"1443","1995-01-01",\N,"2D 1H NMR Studies of Monomeric Insulin",\N
1444,"1444","1995-01-01",\N,"2D 1H NMR Studies of Monomeric Insulin",\N
1445,"1445","1995-01-01",\N,"Studies of Synthetic Helical Peptides Using Circular Dichroism and Nuclear Magnetic Resonance",\N
1446,"1446","1995-01-01",\N,"Studies of Synthetic Helical Peptides Using Circular Dichroism and Nuclear Magnetic Resonance",\N
1447,"1447","1995-01-01",\N,"Solution Structure of the Basic Region from the Transcriptional Activator GCN4",\N
1448,"1448","1995-01-01",\N,"Solution Structure of the Basic Region from the Transcriptional Activator GCN4",\N
1449,"1449","1995-01-01",\N,"Solution Structure of the Basic Region from the Transcriptional Activator GCN4",\N
1450,"1450","1995-01-01",\N,"Solution Structure of the Basic Region from the Transcriptional Activator GCN4",\N
1451,"1451","1995-01-01",\N,"Solution Structure of the Basic Region from the Transcriptional Activator GCN4",\N
1452,"1452","1995-01-01",\N,"Solution Structure of the Basic Region from the Transcriptional Activator GCN4",\N
1453,"1453","1995-01-01",\N,"Solution Structure of the Basic Region from the Transcriptional Activator GCN4",\N
1454,"1454","1995-01-01",\N,"Solution Structure of the Basic Region from the Transcriptional Activator GCN4",\N
1455,"1455","1995-01-01",\N,"1H-NMR study of the mechanism of assembly and equilibrium heme orientation of sperm whale myoglobin reconstituted with protohemin type-isomers",\N
1457,"1457","1995-01-01",\N,"1H-NMR study of the mechanism of assembly and equilibrium heme orientation of sperm whale myoglobin reconstituted with protohemin type-isomers",\N
1459,"1459","1995-01-01",\N,"1H-NMR study of the mechanism of assembly and equilibrium heme orientation of sperm whale myoglobin reconstituted with protohemin type-isomers",\N
1461,"1461","1995-01-01",\N,"1H-NMR study of the mechanism of assembly and equilibrium heme orientation of sperm whale myoglobin reconstituted with protohemin type-isomers",\N
1463,"1463","1995-01-01",\N,"1H-NMR study of the mechanism of assembly and equilibrium heme orientation of sperm whale myoglobin reconstituted with protohemin type-isomers",\N
1465,"1465","1995-01-01",\N,"1H-NMR study of the mechanism of assembly and equilibrium heme orientation of sperm whale myoglobin reconstituted with protohemin type-isomers",\N
1467,"1467","1995-01-01",\N,"1H-NMR study of the mechanism of assembly and equilibrium heme orientation of sperm whale myoglobin reconstituted with protohemin type-isomers",\N
1469,"1469","1995-01-01",\N,"1H-NMR study of the mechanism of assembly and equilibrium heme orientation of sperm whale myoglobin reconstituted with protohemin type-isomers",\N
1471,"1471","1995-01-01",\N,"1H-NMR study of the mechanism of assembly and equilibrium heme orientation of sperm whale myoglobin reconstituted with protohemin type-isomers",\N
1474,"1474","1995-01-01",\N,"Sequence-specific 1H NMR Assignments and Structural Characterization of Bovine Seminal Fluid Protein PDC-109 Domain b",\N
1475,"1475","1995-01-01",\N,"Isotope-Edited NMR of Cyclosporin A Bound to Cyclophilin: Evidence for a Trans 9,10 Amide Bond",\N
1476,"1476","1995-01-01",\N,"1H NMR Structure Characterization of a Recombinant Kringle 2 Domain from Human Tissue-Type Plasminogen Activator",\N
1477,"1477","1995-01-01",\N,"1H NMR Structure Characterization of a Recombinant Kringle 2 Domain from Human Tissue-Type Plasminogen Activator",\N
1478,"1478","1995-01-01",\N,"Two-Dimensional 1H Nuclear Magnetic Resonance Study of AaH IT, an Anti-Insect Toxin from the Scorpion Androctonus australis Hector. Sequential Resonance Assignments and Folding of the Polypeptide Chain",\N
1479,"1479","1995-01-01",\N,"Secondary Structure of a Complement Control Protein Module by Two-Dimensional 1H NMR",\N
1480,"1480","1995-01-01",\N,"Secondary Structure of a Complement Control Protein Module by Two-Dimensional 1H NMR",\N
1481,"1481","1995-01-01",\N,"Two-Dimensional NMR and Structure Determination of Salmon Calcitonin in Methanol",\N
1482,"1482","1995-01-01",\N,"Two-Dimensional NMR and Structure Determination of Salmon Calcitonin in Methanol",\N
1483,"1483","1995-01-01",\N,"Microviridin: A Novel Tricyclic Depsipeptide from the Toxic Cyanobacterium Microcystis viridis",\N
1484,"1484","1995-01-01",\N,"Histidine 121 of Staphylococcal Nuclease. Correlation of the Hdelta2 1H NMR Assignment and Reinterpretation of the Role This Residue Plays in Conformational Heterogeneity of the Protein",\N
1485,"1485","1995-01-01",\N,"Histidine 121 of Staphylococcal Nuclease. Correlation of the Hdelta2 1H NMR Assignment and Reinterpretation of the Role This Residue Plays in Conformational Heterogeneity of the Protein",\N
1486,"1486","1995-01-01",\N,"A characterization of copper/zinc superoxide dismutase mutants at position 124",\N
1487,"1487","1995-01-01",\N,"A characterization of copper/zinc superoxide dismutase mutants at position 124",\N
1494,"1494","1995-01-01",\N,"Assignment of the 1H-NMR spectrum of a lac repressor headpiece-operator complex in H2O and identification of NOEs",\N
1495,"1495","1995-01-01",\N,"1H Assignments and Secondary Structure Determination of the Soybean Trypsin/Chymotrypsin Bowman-Birk Inhibitor",\N
1496,"1496","1995-01-01",\N,"ADR1a, a Zinc Finger Peptide, Exists in Two Folded Conformations",\N
1497,"1497","1995-01-01",\N,"ADR1a, a Zinc Finger Peptide, Exists in Two Folded Conformations",\N
1500,"1500","1995-01-01",\N,"Alternating Zinc Fingers in the Human Male Associated Protein ZFY: 2D NMR Structure of an Even Finger and Implications for \"Jumping-Linker\" DNA Recognition",\N
1503,"1503","1995-01-01",\N,"Solution conformation of endothelin, a potent vaso-constricting bicyclic peptide",\N
1514,"1514","1995-01-01",\N,"Structure Determination of Tolaasin, an Extracellular Lipodepsipeptide Produced by the Mushroom Pathogen Pseudomonas tolaasii Paine",\N
1515,"1515","1995-01-01",\N,"NMR and circular dichroic studies on the solution conformation of a synthetic peptide derived from the calmodulin-binding domain of Bordetella pertussis adenylate cyclase",\N
1516,"1516","1995-01-01",\N,"Three-dimensional correlated NMR study of Megasphaera elsdenii flavodoxin in the oxidized state",\N
1517,"1517","1995-01-01",\N,"Complete assignment of the 1H NMR spectrum and secondary structure of the DNA binding domain of GAL4",\N
1518,"1518","1995-01-01",\N,"Structure and Function of X-Pro Dipeptide Repeats in the TonB Proteins of Salmonella typhimurium and Escherichia coli",\N
1519,"1519","1995-01-01",\N,"Structure and Function of X-Pro Dipeptide Repeats in the TonB Proteins of Salmonella typhimurium and Escherichia coli",\N
1520,"1520","1995-01-01",\N,"Characterization of a Partially Denatured State of a Protein by Two-Dimensional NMR: Reduction of the Hydrophobic Interactions in Ubiquitin",\N
1538,"1538","1995-01-01",\N,"A 1H NMR Study of Human Calcitonin in Solution",\N
1539,"1539","1995-01-01",\N,"A 1H NMR Study of Human Calcitonin in Solution",\N
1541,"1541","1995-01-01",\N,"Analysis of the Methyl 1H-NMR Spectrum of Crambin, a Hydrophobic Protein",\N
1542,"1542","1995-01-01",\N,"Analysis of the Methyl 1H-NMR Spectrum of Crambin, a Hydrophobic Protein",\N
1543,"1543","1995-01-01",\N,"A 1H NMR Study of Human Calcitonin in Solution",\N
1544,"1544","1995-01-01",\N,"A 1H NMR Study of Human Calcitonin in Solution",\N
1545,"1545","1995-01-01",\N,"A 1H NMR Study of Human Calcitonin in Solution",\N
1546,"1546","1995-01-01",\N,"A 1H NMR Study of Human Calcitonin in Solution",\N
1551,"1551","1995-01-01",\N,"1H NMR Identification of a B-Sheet Structure and Description of Folding Topology in Putidaredoxin",\N
1552,"1552","1995-01-01",\N,"pH Dependence of the High-Resolution Proton Nuclear Magnetic Resonance Spectrum of the lac Repressor Headpiece",\N
1553,"1553","1995-01-01",\N,"Solution Structure of a Polypeptide Dimer Comprising the Fourth Ca+2-Binding Site of Troponin C by Nuclear Magnetic Resonance Spectroscopy",\N
1562,"1562","1995-01-01",\N,"Opioid Peptides in Micellar Systems: Conformational Analysis by CD and by One-Dimensional and Two-Dimensional 1H-NMR Spectroscopy",\N
1566,"1566","1995-01-01",\N,"Evidence for Two Interconverting Protein Isomers in the Methotrexate Complex of Dihydrofolate Reductase from Escherichia coli",\N
1567,"1567","1995-01-01",\N,"Evidence for Two Interconverting Protein Isomers in the Methotrexate Complex of Dihydrofolate Reductase from Escherichia coli",\N
1571,"1571","1995-01-01",\N,"1H NMR Study of the Solution Molecular and Electronic Structure of Escherichia coli Ferricytochrome b562: Evidence for S = 1/2 <=> S = 5/2 Spin Equilibrium for Intact His/Met Ligation",\N
1573,"1573","1995-01-01",\N,"1H NMR Study of the Solution Molecular and Electronic Structure of Escherichia coli Ferricytochrome b562: Evidence for S = 1/2 <=> S = 5/2 Spin Equilibrium for Intact His/Met Ligation",\N
1574,"1574","1995-01-01",\N,"Proton magnetic resonance characterization of phoratoxins and homologous proteins related to crambin",\N
1575,"1575","1995-01-01",\N,"Proton magnetic resonance characterization of phoratoxins and homologous proteins related to crambin",\N
1576,"1576","1995-01-01",\N,"Proton magnetic resonance characterization of phoratoxins and homologous proteins related to crambin",\N
1577,"1577","1995-01-01",\N,"Proton magnetic resonance characterization of phoratoxins and homologous proteins related to crambin",\N
1578,"1578","1995-01-01",\N,"Proton magnetic resonance characterization of phoratoxins and homologous proteins related to crambin",\N
1580,"1580","1995-01-01",\N,"Hydrogen-1, Carbon-13, Nitrogen-15 NMR Spectroscopy of Anabaena 7120 Flavodoxin: Assignment of beta-Sheet and Flavin Binding Site Resonances and Analysis of Protein-Flavin Interactions",\N
1581,"1581","1995-01-01",\N,"Deletion of the omega-loop in the Active Site of Staphylococcal Nuclease 2. Effects on Protein Structure and Dynamics",\N
1582,"1582","1995-01-01",\N,"Deletion of the omega-loop in the Active Site of Staphylococcal Nuclease 2. Effects on Protein Structure and Dynamics",\N
1583,"1583","1995-01-01",\N,"Deletion of the omega-loop in the Active Site of Staphylococcal Nuclease 2. Effects on Protein Structure and Dynamics",\N
1584,"1584","1995-01-01",\N,"Deletion of the omega-loop in the Active Site of Staphylococcal Nuclease 2. Effects on Protein Structure and Dynamics",\N
1585,"1585","1995-01-01",\N,"Proton Nuclear Magnetic Resonance Study of the B9(Asp)Mutant of Human Insulin Sequential Assignment and Secondary Structure",\N
1586,"1586","1995-01-01",\N,"Proton Nuclear Magnetic Resonance Study of the B9(Asp)Mutant of Human Insulin Sequential Assignment and Secondary Structure",\N
1587,"1587","1995-01-01",\N,"Proton Nuclear Magnetic Resonance Study of the B9(Asp)Mutant of Human Insulin Sequential Assignment and Secondary Structure",\N
1588,"1588","1995-01-01",\N,"Solution Phase Conformation Studies of the Prekallikrein Binding Domain of High Molecular Weight Kininogen",\N
1589,"1589","1995-01-01",\N,"Solution Phase Conformation Studies of the Prekallikrein Binding Domain of High Molecular Weight Kininogen",\N
1590,"1590","1995-01-01",\N,"A protein structural change in aglycosylated IgG3 correlates with loss of huFcgammaR1 and huFcgammaR111 binding and/or activation",\N
1591,"1591","1995-01-01",\N,"A protein structural change in aglycosylated IgG3 correlates with loss of huFcgammaR1 and huFcgammaR111 binding and/or activation",\N
1592,"1592","1995-01-01",\N,"NMR Studies of the MgATP Binding Site of Adenylate Kinase and of a 45-Residue Peptide Fragment of the Enzyme",\N
1616,"1616","1995-01-01",\N,"Isolation and 2D 1H NMR of the NH2-terminal 24 residues peptide fragment from dog serum albumin and its complexation with copper and nickel",\N
1620,"1620","1995-01-01",\N,"GAL4 transcription factor is not a \"zinc finger\" but forms a Zn(II)2Cys6 binuclear cluster",\N
1624,"1624","1995-01-01",\N,"Secondary structure of the phosphocarrier protein III(Glc), a signal-transducing protein from Escherichia coli, determined by heteronuclear three-dimensional NMR spectroscopy",\N
1632,"1632","1995-01-01",\N,"Comparative 2D NMR Studies of Human Insulin and Des-pentapeptide Insulin: Sequential Resonance Assignment and Implications for Proteins Dynamics and Receptor Recognition",\N
1633,"1633","1995-01-01",\N,"Comparative 2D NMR Studies of Human Insulin and Des-pentapeptide Insulin: Sequential Resonance Assignment and Implications for Proteins Dynamics and Receptor Recognition",\N
1634,"1634","1995-01-01",\N,"Triple-Resonance Multidimensional NMR Study of Calmodulin Complexed with the Binding Domain of Skeletal Muscle Myosin Light-Chain Kinase: Indication of a Conformational Change in the Central Helix",\N
1635,"1635","1995-01-01",\N,"Solution Conformation of a Peptide Fragment Representing a Proposed RNA-Binding Site of a Viral Coat Protein Studied by Two-Dimensional NMR",\N
1638,"1638","1995-01-01",\N,"Polypeptide-metal cluster connectivities in Cd(II) GAL4",\N
1639,"1639","1995-01-01",\N,"Sequential 1H NMR Assignments and Secondary Structure of an IgG-Binding Domain from Protein G",\N
1640,"1640","1995-01-01",\N,"High-Resolution Structure of an HIV Zinc Fingerlike Domain via a New NMR-Based Distance Geometry Approach",\N
1642,"1642","1995-01-01",\N,"Complete Assignment of the Noncarbonylic Carbon-13 Resonances of Tendamistat",\N
1643,"1643","1995-01-01",\N,"Solution Structure of Salmon Calcitonin",\N
1646,"1646","1995-01-01",\N,"A spectroscopic analysis of the Pro35-->Ala mutant of Rhodobacter capsulatus cytochrome c2. The strictly conserved Pro35 is not structurally essential.",\N
1647,"1647","1995-01-01",\N,"A spectroscopic analysis of the Pro35-->Ala mutant of Rhodobacter capsulatus cytochrome c2. The strictly conserved Pro35 is not structurally essential.",\N
1648,"1648","1995-01-01",\N,"Triple-Resonance Multidimensional NMR Study of Calmodulin Complexed with the Binding Domain of Skeletal Muscle Myosin Light-Chain Kinase: Indication of a Conformational Change in the Central Helix",\N
1649,"1649","1995-01-01",\N,"Polypeptide-metal cluster connectivities in Cd(II) GAL4",\N
1650,"1650","1995-01-01",\N,"Hydrophobic Clustering in Nonnative States of a Protein: Interpretation of Chemical Shifts in NMR Spectra of Denatured States of Lysozyme",\N
1651,"1651","1995-01-01",\N,"Hydrophobic Clustering in Nonnative States of a Protein: Interpretation of Chemical Shifts in NMR Spectra of Denatured States of Lysozyme",\N
1652,"1652","1995-01-01",\N,"Structural Determination of the Vasoactive Intestinal Peptide by Two-Dimensional 1H-NMR Spectroscopy",\N
1653,"1653","1995-01-01",\N,"Hydrophobic Clustering in Nonnative States of a Protein: Interpretation of Chemical Shifts in NMR Spectra of Denatured States of Lysozyme",\N
1654,"1654","1995-01-01",\N,"Determination of the structure of [Nle7]-endothelin by 1H NMR",\N
1655,"1655","1995-01-01",\N,"Determination of the structure of [Nle7]-endothelin by 1H NMR",\N
1656,"1656","1995-01-01",\N,"C-Terminal Retroviral-Type Zinc Finger Domain from the HIV-1 Nucleocapsid Protein Is Structurally Similar to the N-Terminal Zinc Finger Domain",\N
1657,"1657","1995-01-01",\N,"Assignments of Backbone 1H, 13C, 15N Resonances and Secondary Structure of Ribonuclease H from Escherichia coli by Heteronuclear Three-Dimensional NMR Spectroscopy",\N
1658,"1658","1995-01-01",\N,"Two-dimensional 1H, 15N-NMR investigation of uniformly 15N-labeled ribonuclease T1 (Complete assignment of 15N resonances)",\N
1660,"1660","1995-01-01",\N,"Proton nuclear magnetic resonance investigation of adrenodoxin (Assignment of aromatic resonances and evidence for a conformational similarity with ferredoxin from Spirulina platensis",\N
1661,"1661","1995-01-01",\N,"Proton nuclear magnetic resonance investigation of adrenodoxin (Assignment of aromatic resonances and evidence for a conformational similarity with ferredoxin from Spirulina platensis",\N
1662,"1662","1995-01-01",\N,"Proton nuclear magnetic resonance investigation of adrenodoxin (Assignment of aromatic resonances and evidence for a conformational similarity with ferredoxin from Spirulina platensis",\N
1663,"1663","1995-01-01",\N,"Polypeptide Backbone Resonance Assignments and Secondary Structure of Bacillus subtilis Enzyme III(glc) Determined by Two-Dimensional and Three-Dimensional Heteronuclear NMR Spectroscopy",\N
1664,"1664","1995-01-01",\N,"Tertiary Structure of Conotoxin GIIIA in Aqueous Solution",\N
1665,"1665","1995-01-01",\N,"Tertiary Structure of Conotoxin GIIIA in Aqueous Solution",\N
1666,"1666","1995-01-01",\N,"Investigation of the Solution Structure of the Human Parathyroid Hormone Fragment (1-34) by 1H NMR Spectroscopy, Distance Geometry, and Molecular Dynamics Calculations",\N
1669,"1669","1995-01-01",\N,"A structural study of calcium-binding equine lysozome by two-dimensional 1H-NMR",\N
1670,"1670","1995-01-01",\N,"A structural study of calcium-binding equine lysozome by two-dimensional 1H-NMR",\N
1672,"1672","1995-01-01",\N,"1H and 15N NMR Resonance Assignments and Preliminary Structural Characterization of Escherichia coli Apocytochrome b562",\N
1673,"1673","1995-01-01",\N,"1H and 15N Resonance Assignments of Oxidized Flavodoxin from Anacystis nidulans with 3D NMR",\N
1674,"1674","1995-01-01",\N,"Sequence-specific 1H-NMR Assignments and Identification of Slowly Exchanging Amide Protons in Murine Epidermal Growth Factor",\N
1675,"1675","1995-01-01",\N,"Solution Structure of Neuronal Bungarotoxin Determined by Two-Dimensional NMR Spectroscopy: Sequence-Specific Assignments, Secondary Structure, and Dimer Formation",\N
1676,"1676","1995-01-01",\N,"Mimicking the Membrane-Mediated Conformation of Dynorphin A-(1-13)-Peptide: Circular Dichroism and Nuclear Magnetic Resonance Studies in Methanolic Solution",\N
1677,"1677","1995-01-01",\N,"1H-NMR Assignments and Conformational Studies of Melanin Concentrating Hormone in Water Using Two-Dimensional NMR",\N
1692,"1692","1995-01-01",\N,"Comparison of Helix Stability in Wild-type and Mutant LamB Signal Sequences",\N
1693,"1693","1995-01-01",\N,"Comparison of Helix Stability in Wild-type and Mutant LamB Signal Sequences",\N
1696,"1696","1995-01-01",\N,"Complete 1H and 13C assignment of Lys and Leu sidechains of staphylococcal nuclease using HCCH-COSY and HCCH-TOCSY 3D NMR spectroscopy",\N
1697,"1697","1995-01-01",\N,"Conformations of neurotensin in solution and in membrane environments studied by 2D-NMR spectroscopy",\N
1698,"1698","1995-01-01",\N,"Conformations of neurotensin in solution and in membrane environments studied by 2D-NMR spectroscopy",\N
1699,"1699","1995-01-01",\N,"Conformations of neurotensin in solution and in membrane environments studied by 2D-NMR spectroscopy",\N
1700,"1700","1995-01-01",\N,"1H NMR Study of the Solution Structure of Sarafotoxin-S6b",\N
1702,"1702","1995-01-01",\N,"Positioning of a Spin-Labeled Substrate Analogue into the Structure of delta5-3-Ketosteroid Isomerase by Combined Kinetic, Magnetic Resonance, and X-ray Diffraction Methods",\N
1704,"1704","1995-01-01",\N,"Two-Dimensional NMR Studies of Staphylococcal Nuclease: Evidence for Conformational Heterogeneity from Hydrogen-1, Carbon-13, and Nitrogen-15 Spin System Assignments of the Aromatic Amino Acids in the Nuclease H124L-Thymidine 3',5'-Bisphosp",\N
1705,"1705","1995-01-01",\N,"Structure-function relationships in the polypeptide cardiac stimulant, anthopleurin-A (Effects of limited proteolysis by trypsin)",\N
1706,"1706","1995-01-01",\N,"Structure-function relationships in the polypeptide cardiac stimulant, anthopleurin-A (Effects of limited proteolysis by trypsin)",\N
1707,"1707","1995-01-01",\N,"Characterization of wild-type and mutant M13 gene V proteins by means of 1H-NMR",\N
1709,"1709","1995-01-01",\N,"Cell Adhesion Promoting Peptide GVKGDKGNPGWPGAP from the CollagenType IV Triple Helix: Cis/Trans Proline-Induced Multiple 1H NMR Conformations and Evidence for a KG/PG Multiple Turn Repeat Motif in the All-Trans Proline State",\N
1710,"1710","1995-01-01",\N,"Two-dimensional Proton-NMR studies on a hybrid peptide between cecropin A and melittin",\N
1712,"1712","1995-01-01",\N,"C-Terminal Structure and Mobility of Rabbit Skeletal Muscle Light Meromyosin As Studied by One- and Two-Dimensional 1H NMR Spectroscopy and X-ray Small-Angle Scattering",\N
1713,"1713","1995-01-01",\N,"C-Terminal Structure and Mobility of Rabbit Skeletal Muscle Light Meromyosin As Studied by One- and Two-Dimensional 1H NMR Spectroscopy and X-ray Small-Angle Scattering",\N
1719,"1719","1995-01-01",\N,"Proton Nuclear Magnetic Resonance as a Probe of Differences in Structure between the C102T and F82S,C102T Variants of Iso-1-cytochrome c from the Yeast Saccharomyces cerevisiae",\N
1720,"1720","1995-01-01",\N,"Proton Nuclear Magnetic Resonance as a Probe of Differences in Structure between the C102T and F82S,C102T Variants of Iso-1-cytochrome c from the Yeast Saccharomyces cerevisiae",\N
1722,"1722","1995-01-01",\N,"Cell Adhesion Promoting Peptide GVKGDKGNPGWPGAP from the CollagenType IV Triple Helix: Cis/Trans Proline-Induced Multiple 1H NMR Conformations and Evidence for a KG/PG Multiple Turn Repeat Motif in the All-Trans Proline State",\N
1723,"1723","1995-01-01",\N,"Cell Adhesion Promoting Peptide GVKGDKGNPGWPGAP from the CollagenType IV Triple Helix: Cis/Trans Proline-Induced Multiple 1H NMR Conformations and Evidence for a KG/PG Multiple Turn Repeat Motif in the All-Trans Proline State",\N
1724,"1724","1995-01-01",\N,"Cell Adhesion Promoting Peptide GVKGDKGNPGWPGAP from the CollagenType IV Triple Helix: Cis/Trans Proline-Induced Multiple 1H NMR Conformations and Evidence for a KG/PG Multiple Turn Repeat Motif in the All-Trans Proline State",\N
1725,"1725","1995-01-01",\N,"Cell Adhesion Promoting Peptide GVKGDKGNPGWPGAP from the CollagenType IV Triple Helix: Cis/Trans Proline-Induced Multiple 1H NMR Conformations and Evidence for a KG/PG Multiple Turn Repeat Motif in the All-Trans Proline State",\N
1726,"1726","1995-01-01",\N,"Cell Adhesion Promoting Peptide GVKGDKGNPGWPGAP from the CollagenType IV Triple Helix: Cis/Trans Proline-Induced Multiple 1H NMR Conformations and Evidence for a KG/PG Multiple Turn Repeat Motif in the All-Trans Proline State",\N
1727,"1727","1995-01-01",\N,"Nuclear-magnetic-resonance studies on the conformation of membrane-bound alpha-mating factor (Transferred nuclear Overhauser effect analysis)",\N
1728,"1728","1995-01-01",\N,"Solution conformation of endothelin determined by means of 1H-NMR spectroscopy and distance geometry calculations",\N
1729,"1729","1995-01-01",\N,"Complete Sequence-Specific 1H Nuclear Magnetic Resonance Assignments for Mouse Epidermal Growth Factor",\N
1734,"1734","1995-01-01",\N,"Heteronuclear Multiple-Quantum Coherence NMR Spectroscopy of Paramagnetic Heme and Cytochrome c-551",\N
1736,"1736","1995-01-01",\N,"Heteronuclear Multiple-Quantum Coherence NMR Spectroscopy of Paramagnetic Heme and Cytochrome c-551",\N
1739,"1739","1995-01-01",\N,"Properties of aromatic residues in ferricytochrome c3 of Desulfovibrio vulgaris miyazaki f studied by 1H NMR",\N
1743,"1743","1995-01-01",\N,"Assignments of 1H-15N magnetic resonances and identification of secondary structure elements of the lambda-cro repressor",\N
1744,"1744","1995-01-01",\N,"Assignments of 1H-15N magnetic resonances and identification of secondary structure elements of the lambda-cro repressor",\N
1745,"1745","1995-01-01",\N,"Alternating Zinc Fingers in the Human Male Associated Protein ZFY: Refinement of the NMR Structure of an Even Finger by Selective Deuteration Labeling and Implications for DNA Recognition",\N
1751,"1751","1995-01-01",\N,"NMR study of Galeorhinus japonicus myoglobin (1H-NMR study of molecular structure of the heme cavity)",\N
1752,"1752","1995-01-01",\N,"NMR study of Galeorhinus japonicus myoglobin (1H-NMR study of molecular structure of the heme cavity)",\N
1756,"1756","1995-01-01",\N,"Sequence-specific 1H-NMR assignments and secondary structure of the lipoyl domain of the Bacillus stearothermophilus pyruvate dehydrogenase multienzyme complex",\N
1757,"1757","1995-01-01",\N,"1H NMR and Circular Dichroism Studies of the N-Terminal Domain of Cyclic GMP Dependent Protein Kinase: A Leucine/Isoleucine Zipper",\N
1760,"1760","1995-01-01",\N,"Heteronuclear 2D NMR Studies of an Engineered Insulin Monomer: Assignment and Characterization of the Receptor-Binding Surface by Selective 2H and 13C Labeling with Application to Protein Design",\N
1761,"1761","1995-01-01",\N,"Heteronuclear 2D NMR Studies of an Engineered Insulin Monomer: Assignment and Characterization of the Receptor-Binding Surface by Selective 2H and 13C Labeling with Application to Protein Design",\N
1762,"1762","1995-01-01",\N,"Heteronuclear 2D NMR Studies of an Engineered Insulin Monomer: Assignment and Characterization of the Receptor-Binding Surface by Selective 2H and 13C Labeling with Application to Protein Design",\N
1766,"1766","1995-01-01",\N,"Two and Three-Dimensional Proton NMR Studies of Apo-Neocarzinostatin",\N
1767,"1767","1995-01-01",\N,"The conformation of porcine-brain natriuretic peptide by two-dimensional NMR spectroscopy",\N
1769,"1769","1995-01-01",\N,"Identification of resonances from an oncogenic activating locus of human N-Ras-encoded p21 protein using isotope-edited NMR",\N
1770,"1770","1995-01-01",\N,"1H-NMR Study of the Intramolecular Interaction of a Substrate Analogue Covalently Attached to Aspartic Acid-101 in Lysozyme",\N
1771,"1771","1995-01-01",\N,"1H-NMR Study of the Intramolecular Interaction of a Substrate Analogue Covalently Attached to Aspartic Acid-101 in Lysozyme",\N
1772,"1772","1995-01-01",\N,"1H-NMR Study of the Intramolecular Interaction of a Substrate Analogue Covalently Attached to Aspartic Acid-101 in Lysozyme",\N
1773,"1773","1995-01-01",\N,"1H-NMR Study of the Intramolecular Interaction of a Substrate Analogue Covalently Attached to Aspartic Acid-101 in Lysozyme",\N
1775,"1775","1995-01-01",\N,"Proton-NMR studies of the effects of ionic strength and pH on the hyperfine-shifted resonances and phenylalanine-82 environment of three species of mitochondrial ferricytochrome c",\N
1777,"1777","1995-01-01",\N,"Proton-NMR studies of the effects of ionic strength and pH on the hyperfine-shifted resonances and phenylalanine-82 environment of three species of mitochondrial ferricytochrome c",\N
1779,"1779","1995-01-01",\N,"Proton-NMR studies of the effects of ionic strength and pH on the hyperfine-shifted resonances and phenylalanine-82 environment of three species of mitochondrial ferricytochrome c",\N
1781,"1781","1995-01-01",\N,"Proton-NMR studies of the effects of ionic strength and pH on the hyperfine-shifted resonances and phenylalanine-82 environment of three species of mitochondrial ferricytochrome c",\N
1783,"1783","1995-01-01",\N,"Proton-NMR studies of the effects of ionic strength and pH on the hyperfine-shifted resonances and phenylalanine-82 environment of three species of mitochondrial ferricytochrome c",\N
1785,"1785","1995-01-01",\N,"Proton-NMR studies of the effects of ionic strength and pH on the hyperfine-shifted resonances and phenylalanine-82 environment of three species of mitochondrial ferricytochrome c",\N
1787,"1787","1995-01-01",\N,"Proton-NMR studies of the effects of ionic strength and pH on the hyperfine-shifted resonances and phenylalanine-82 environment of three species of mitochondrial ferricytochrome c",\N
1789,"1789","1995-01-01",\N,"Proton-NMR studies of the effects of ionic strength and pH on the hyperfine-shifted resonances and phenylalanine-82 environment of three species of mitochondrial ferricytochrome c",\N
1791,"1791","1995-01-01",\N,"Proton-NMR studies of the effects of ionic strength and pH on the hyperfine-shifted resonances and phenylalanine-82 environment of three species of mitochondrial ferricytochrome c",\N
1793,"1793","1995-01-01",\N,"Proton-NMR studies of the effects of ionic strength and pH on the hyperfine-shifted resonances and phenylalanine-82 environment of three species of mitochondrial ferricytochrome c",\N
1795,"1795","1995-01-01",\N,"Proton-NMR studies of the effects of ionic strength and pH on the hyperfine-shifted resonances and phenylalanine-82 environment of three species of mitochondrial ferricytochrome c",\N
1797,"1797","1995-01-01",\N,"Proton-NMR studies of the effects of ionic strength and pH on the hyperfine-shifted resonances and phenylalanine-82 environment of three species of mitochondrial ferricytochrome c",\N
1798,"1798","1995-01-01",\N,"Effect of inhibitors on conformational changes in hen lysozyme around thermal transition point in solution and solid state",\N
1799,"1799","1995-01-01",\N,"Effect of inhibitors on conformational changes in hen lysozyme around thermal transition point in solution and solid state",\N
1800,"1800","1995-01-01",\N,"Effect of inhibitors on conformational changes in hen lysozyme around thermal transition point in solution and solid state",\N
1801,"1801","1995-01-01",\N,"Effect of inhibitors on conformational changes in hen lysozyme around thermal transition point in solution and solid state",\N
1802,"1802","1995-01-01",\N,"Effect of inhibitors on conformational changes in hen lysozyme around thermal transition point in solution and solid state",\N
1803,"1803","1995-01-01",\N,"Effect of inhibitors on conformational changes in hen lysozyme around thermal transition point in solution and solid state",\N
1808,"1808","1995-01-01",\N,"2D NMR of paramagnetic metalloenzymes: Cyanide-inhibited horseradish peroxidase",\N
1811,"1811","1995-01-01",\N,"Conformation of sarafotoxin-6b in aqueous solution determined by NMR spectroscopy and distance geometry",\N
1812,"1812","1995-01-01",\N,"Assignment of the 15N NMR spectra of reduced and oxidized Escherichia coli thioredoxin",\N
1813,"1813","1995-01-01",\N,"Assignment of the 15N NMR spectra of reduced and oxidized Escherichia coli thioredoxin",\N
1814,"1814","1995-01-01",\N,"Calorimetric and Spectroscopic Examination of the Solution Phase Structures of Prekallikrein Binding Domain Peptides of High Molecular Weight Kininogen",\N
1815,"1815","1995-01-01",\N,"Calorimetric and Spectroscopic Examination of the Solution Phase Structures of Prekallikrein Binding Domain Peptides of High Molecular Weight Kininogen",\N
1816,"1816","1995-01-01",\N,"Tendamistat (12-26) fragment (NMR characterization of isolated Beta-turn folding intermediates)",\N
1817,"1817","1995-01-01",\N,"The Solution Conformation of Tubulin-beta(422-434)-NH2 and Its Nac-DATADEQG-NH2 Fragment Based on NMR",\N
1819,"1819","1995-01-01",\N,"Interaction of Sulphate and Chloride with Cobalt(II)-Carbonic Anhydrase",\N
1820,"1820","1995-01-01",\N,"Interaction of Sulphate and Chloride with Cobalt(II)-Carbonic Anhydrase",\N
1821,"1821","1995-01-01",\N,"Interaction of Sulphate and Chloride with Cobalt(II)-Carbonic Anhydrase",\N
1822,"1822","1995-01-01",\N,"Interaction of Sulphate and Chloride with Cobalt(II)-Carbonic Anhydrase",\N
1825,"1825","1995-01-01",\N,"Anantin-A peptide antagonist of the atrial natriuretic factor(ANF) II. Determination of the primary sequence by NMR on the basis of proton assignments",\N
1826,"1826","1995-01-01",\N,"Anantin-A peptide antagonist of the atrial natriuretic factor(ANF) II. Determination of the primary sequence by NMR on the basis of proton assignments",\N
1839,"1839","1995-01-01",\N,"Proton NMR Assignments of Heme Contacts and Catalytically Implicated Amino Acids in Cyanide-Ligated Cytochrome c Peroxidase Determined from One- and Two-Dimensional Nuclear Overhauser Effects",\N
1841,"1841","1995-01-01",\N,"Proton Hyperfine Resonance Assignments in Cyanide-ligated Cytochrome c Peroxidase Using the Nuclear Overhauser Effect",\N
1843,"1843","1995-01-01",\N,"NMR analysis of site-specific mutants of yeast phosphoglycerate kinase An investigation of the triose-binding site",\N
1844,"1844","1995-01-01",\N,"NMR analysis of site-specific mutants of yeast phosphoglycerate kinase An investigation of the triose-binding site",\N
1845,"1845","1995-01-01",\N,"NMR analysis of site-specific mutants of yeast phosphoglycerate kinase An investigation of the triose-binding site",\N
1846,"1846","1995-01-01",\N,"NMR analysis of site-specific mutants of yeast phosphoglycerate kinase An investigation of the triose-binding site",\N
1851,"1851","1995-01-01",\N,"Conformational and Receptor Binding Properties of Human EGF and TGF-alpha Second Loop Fragments",\N
1854,"1854","1995-01-01",\N,"Reductive cleavage and regeneration of the disulfide bonds in Streptomyces subtilisin inhibitor (SSI) as studied by the carbonyl 13C NMR resonances of cysteinyl residues",\N
1855,"1855","1995-01-01",\N,"Reductive cleavage and regeneration of the disulfide bonds in Streptomyces subtilisin inhibitor (SSI) as studied by the carbonyl 13C NMR resonances of cysteinyl residues",\N
1856,"1856","1995-01-01",\N,"Reductive cleavage and regeneration of the disulfide bonds in Streptomyces subtilisin inhibitor (SSI) as studied by the carbonyl 13C NMR resonances of cysteinyl residues",\N
1857,"1857","1995-01-01",\N,"Reductive cleavage and regeneration of the disulfide bonds in Streptomyces subtilisin inhibitor (SSI) as studied by the carbonyl 13C NMR resonances of cysteinyl residues",\N
1858,"1858","1995-01-01",\N,"Reductive cleavage and regeneration of the disulfide bonds in Streptomyces subtilisin inhibitor (SSI) as studied by the carbonyl 13C NMR resonances of cysteinyl residues",\N
1859,"1859","1995-01-01",\N,"Reductive cleavage and regeneration of the disulfide bonds in Streptomyces subtilisin inhibitor (SSI) as studied by the carbonyl 13C NMR resonances of cysteinyl residues",\N
1865,"1865","1995-01-01",\N,"Studies of Individual Carbon Sites of Hen Egg White Lysozyme by Natural Abundance Carbon 13 Nuclear Magnetic Resonance Spectroscopy",\N
1866,"1866","1995-01-01",\N,"Proton resonance assignments for Pseudomonas aeruginosa ferrocytochrome c-551",\N
1867,"1867","1995-01-01",\N,"The Conformation of Endothelin-1 in Aqueous Solution: NMR-Derived Constraints Combined with Distance Geometry and Molecular Dynamics Calculations",\N
1869,"1869","1995-01-01",\N,"Sequence specific assignment of the proton nuclear magnetic resonance spectrum of barley serine proteinase inhibitor 2",\N
1870,"1870","1995-01-01",\N,"Sequence specific assignment of the proton nuclear magnetic resonance spectrum of barley serine proteinase inhibitor 2",\N
1871,"1871","1995-01-01",\N,"Sequence specific assignment of the proton nuclear magnetic resonance spectrum of barley serine proteinase inhibitor 2",\N
1872,"1872","1995-01-01",\N,"Sequence specific assignment of the proton nuclear magnetic resonance spectrum of barley serine proteinase inhibitor 2",\N
1874,"1874","1995-01-01",\N,"Solution Studies of Staphylococcal Nuclease H124L. 2. 1H, 13C, and 15N Chemical Shift Assignments for the Unligated Enzyme and Analysis of Chemical Shift Changes That Accompany Formation of the Nuclease-Thymidine 3',5'-Bisphosphate-Calcium",\N
1875,"1875","1995-01-01",\N,"Solution Studies of Staphylococcal Nuclease H124L. 2. 1H, 13C, and 15N Chemical Shift Assignments for the Unligated Enzyme and Analysis of Chemical Shift Changes That Accompany Formation of the Nuclease-Thymidine 3',5'-Bisphosphate-Calcium",\N
1876,"1876","1995-01-01",\N,"Solution Studies of Staphylococcal Nuclease H124L. 2. 1H, 13C, and 15N Chemical Shift Assignments for the Unligated Enzyme and Analysis of Chemical Shift Changes That Accompany Formation of the Nuclease-Thymidine 3',5'-Bisphosphate-Calcium",\N
1877,"1877","1995-01-01",\N,"Solution Studies of Staphylococcal Nuclease H124L. 2. 1H, 13C, and 15N Chemical Shift Assignments for the Unligated Enzyme and Analysis of Chemical Shift Changes That Accompany Formation of the Nuclease-Thymidine 3',5'-Bisphosphate-Calcium",\N
1878,"1878","1995-01-01",\N,"Solution Studies of Staphylococcal Nuclease H124L. 2. 1H, 13C, and 15N Chemical Shift Assignments for the Unligated Enzyme and Analysis of Chemical Shift Changes That Accompany Formation of the Nuclease-Thymidine 3',5'-Bisphosphate-Calcium",\N
1881,"1881","1995-01-01",\N,"Hydrophobic Clustering in Nonnative States of a Protein: Interpretation of Chemical Shifts in NMR Spectra of Denatured States of Lysozyme",\N
1882,"1882","1995-01-01",\N,"Hydrophobic Clustering in Nonnative States of a Protein: Interpretation of Chemical Shifts in NMR Spectra of Denatured States of Lysozyme",\N
1883,"1883","1995-01-01",\N,"Hydrophobic Clustering in Nonnative States of a Protein: Interpretation of Chemical Shifts in NMR Spectra of Denatured States of Lysozyme",\N
1884,"1884","1995-01-01",\N,"Hydrophobic Clustering in Nonnative States of a Protein: Interpretation of Chemical Shifts in NMR Spectra of Denatured States of Lysozyme",\N
1885,"1885","1995-01-01",\N,"Solution Conformational Preferences of Immunogenic Peptides Derived from the Principal Neutralizing Determinant of the HIV-1 Envelope Glycoprotein gp120",\N
1886,"1886","1995-01-01",\N,"Solution Conformational Preferences of Immunogenic Peptides Derived from the Principal Neutralizing Determinant of the HIV-1 Envelope Glycoprotein gp120",\N
1887,"1887","1995-01-01",\N,"Solution Conformational Preferences of Immunogenic Peptides Derived from the Principal Neutralizing Determinant of the HIV-1 Envelope Glycoprotein gp120",\N
1889,"1889","1995-01-01",\N,"Proton Homonuclear Correlated Spectroscopy as an Assignment Tool for Hyperfine-Shifted Resonances in Medium-Sized Paramagnetic Proteins: Cyanide-Ligated Yeast Cytochrome c Peroxidase as an Example",\N
1891,"1891","1995-01-01",\N,"Nuclear Magnetic Resonance Study on the Structure and Interaction of Cyclic AMP Receptor Protein and Its Mutants: A Deuterium-Labeling and Photo-CIDNP Study",\N
1892,"1892","1995-01-01",\N,"Nuclear Magnetic Resonance Study on the Structure and Interaction of Cyclic AMP Receptor Protein and Its Mutants: A Deuterium-Labeling and Photo-CIDNP Study",\N
1893,"1893","1995-01-01",\N,"Conformations of neurotensin in solution and in membrane environments studied by 2D-NMR spectroscopy",\N
1895,"1895","1995-01-01",\N,"A Nuclear Magnetic Resonance Study on the Cyclic AMP Receptor Protein (CRP): Assignments of the NH Protons of Histidine and Tryptophan Residues and the Effect of Binding of cAMP to CRP",\N
1911,"1911","1995-01-01",\N,"Alternating Zinc Fingers in the Human Male-Associated Protein ZFY: HX3H and HX4H Motifs Encode a Local Structural Switch",\N
1917,"1917","1995-01-01",\N,"Three-Dimensional Structure of Potato Carboxypeptidase Inhibitor in Solution. A Study Using Nuclear Magnetic Resonance, Distance Geometry, and Restrained Molecular Dynamics",\N
1918,"1918","1995-01-01",\N,"Three-Dimensional Structure of Potato Carboxypeptidase Inhibitor in Solution. A Study Using Nuclear Magnetic Resonance, Distance Geometry, and Restrained Molecular Dynamics",\N
1919,"1919","1995-01-01",\N,"Two-dimensional 1H-NMR studies of phospholipase-A2-inhibitor complexes bound to a micellar lipid-water interface",\N
1920,"1920","1995-01-01",\N,"Two-dimensional 1H-NMR studies of phospholipase-A2-inhibitor complexes bound to a micellar lipid-water interface",\N
1921,"1921","1995-01-01",\N,"Two-dimensional 1H-NMR studies of phospholipase-A2-inhibitor complexes bound to a micellar lipid-water interface",\N
1968,"1968","1995-01-01",\N,"Location of an alpha-Helix in Fragment 96-133 from Bovine Somatotropin by 1H NMR Spectroscopy",\N
1975,"1975","1995-01-01",\N,"N.m.r. study of conformational changes in lysozyme around the thermal transition point",\N
1977,"1977","1995-01-01",\N,"N.m.r. study of conformational changes in lysozyme around the thermal transition point",\N
1991,"1991","1995-01-01",\N,"Determinants of Protein Hyperthermostability: Purification and Amino Acid Sequence of Rubredoxin from the Hyperthermophilic Archaebacterium Pyrococcus furiosus and Secondary Structure of the Zinc Adduct by NMR",\N
1995,"1995","1995-01-01",\N,"NMR Study of the Phosphate-Binding Elements of Escherichia coli Elongation Factor Tu Catalytic Domain",\N
1996,"1996","1995-01-01",\N,"NMR Study of the Phosphate-Binding Elements of Escherichia coli Elongation Factor Tu Catalytic Domain",\N
1997,"1997","1995-01-01",\N,"1H NMR and CD Secondary Structure Analysis of Cell Adhesion Promoting Peptide F-9 from Laminin",\N
1998,"1998","1995-01-01",\N,"Conformational studies on a peptide fragment representing the RNA-binding N-terminus of a viral coat protein using circular dichroism and NMR spectroscopy",\N
1999,"1999","1995-01-01",\N,"Conformational studies on a peptide fragment representing the RNA-binding N-terminus of a viral coat protein using circular dichroism and NMR spectroscopy",\N
2000,"2000","1995-01-01",\N,"Conformational studies on a peptide fragment representing the RNA-binding N-terminus of a viral coat protein using circular dichroism and NMR spectroscopy",\N
2001,"2001","1995-01-01",\N,"Conformational studies on a peptide fragment representing the RNA-binding N-terminus of a viral coat protein using circular dichroism and NMR spectroscopy",\N
2002,"2002","1995-01-01",\N,"Conformational studies on a peptide fragment representing the RNA-binding N-terminus of a viral coat protein using circular dichroism and NMR spectroscopy",\N
2003,"2003","1995-01-01",\N,"Conformational studies on a peptide fragment representing the RNA-binding N-terminus of a viral coat protein using circular dichroism and NMR spectroscopy",\N
2006,"2006","1995-01-01",\N,"Assignment of proton resonances in the NMR spectrum of carbonmonoxy hemoglobin beta subunit tetramers",\N
2012,"2012","1995-01-01",\N,"Sequential 1H Assignment and Secondary Structure Determination of Salmon Calcitonin in Solution",\N
2013,"2013","1995-01-01",\N,"Structure of the Propeptide of Prothrombin Containing the gamma-Carboxylation Recognition Site Determined by Two-Dimensional NMR Spectroscopy",\N
2014,"2014","1995-01-01",\N,"Structure of the Propeptide of Prothrombin Containing the gamma-Carboxylation Recognition Site Determined by Two-Dimensional NMR Spectroscopy",\N
2024,"2024","1995-01-01",\N,"Sequential NMR Resonance Assignment and Structure Determination of the Kunitz-Type Inhibitor Domain of the Alzheimer's B-Amyloid Precursor Protein",\N
2030,"2030","1995-01-01",\N,"Two-Dimensional 1H NMR Studies on HPr Protein from Staphylococcus aureus: Complete Sequential Assignments and Secondary Structure",\N
2031,"2031","1995-01-01",\N,"Secondary Structure and Topology of Human Interleukin 4 in Solution",\N
2038,"2038","1995-01-01",\N,"NMR Study of the Active Site of Resting State and Cyanide-inhibited Lignin Peroxidase from Phanerochaete chrysosporium (Comparison with horseradish peroxidase)",\N
2039,"2039","1995-01-01",\N,"Sequence-specific 1H-NMR assignment and secondary structure of the Tyr41->His mutant of the single-stranded DNA binding protein, gene V protein, encoded by the filamentous bacteriophage M13",\N
2040,"2040","1995-01-01",\N,"Determination of the orientations of tryptophan analogues bound to the trp repressor and the relationship to activation",\N
2042,"2042","1995-01-01",\N,"Determination of the orientations of tryptophan analogues bound to the trp repressor and the relationship to activation",\N
2043,"2043","1995-01-01",\N,"Determination of the orientations of tryptophan analogues bound to the trp repressor and the relationship to activation",\N
2047,"2047","1995-01-01",\N,"Solution Conformation of Salmon Calcitonin in Sodium Dodecyl Sulfate Micelles As Determined by Two-Dimensional NMR and Distance Geometry Calculations",\N
2048,"2048","1995-01-01",\N,"Solution Conformation of Salmon Calcitonin in Sodium Dodecyl Sulfate Micelles As Determined by Two-Dimensional NMR and Distance Geometry Calculations",\N
2049,"2049","1995-01-01",\N,"The Secondary Structure in Solution of Acyl-Coenzyme A Binding Protein from Bovine Liver Using 1H Nuclear Magnetic Resonance Spectroscopy",\N
2050,"2050","1995-01-01",\N,"The Secondary Structure in Solution of Acyl-Coenzyme A Binding Protein from Bovine Liver Using 1H Nuclear Magnetic Resonance Spectroscopy",\N
2051,"2051","1995-01-01",\N,"Structure of the Binuclear Metal-Binding Site in the GAL4 Transcription Factor",\N
2052,"2052","1995-01-01",\N,"Structure of the Binuclear Metal-Binding Site in the GAL4 Transcription Factor",\N
2053,"2053","1995-01-01",\N,"Structure of the Binuclear Metal-Binding Site in the GAL4 Transcription Factor",\N
2059,"2059","1995-01-01",\N,"Assignment of the 600-MHz 1H-NMR spectrum of amicyanin from Thiobacillus versutus by two-dimensional NMR methods provides information on secondary structure",\N
2060,"2060","1995-01-01",\N,"Reexamination of the Secondary and Tertiary Structure of Histidine-Containing Protein from Escherichia coli by Homonuclear and Heteronuclear NMR Spectroscopy",\N
2061,"2061","1995-01-01",\N,"Proton NMR Assignments and Secondary Structure of the Snake Venom Protein Echistatin",\N
2062,"2062","1995-01-01",\N,"Periodicity of Amide Proton Exchange Rates in a Coiled-Coil Leucine Zipper Peptide",\N
2063,"2063","1995-01-01",\N,"High-resolution Solution Structure of Reduced French Bean Plastocyanin and Comparison with the Crystal Structure of Poplar Plastocyanin",\N
2065,"2065","1995-01-01",\N,"Two- and Three-Dimensional 1H NMR Studies of a Wheat Phospholipid Transfer Protein: Sequential Resonance Assignments and Secondary Structure",\N
2066,"2066","1995-01-01",\N,"Characterization of Phosphate Binding in the Active Site of Barnase by Site-Directed Mutagenesis and NMR",\N
2067,"2067","1995-01-01",\N,"Characterization of Phosphate Binding in the Active Site of Barnase by Site-Directed Mutagenesis and NMR",\N
2068,"2068","1995-01-01",\N,"Characterization of Phosphate Binding in the Active Site of Barnase by Site-Directed Mutagenesis and NMR",\N
2069,"2069","1995-01-01",\N,"Characterization of Phosphate Binding in the Active Site of Barnase by Site-Directed Mutagenesis and NMR",\N
2070,"2070","1995-01-01",\N,"Characterization of Phosphate Binding in the Active Site of Barnase by Site-Directed Mutagenesis and NMR",\N
2071,"2071","1995-01-01",\N,"Characterization of Phosphate Binding in the Active Site of Barnase by Site-Directed Mutagenesis and NMR",\N
2074,"2074","1995-01-01",\N,"Determination of the orientations of tryptophan analogues bound to the trp repressor and the relationship to activation",\N
2075,"2075","1995-01-01",\N,"Structure-Function Relationships in Human Epidermal Growth Factor Studied by Site-Directed Mutagenesis and 1H NMR",\N
2076,"2076","1995-01-01",\N,"Structure-Function Relationships in Human Epidermal Growth Factor Studied by Site-Directed Mutagenesis and 1H NMR",\N
2077,"2077","1995-01-01",\N,"Structure-Function Relationships in Human Epidermal Growth Factor Studied by Site-Directed Mutagenesis and 1H NMR",\N
2078,"2078","1995-01-01",\N,"Structure-Function Relationships in Human Epidermal Growth Factor Studied by Site-Directed Mutagenesis and 1H NMR",\N
2113,"2113","1995-01-01",\N,"The solution structures of Escherichia coli trp repressor and trp aporepressor at an intermediate resolution",\N
2114,"2114","1995-01-01",\N,"The solution structures of Escherichia coli trp repressor and trp aporepressor at an intermediate resolution",\N
2115,"2115","1995-01-01",\N,"The solution structures of Escherichia coli trp repressor and trp aporepressor at an intermediate resolution",\N
2116,"2116","1995-01-01",\N,"Interaction of Troponin I and Troponin C (Use of the Two-dimensional Nuclear Magnetic Resonance Transferred Nuclear Overhauser Effect to Determine the Structure of the Inhibitory Troponin I Peptide when Bound to Skeletal Troponin C)",\N
2117,"2117","1995-01-01",\N,"Interaction of Troponin I and Troponin C (Use of the Two-dimensional Nuclear Magnetic Resonance Transferred Nuclear Overhauser Effect to Determine the Structure of the Inhibitory Troponin I Peptide when Bound to Skeletal Troponin C)",\N
2118,"2118","1995-01-01",\N,"Structural studies on the [But-Cys18](19-37)-fragment of human beta-calcitonin-gene-related peptide",\N
2151,"2151","1995-01-01",\N,"Sequence-specific 1H n.m.r. Assignments and Determination of the Three-dimensional Structure of Reduced Escherichia coli Glutaredoxin",\N
2169,"2169","1995-01-01",\N,"Two-dimensional 1H nuclear magnetic resonance study of the (5-55) single-disulphide folding intermediate of bovine pancreatic trypsin inhibitor",\N
2173,"2173","1995-01-01",\N,"Determination of the orientations of tryptophan analogues bound to the trp repressor and the relationship to activation",\N
2192,"2192","1995-01-01",\N,"Solution Structure of the 45-Residue MgATP-Binding Peptide of Adenylate Kinase As Examined by 2-D NMR, FTIR, and CD Spectroscopy",\N
2193,"2193","1995-01-01",\N,"Solution Structure of the 45-Residue MgATP-Binding Peptide of Adenylate Kinase As Examined by 2-D NMR, FTIR, and CD Spectroscopy",\N
2196,"2196","1995-01-01",\N,"Sequence Specific Assignments in the 1H NMR Spectrum of the Human Inflammatory Protein C5a",\N
2197,"2197","1995-01-01",\N,"Solution Conformation of a Synthetic Fragment of Human Pituitary Growth Hormone. Two-Dimensional NMR of an alpha-Helical Dimer",\N
2198,"2198","1995-01-01",\N,"1H NMR Studies of Plastocyanin from Scenedesmus obliquus: Complete Sequence-Specific Assignment, Secondary Structure Analysis, and Global Fold",\N
2199,"2199","1995-01-01",\N,"Solution Structure of an Analogue of Vasoactive Intestinal Peptide As Determined by Two-Dimensional NMR and Circular Dichroism Spectroscopies and Constrained Molecular Dynamics",\N
2200,"2200","1995-01-01",\N,"Solution Structure of an Analogue of Vasoactive Intestinal Peptide As Determined by Two-Dimensional NMR and Circular Dichroism Spectroscopies and Constrained Molecular Dynamics",\N
2201,"2201","1995-01-01",\N,"Solution Structure of Murine Epidermal Growth Factor Determined by NMR Spectroscopy and Refined by Energy Minimization with Restraints",\N
2202,"2202","1995-01-01",\N,"1H and 15N NMR Characterization of Free and Bound States of an Amphiphilic Peptide Interacting with Calmodulin",\N
2203,"2203","1995-01-01",\N,"1H and 15N NMR Characterization of Free and Bound States of an Amphiphilic Peptide Interacting with Calmodulin",\N
2204,"2204","1995-01-01",\N,"The secondary structure of echistatin from 1H-NMR, circular-dichroism and Raman spectroscopy",\N
2205,"2205","1995-01-01",\N,"1H NMR studies of echistatin in solution Sequential resonance assignments and secondary structure",\N
2206,"2206","1995-01-01",\N,"Nuclear magnetic resonance studies of the snake toxin echistatin 1H resonance assignments and secondary structure",\N
2207,"2207","1995-01-01",\N,"Nuclear magnetic resonance studies of the snake toxin echistatin 1H resonance assignments and secondary structure",\N
2208,"2208","1995-01-01",\N,"1H, 13C and 15N backbone assignments of cyclophilin when bound to cyclosporin A (CsA) and preliminary structural characterization of the CsA binding site",\N
2209,"2209","1995-01-01",\N,"Determination of the orientations of tryptophan analogues bound to the trp repressor and the relationship to activation",\N
2217,"2217","1995-01-01",\N,"Structural characterization of a 39-residue synthetic peptide containing the two zinc binding domains from the HIV-1 p7 nucleocapsid protein by CD and NMR spectroscopy",\N
2218,"2218","1995-01-01",\N,"NMR Study of the Molecular and Electronic Structure of the Heme Cavity of Aplysia Metmyoglobin. Resonance Assignments Based on Isotope Labeling and Proton Nuclear Overhauser Effect Measurements",\N
2219,"2219","1995-01-01",\N,"Sequential Resonance Assignments of Oxidized High-Potential Iron-Sulfur Protein from Chromatium vinosum",\N
2220,"2220","1995-01-01",\N,"Sequential Resonance Assignments of Oxidized High-Potential Iron-Sulfur Protein from Chromatium vinosum",\N
2221,"2221","1995-01-01",\N,"Sequential Resonance Assignments of Oxidized High-Potential Iron-Sulfur Protein from Chromatium vinosum",\N
2222,"2222","1995-01-01",\N,"Sequential Resonance Assignments of Oxidized High-Potential Iron-Sulfur Protein from Chromatium vinosum",\N
2223,"2223","1995-01-01",\N,"Sequence-Specific 1H NMR Assignments and Solution Structure of Bovine Pancreatic Polypeptide",\N
2224,"2224","1995-01-01",\N,"Assignment of the 1H NMR Spectrum and Secondary Structure Elucidation of the Single-Stranded DNA Binding Protein Encoded by the Filamentous Bacteriophage IKe",\N
2225,"2225","1995-01-01",\N,"Proton NMR Studies of Cucurbita maxima Trypsin Inhibitors: Evidence for pH-Dependent Conformational Change and His25-Tyr27 Interaction",\N
2226,"2226","1995-01-01",\N,"Proton NMR Studies of Cucurbita maxima Trypsin Inhibitors: Evidence for pH-Dependent Conformational Change and His25-Tyr27 Interaction",\N
2227,"2227","1995-01-01",\N,"Two-Dimensional NMR Studies of Squash Family Inhibitors. Sequence-Specific Proton Assignments and Secondary Structure of Reactive-Site Hydrolyzed Cucurbita maxima Trypsin Inhibitor III",\N
2228,"2228","1995-01-01",\N,"Two-Dimensional NMR Studies of Squash Family Inhibitors. Sequence-Specific Proton Assignments and Secondary Structure of Reactive-Site Hydrolyzed Cucurbita maxima Trypsin Inhibitor III",\N
2229,"2229","1995-01-01",\N,"The Role of an Active Site Histidine in the Catalytic Mechanism of Aspartate Transcarbamoylase",\N
2231,"2231","1995-01-01",\N,"Preparation of a Lysozyme Derivative in Which Two Domains Are Cross-Linked Intramolecularly between Trp62 and Asp101",\N
2232,"2232","1995-01-01",\N,"Preparation of a Lysozyme Derivative in Which Two Domains Are Cross-Linked Intramolecularly between Trp62 and Asp101",\N
2233,"2233","1995-01-01",\N,"Proton Nuclear Magnetic Resonance Studies of Intact Native Bovine Parathyroid Hormone",\N
2234,"2234","1995-01-01",\N,"Proton Nuclear Magnetic Resonance Studies of Intact Native Bovine Parathyroid Hormone",\N
2235,"2235","1995-01-01",\N,"Evidence for a Tetrahedral Intermediate Complex during Serpin-Proteinase Interactions",\N
2236,"2236","1995-01-01",\N,"Evidence for a Tetrahedral Intermediate Complex during Serpin-Proteinase Interactions",\N
2247,"2247","1995-01-01",\N,"Conformational Changes in the Metal-Binding Sites of Cardiac Troponin C Induced by Calcium Binding",\N
2249,"2249","1995-01-01",\N,"Structure of Epidermal Growth Factor Bound to Perdeuterated Dodecylphosphocholine Micelles Determined by Two-Dimensional NMR and Simulated Annealing Calculations",\N
2261,"2261","1995-01-01",\N,"Solution Structure of the Tissue-type Plasminogen Activator Kringle 2 Domain complexed to 6-Aminohexanoic Acid an Antifibrinolytic Drug",\N
2262,"2262","1995-01-01",\N,"Conformational Isomerism of Endothelin in Acidic Aqueous Media: A Quantitative NOESY Analysis",\N
2263,"2263","1995-01-01",\N,"Conformational Isomerism of Endothelin in Acidic Aqueous Media: A Quantitative NOESY Analysis",\N
2265,"2265","1995-01-01",\N,"Two-Dimensional NMR Strategies for Carbon-Carbon Correlations and Sequence-Specific Assignments in Carbon-13 Labeled Proteins",\N
2266,"2266","1995-01-01",\N,"Fluorescence, CD, Attenuated Total Reflectance (ATR) FTIR, and 13C NMR Characterization of the Structure and Dynamics of Synthetic Melittin and Melittin Analogues in Lipid Environments",\N
2267,"2267","1995-01-01",\N,"Fluorescence, CD, Attenuated Total Reflectance (ATR) FTIR, and 13C NMR Characterization of the Structure and Dynamics of Synthetic Melittin and Melittin Analogues in Lipid Environments",\N
2268,"2268","1995-01-01",\N,"Fluorescence, CD, Attenuated Total Reflectance (ATR) FTIR, and 13C NMR Characterization of the Structure and Dynamics of Synthetic Melittin and Melittin Analogues in Lipid Environments",\N
2269,"2269","1995-01-01",\N,"Fluorescence, CD, Attenuated Total Reflectance (ATR) FTIR, and 13C NMR Characterization of the Structure and Dynamics of Synthetic Melittin and Melittin Analogues in Lipid Environments",\N
2270,"2270","1995-01-01",\N,"Fluorescence, CD, Attenuated Total Reflectance (ATR) FTIR, and 13C NMR Characterization of the Structure and Dynamics of Synthetic Melittin and Melittin Analogues in Lipid Environments",\N
2271,"2271","1995-01-01",\N,"Fluorescence, CD, Attenuated Total Reflectance (ATR) FTIR, and 13C NMR Characterization of the Structure and Dynamics of Synthetic Melittin and Melittin Analogues in Lipid Environments",\N
2272,"2272","1995-01-01",\N,"Immunogenic Peptides Corresponding to the Dominant Antigenic Region Alanine-597 to Cysteine-619 in the Transmembrane Protein of Simian Immunodeficiency Virus Have a Propensity To Fold in Aqueous Solution",\N
2274,"2274","1995-01-01",\N,"1H Spin System Identifications of S-Sulfonated Insulin B Chain with 2D-NMR",\N
2275,"2275","1995-01-01",\N,"Identification of Two Antiparallel-sheet Structure of Cobrotoxin in Aqueous Solution by 1H NMR",\N
2276,"2276","1995-01-01",\N,"Conformational Studies on Bombesin Antagonists: CD and NMR Characterization of [Thr6, Leu13psi(CH2NH) Met14] Bombesin (6-14)",\N
2277,"2277","1995-01-01",\N,"Syringopeptins, new phytotoxic lipodepsipeptides of Pseudomonas syringae pv. syringae",\N
2278,"2278","1995-01-01",\N,"1H NMR Sequential Assignments and Identification of Secondary Structural Elements in Oxidized Putidaredoxin, an Electron-Transfer Protein from Pseudomonas",\N
2279,"2279","1995-01-01",\N,"NMR studies of lantibiotics Assignment of the 1H-NMR spectrum of nisin and identification of interresidual contacts",\N
2281,"2281","1995-01-01",\N,"1H NMR Assignment and Secondary Structure of the Cell Adhesion Type III Module of Fibronectin",\N
2282,"2282","1995-01-01",\N,"Two-dimensional 1H-NMR study of bacterioopsin-(34-65)-polypeptide conformation",\N
2283,"2283","1995-01-01",\N,"Toxin III of the scorpion Androctonus australis Hector: Proton nuclear magnetic resonance assignments and secondary structure",\N
2284,"2284","1995-01-01",\N,"Toxin III of the scorpion Androctonus australis Hector: Proton nuclear magnetic resonance assignments and secondary structure",\N
2285,"2285","1995-01-01",\N,"Catalytic mechanism of serine proteases: Reexamination of the pH dependence of the histidyl 1J13C2-H coupling constant in the catalytic triad of alpha-lytic protease",\N
2288,"2288","1995-01-01",\N,"Assignment of the Three Methionyl Carbonyl Carbon Resonances in Streptomyces Subtilisin Inhibitor by a Carbon-13 and Nitrogen-15 Double -Labeling Technique. A New Strategy for Structural Studies of Proteins in Solution",\N
2324,"2324","1995-01-01",\N,"The Structural Isomerisation of Human-Muscle Adenylate Kinase as Studied by 1H-Nuclear Magnetic Resonance",\N
2325,"2325","1995-01-01",\N,"The Structural Isomerisation of Human-Muscle Adenylate Kinase as Studied by 1H-Nuclear Magnetic Resonance",\N
2326,"2326","1995-01-01",\N,"The Structural Isomerisation of Human-Muscle Adenylate Kinase as Studied by 1H-Nuclear Magnetic Resonance",\N
2327,"2327","1995-01-01",\N,"The Essential Tyrosine of the Internalization Signal in Lysosomal Acid Phosphatase Is Part of a beta Turn",\N
2328,"2328","1995-01-01",\N,"Structural determinants of Cys2His2 zinc fingers",\N
2329,"2329","1995-01-01",\N,"Structural determinants of Cys2His2 zinc fingers",\N
2331,"2331","1995-01-01",\N,"Individual Assignments of the Amide Proton Resonances Involved in the Triple-Stranded Antiparallel Pleated beta-Sheet Structure of a Long Neurotoxin, Laticauda Semifasciata III from Laticauda semifasciata",\N
2338,"2338","1995-01-01",\N,"A Two-Dimensional NMR Method for Assignment of Imidazole Ring Proton Resonances of Histidine Residues in Proteins",\N
2345,"2345","1995-01-01",\N,"Influence of Molecular Correlation Time on the Homonuclear Overhauser Effect in Paramagnetic Proteins",\N
2346,"2346","1995-01-01",\N,"Influence of Molecular Correlation Time on the Homonuclear Overhauser Effect in Paramagnetic Proteins",\N
2347,"2347","1995-01-01",\N,"Influence of Molecular Correlation Time on the Homonuclear Overhauser Effect in Paramagnetic Proteins",\N
2348,"2348","1995-01-01",\N,"Influence of Molecular Correlation Time on the Homonuclear Overhauser Effect in Paramagnetic Proteins",\N
2352,"2352","1995-01-01",\N,"Structural and Electronic Properties of the Liver Fluke Heme Cavity by Nuclear Magnetic Resonance and Optical Spectroscopy. Evidence for a Distal Tyrosine Residue in a Normally Functioning Hemoglobin.",\N
2353,"2353","1995-01-01",\N,"15N nuclear magnetic resonance studies of the B domain of Staphylococcal protein A: Sequence specific assignments of the imide 15N resonances of the proline residues and the interaction with human immunoglobin G",\N
2366,"2366","1995-01-01",\N,"Nuclear Magnetic Resonance Studies of Metal Substituted Horse Cytochrome c",\N
2367,"2367","1995-01-01",\N,"Nuclear Magnetic Resonance Studies of Metal Substituted Horse Cytochrome c",\N
2368,"2368","1995-01-01",\N,"Nuclear Magnetic Resonance Studies of Metal Substituted Horse Cytochrome c",\N
2371,"2371","1995-01-01",\N,"Three-Dimensional 15N-1H-1H and 15N-13C-1H nuclear-magnetic resonance studies of HPr a central component of the phosphoenolpyruvate-dependent phosphotransferase system from Escherichia coli",\N
2384,"2384","1995-01-01",\N,"1H NMR-Based Determination of the Secondary Structure of Porcine Pancreatic Spasmolytic Polypeptide: One of a New Family of \"Trefoil\" Motif Containing Cell Growth Factors",\N
2395,"2395","1995-01-01",\N,"Location of an alpha-Helix in Fragment 96-133 from Bovine Somatotropin by 1H NMR Spectroscopy",\N
2396,"2396","1995-01-01",\N,"Mapping the Substrate-Binding Site of a Human Class Mu Glutathione Transferase Using Nuclear Magnetic Resonance Spectroscopy",\N
2410,"2410","2001-04-30",\N,"Sequence-specific 1H, 15N, and 13C assignment of the N-terminal domain of the human oncoprotein MDM2 that binds to p53",\N
2425,"2425","1995-01-01",\N,"Nature and Locations of the Most Slowly Exchanging Peptide NH Protons in Residues 1 to 19 of Ribonuclease S",\N
2426,"2426","1995-01-01",\N,"Nature and Locations of the Most Slowly Exchanging Peptide NH Protons in Residues 1 to 19 of Ribonuclease S",\N
2431,"2431","1995-01-01",\N,"Influence of Propionate Side Chains on the Equilibrium Heme Orientation in Sperm Whale Myoglobin. Heme Resonance Assignments and Structure Determination by Nuclear Overhauser Effect Measurements",\N
2432,"2432","1995-01-01",\N,"Influence of Propionate Side Chains on the Equilibrium Heme Orientation in Sperm Whale Myoglobin. Heme Resonance Assignments and Structure Determination by Nuclear Overhauser Effect Measurements",\N
2433,"2433","1995-01-01",\N,"Influence of Propionate Side Chains on the Equilibrium Heme Orientation in Sperm Whale Myoglobin. Heme Resonance Assignments and Structure Determination by Nuclear Overhauser Effect Measurements",\N
2434,"2434","1995-01-01",\N,"Influence of Propionate Side Chains on the Equilibrium Heme Orientation in Sperm Whale Myoglobin. Heme Resonance Assignments and Structure Determination by Nuclear Overhauser Effect Measurements",\N
2435,"2435","1995-01-01",\N,"Nuclear Magnetic Resonance Studies on Calmodulin: Calcium-Induced Conformational Change",\N
2436,"2436","1995-01-01",\N,"Nuclear Magnetic Resonance Studies on Calmodulin: Calcium-Induced Conformational Change",\N
2437,"2437","1995-01-01",\N,"Nuclear Magnetic Resonance Studies on Calmodulin: Calcium-Induced Conformational Change",\N
2438,"2438","1995-01-01",\N,"Nuclear Magnetic Resonance Studies on Calmodulin: Calcium-Induced Conformational Change",\N
2439,"2439","1995-01-01",\N,"Nuclear Magnetic Resonance Studies on Calmodulin: Calcium-Induced Conformational Change",\N
2440,"2440","1995-01-01",\N,"Nuclear Magnetic Resonance Studies on Calmodulin: Calcium-Induced Conformational Change",\N
2442,"2442","1995-01-01",\N,"Nucleotide Binding and GTP Hydrolysis by Elongation Factor Tu from Thermus thermophilus As Monitored by Proton NMR",\N
2443,"2443","1995-01-01",\N,"Nucleotide Binding and GTP Hydrolysis by Elongation Factor Tu from Thermus thermophilus As Monitored by Proton NMR",\N
2446,"2446","1995-01-01",\N,"Studies of beta-Sheet Structure in Lysozyme by Proton Nuclear Magnetic Resonance. Assignments and Analysis of Spin-Spin Coupling Constants",\N
2454,"2454","1995-01-01",\N,"Acyl Carrier Protein from Escherichia coli I. Aspects of the Solution Structure As Evidenced by Proton Nuclear Overhauser Experiments at 500 MHz",\N
2455,"2455","1995-01-01",\N,"pH and Temperature Effects on the Molecular Conformation of the Porcine Pancreatic Secretory Trypsin Inhibitor As Detected by Hydrogen-1 Nuclear Magnetic Resonance",\N
2457,"2457","1995-01-01",\N,"Preliminary Structural Comparison of the Proteinase Isoinhibitors IIA and IIB from Bull Seminal Plasma Based on Individual Assignments of the 1H Nuclear Magnetic Resonance Spectra by Two-dimensional Nuclear Magnetic Resonance at 500 MHz",\N
2463,"2463","1995-01-01",\N,"Heternuclear (1H,13C) Two-Dimensional Chemical Shift Correlation NMR Spectroscopy of a Protein. Ferredoxin from Anabaena variabilis",\N
2472,"2472","1995-01-01",\N,"1H NMR Studies of a Two-Iron: Two-Sulfur Ferredoxin from Halobacterium of the Dead Sea",\N
2473,"2473","1995-01-01",\N,"Ligand-binding effects on the kringle 4 domain from human plasminogen: a study by laser photo-CIDNP 1H-NMR spectroscopy",\N
2474,"2474","1995-01-01",\N,"Ligand-binding effects on the kringle 4 domain from human plasminogen: a study by laser photo-CIDNP 1H-NMR spectroscopy",\N
2475,"2475","1995-01-01",\N,"Ligand-binding effects on the kringle 4 domain from human plasminogen: a study by laser photo-CIDNP 1H-NMR spectroscopy",\N
2476,"2476","1995-01-01",\N,"A Proton NMR and Nuclear Overhauser Effect (NOE) Study of Human Plasma Prealbumin, Including the Development and Application to Spectral Assignment of a Combined Ring Current Shift and NOE Prediction Program",\N
2488,"2488","1995-01-01",\N,"Assignment of hyperfine-shifted resonances in yeast ferricytochrome c isozyme 2 using the proton pre-steady-state nuclear Overhauser effect",\N
2489,"2489","1995-01-01",\N,"Assignment of hyperfine-shifted resonances in yeast ferricytochrome c isozyme 2 using the proton pre-steady-state nuclear Overhauser effect",\N
2498,"2498","1995-01-01",\N,"1H-NMR Assignment and Secondary structure of Human Insulin-Like Growth Factor-I (IGF-I) in Solution",\N
2506,"2506","1995-01-01",\N,"Heteronuclear Three-Dimensional NMR Spectroscopy of the Inflammatory Protein C5a",\N
2512,"2512","1995-01-01",\N,"pH-Dependent Properties of Cobalt(II) Carboxypeptidase A-Inhibitor Complexes",\N
2513,"2513","1995-01-01",\N,"pH-Dependent Properties of Cobalt(II) Carboxypeptidase A-Inhibitor Complexes",\N
2527,"2527","1995-01-01",\N,"Two-Dimensional NMR Studies of Squash Family Inhibitors. Sequence-Specific Proton Assignments and Secondary Structure of Reactive-Site Hydrolyzed Cucurbita maxima Trypsin Inhibitor III",\N
2528,"2528","1995-01-01",\N,"Conformation and Dynamics of an Fab'-Bound Peptide by Isotope-Edited NMR Spectroscopy",\N
2529,"2529","1995-01-01",\N,"Conformation and Dynamics of an Fab'-Bound Peptide by Isotope-Edited NMR Spectroscopy",\N
2539,"2539","1995-01-01",\N,"Determination of the Nuclear Magnetic Resonance Solution Structure of the DNA-binding Domain (Residues 1 to 69) of the 434 Repressor and Comparison with the X-ray Crystal Structure",\N
2542,"2542","1995-01-01",\N,"1H and 15N NMR Study of Human Lysozyme",\N
2545,"2545","1995-01-01",\N,"Uniform 15N Labeling of a Fungal Peptide: The Structure and Dynamics of an Alamethicin by 15N and 1H NMR Spectroscopy",\N
2546,"2546","1995-01-01",\N,"Three-Dimensional Solution Structure of the E3-Binding Domain of the Dihydrolipoamide Succinyltransferase Core from the 2-Oxoglutarate Dehydrogenase Multienzyme Complex of Escherichia coli",\N
2547,"2547","1995-01-01",\N,"Three-Dimensional Solution Structure of the E3-Binding Domain of the Dihydrolipoamide Succinyltransferase Core from the 2-Oxoglutarate Dehydrogenase Multienzyme Complex of Escherichia coli",\N
2573,"2573","1995-01-01",\N,"Fast Internal Main-Chain Dynamics of Human Ubiquitin",\N
2574,"2574","1995-01-01",\N,"Fast Internal Main-Chain Dynamics of Human Ubiquitin",\N
2575,"2575","1995-01-01",\N,"Sequence-Specific 1H NMR Assignments and Secondary Structure of the Streptococcal Protein G B2-Domain",\N
2580,"2580","1995-01-01",\N,"Sequence-specific resonance assignment and secondary structure of (1-71) bacterioopsin",\N
2590,"2590","1995-01-01",\N,"Transmembrane Region of Wild-type and Mutant M13 Coat Proteins Conformational Role of beta-Branched Residues",\N
2591,"2591","1995-01-01",\N,"Transmembrane Region of Wild-type and Mutant M13 Coat Proteins Conformational Role of beta-Branched Residues",\N
2592,"2592","1995-01-01",\N,"Transmembrane Region of Wild-type and Mutant M13 Coat Proteins Conformational Role of beta-Branched Residues",\N
2606,"2606","1995-01-01",\N,"Nitrogen-15 NMR Spectroscopy of the Catalytic-Triad Histidine of a Serine Protease in Peptide Boronic Acid Inhibitor Complexes",\N
2607,"2607","1995-01-01",\N,"Nitrogen-15 NMR Spectroscopy of the Catalytic-Triad Histidine of a Serine Protease in Peptide Boronic Acid Inhibitor Complexes",\N
2608,"2608","1995-01-01",\N,"Nitrogen-15 NMR Spectroscopy of the Catalytic-Triad Histidine of a Serine Protease in Peptide Boronic Acid Inhibitor Complexes",\N
2609,"2609","1995-01-01",\N,"Nitrogen-15 NMR Spectroscopy of the Catalytic-Triad Histidine of a Serine Protease in Peptide Boronic Acid Inhibitor Complexes",\N
2610,"2610","1995-01-01",\N,"Nitrogen-15 NMR Spectroscopy of the Catalytic-Triad Histidine of a Serine Protease in Peptide Boronic Acid Inhibitor Complexes",\N
2611,"2611","1995-01-01",\N,"Nitrogen-15 NMR Spectroscopy of the Catalytic-Triad Histidine of a Serine Protease in Peptide Boronic Acid Inhibitor Complexes",\N
2612,"2612","1995-01-01",\N,"Nitrogen-15 NMR Spectroscopy of the Catalytic-Triad Histidine of a Serine Protease in Peptide Boronic Acid Inhibitor Complexes",\N
2613,"2613","1995-01-01",\N,"Nitrogen-15 NMR Spectroscopy of the Catalytic-Triad Histidine of a Serine Protease in Peptide Boronic Acid Inhibitor Complexes",\N
2614,"2614","1995-01-01",\N,"Nitrogen-15 NMR Spectroscopy of the Catalytic-Triad Histidine of a Serine Protease in Peptide Boronic Acid Inhibitor Complexes",\N
2615,"2615","1995-01-01",\N,"Nitrogen-15 NMR Spectroscopy of the Catalytic-Triad Histidine of a Serine Protease in Peptide Boronic Acid Inhibitor Complexes",\N
2616,"2616","1995-01-01",\N,"Nitrogen-15 NMR Spectroscopy of the Catalytic-Triad Histidine of a Serine Protease in Peptide Boronic Acid Inhibitor Complexes",\N
2617,"2617","1995-01-01",\N,"Nitrogen-15 NMR Spectroscopy of the Catalytic-Triad Histidine of a Serine Protease in Peptide Boronic Acid Inhibitor Complexes",\N
2618,"2618","1995-01-01",\N,"Nitrogen-15 NMR Spectroscopy of the Catalytic-Triad Histidine of a Serine Protease in Peptide Boronic Acid Inhibitor Complexes",\N
2619,"2619","1995-01-01",\N,"Nitrogen-15 NMR Spectroscopy of the Catalytic-Triad Histidine of a Serine Protease in Peptide Boronic Acid Inhibitor Complexes",\N
2620,"2620","1995-01-01",\N,"Nitrogen-15 NMR Spectroscopy of the Catalytic-Triad Histidine of a Serine Protease in Peptide Boronic Acid Inhibitor Complexes",\N
2621,"2621","1995-01-01",\N,"Nitrogen-15 NMR Spectroscopy of the Catalytic-Triad Histidine of a Serine Protease in Peptide Boronic Acid Inhibitor Complexes",\N
2622,"2622","1995-01-01",\N,"Nitrogen-15 NMR Spectroscopy of the Catalytic-Triad Histidine of a Serine Protease in Peptide Boronic Acid Inhibitor Complexes",\N
2623,"2623","1995-01-01",\N,"Nitrogen-15 NMR Spectroscopy of the Catalytic-Triad Histidine of a Serine Protease in Peptide Boronic Acid Inhibitor Complexes",\N
2624,"2624","1995-01-01",\N,"Nitrogen-15 NMR Spectroscopy of the Catalytic-Triad Histidine of a Serine Protease in Peptide Boronic Acid Inhibitor Complexes",\N
2625,"2625","1995-01-01",\N,"Nitrogen-15 NMR Spectroscopy of the Catalytic-Triad Histidine of a Serine Protease in Peptide Boronic Acid Inhibitor Complexes",\N
2627,"2627","1995-01-01",\N,"Nitrogen-15 NMR Spectroscopy of the Catalytic-Triad Histidine of a Serine Protease in Peptide Boronic Acid Inhibitor Complexes",\N
2628,"2628","1995-01-01",\N,"Nitrogen-15 NMR Spectroscopy of the Catalytic-Triad Histidine of a Serine Protease in Peptide Boronic Acid Inhibitor Complexes",\N
2630,"2630","1995-01-01",\N,"Multidimensional 1H and 15N NMR investigation of glutamine-binding protein of Escherichia coli",\N
2631,"2631","1995-01-01",\N,"Multidimensional 1H and 15N NMR investigation of glutamine-binding protein of Escherichia coli",\N
2632,"2632","1995-01-01",\N,"Multidimensional 1H and 15N NMR investigation of glutamine-binding protein of Escherichia coli",\N
2638,"2638","1995-01-01",\N,"1H NMR and UV-Vis Spectroscopic Characterization of Sulfonamide Complexes of Nickel(II)-Carbonic Anhydrase. Resonance Assignments Based on NOE Effects",\N
2639,"2639","1995-01-01",\N,"1H NMR and UV-Vis Spectroscopic Characterization of Sulfonamide Complexes of Nickel(II)-Carbonic Anhydrase. Resonance Assignments Based on NOE Effects",\N
2640,"2640","1995-01-01",\N,"1H NMR and UV-Vis Spectroscopic Characterization of Sulfonamide Complexes of Nickel(II)-Carbonic Anhydrase. Resonance Assignments Based on NOE Effects",\N
2641,"2641","1995-01-01",\N,"1H NMR and UV-Vis Spectroscopic Characterization of Sulfonamide Complexes of Nickel(II)-Carbonic Anhydrase. Resonance Assignments Based on NOE Effects",\N
2642,"2642","1995-01-01",\N,"1H NMR and UV-Vis Spectroscopic Characterization of Sulfonamide Complexes of Nickel(II)-Carbonic Anhydrase. Resonance Assignments Based on NOE Effects",\N
2651,"2651","1995-01-01",\N,"Site-Directed Mutagenesis and 1H NMR Spectroscopy of an Interdomain Segment in the Pyruvate Dehydrogenase Multienzyme Complex of Escherichia coli",\N
2652,"2652","1995-01-01",\N,"Hydrogen-Exchange Kinetics of the Indole NH Proton of the Buried Tryptophan in the Constant Fragment of the Immunoglobulin Light Chain",\N
2707,"2707","1995-01-01",\N,"Proton Magnetic Resonance Investigation of the Influence of Quaternary Structure on Iron-Histidine Bonding in Deoxyhemoglobins",\N
2708,"2708","1995-01-01",\N,"Proton Magnetic Resonance Investigation of the Influence of Quaternary Structure on Iron-Histidine Bonding in Deoxyhemoglobins",\N
2709,"2709","1995-01-01",\N,"Proton Magnetic Resonance Investigation of the Influence of Quaternary Structure on Iron-Histidine Bonding in Deoxyhemoglobins",\N
2710,"2710","1995-01-01",\N,"Proton Magnetic Resonance Investigation of the Influence of Quaternary Structure on Iron-Histidine Bonding in Deoxyhemoglobins",\N
2711,"2711","1995-01-01",\N,"Proton Magnetic Resonance Investigation of the Influence of Quaternary Structure on Iron-Histidine Bonding in Deoxyhemoglobins",\N
2712,"2712","1995-01-01",\N,"Proton Magnetic Resonance Investigation of the Influence of Quaternary Structure on Iron-Histidine Bonding in Deoxyhemoglobins",\N
2718,"2718","1995-01-01",\N,"A 1H-NMR study of human interleukin-1beta Sequence-specific assignment of aromatic residues using site-directed mutant proteins",\N
2719,"2719","1995-01-01",\N,"A 1H-NMR study of human interleukin-1beta Sequence-specific assignment of aromatic residues using site-directed mutant proteins",\N
2763,"2763","1995-01-01",\N,"Comparison of the Structure and Dynamics of Chicken Gizzard and Rabbit Cardiac Tropomyosins: 1H NMR Spectroscopy and Measurement of Amide Hydrogen Exchange Rates",\N
2764,"2764","1995-01-01",\N,"NMR studies of the trp repressor from Escherichia coli Characterisation and assignments of residue types",\N
2768,"2768","1995-01-01",\N,"Different conformations for the same polypeptide bound to chaperones DnaK and GroEL",\N
2784,"2784","1995-01-01",\N,"Dynamics of Methyl Groups in Proteins As Studied by Proton-Detected 13C NMR Spectroscopy. Application to the Leucine Residues of Staphylococcal Nuclease",\N
2785,"2785","1995-01-01",\N,"Dynamics of Methyl Groups in Proteins As Studied by Proton-Detected 13C NMR Spectroscopy. Application to the Leucine Residues of Staphylococcal Nuclease",\N
2786,"2786","1995-01-01",\N,"Complete Assignment of Aromatic 1H Nuclear Magnetic Resonances of the Tyrosine Residues of Hen Lysozyme",\N
2787,"2787","1995-01-01",\N,"Sequential Individual Resonance Assignments in the 1H Nuclear-Magnetic-Resonance Spectrum of Cardiotoxin VII 2 from Naja mossambica mossambica",\N
2798,"2798","1995-01-01",\N,"Proton NMR Studies of Cucurbita maxima Trypsin Inhibitors: Evidence for pH-Dependent Conformational Change and His25-Tyr27 Interaction",\N
2799,"2799","1995-01-01",\N,"Proton NMR Studies of Cucurbita maxima Trypsin Inhibitors: Evidence for pH-Dependent Conformational Change and His25-Tyr27 Interaction",\N
2802,"2802","1995-01-01",\N,"Determination of the Molecular Dynamics of Alamethicin Using 13C NMR: Implications for the mechanism of Gating of a Voltage-Dependent Channel",\N
2804,"2804","1995-01-01",\N,"Solution Structure of Endothelin-3 Determined Using NMR Spectroscopy",\N
2852,"2852","1995-01-01",\N,"1H-n.m.r. studies of the fibronectin 13kDa collagen-binding fragment Evidence for autonomous conserved typeI and type II domain folds",\N
2853,"2853","1995-01-01",\N,"1H-n.m.r. studies of the fibronectin 13kDa collagen-binding fragment Evidence for autonomous conserved typeI and type II domain folds",\N
2856,"2856","1995-01-01",\N,"Sequential 1H NMR Assignments of Kistrin, a Potent Platelet Aggregation Inhibitor and Glycoprotein IIB-IIIa Antagonist",\N
2858,"2858","1995-01-01",\N,"Comparisons of Ring-Current Shifts Calculated from the Crystal Structure of Egg White Lysozyme of Hen with the Proton Nuclear Magnetic Resonance Spectrum of Lysozyme in Solution",\N
2868,"2868","1995-01-01",\N,"Sequential assignment of the proton NMR spectrum of isolated alpha(CO) chains from human adult hemoglobin",\N
2917,"2917","1995-01-01",\N,"Study of Tryptophan Residues of Lysozyme Using 1H Nuclear Magnetic Resonance",\N
2928,"2928","1995-01-01",\N,"3D structure of bovine pancreatic ribonuclease A in aqueous solution: An approach to tertiary structure determination from a small basis of 1H NMR NOE correlations",\N
2935,"2935","1995-01-01",\N,"1H NMR Study of the Molecular and Electronic Structure of Paramagnetic Iron Chlorin Complexes of Myoglobin: Dynamic Heterogeneity of the Heme Pocket",\N
2936,"2936","1995-01-01",\N,"1H NMR Study of the Molecular and Electronic Structure of Paramagnetic Iron Chlorin Complexes of Myoglobin: Dynamic Heterogeneity of the Heme Pocket",\N
2939,"2939","1995-01-01",\N,"Solution Structures of Cyclic and Dicyclic Analogues of Growth Hormone Releasing factor as Determined by Two-Dimensional NMR an CD Spectroscopies and Constrained Molecular Dynamics",\N
2940,"2940","1995-01-01",\N,"Solution Structures of Cyclic and Dicyclic Analogues of Growth Hormone Releasing factor as Determined by Two-Dimensional NMR an CD Spectroscopies and Constrained Molecular Dynamics",\N
2941,"2941","1995-01-01",\N,"Solution Structures of Cyclic and Dicyclic Analogues of Growth Hormone Releasing factor as Determined by Two-Dimensional NMR an CD Spectroscopies and Constrained Molecular Dynamics",\N
2948,"2948","1995-01-01",\N,"Evidence for the presence of a secondary structure at the dibasic processing site of prohormone: the pro-ocytocin model",\N
2950,"2950","1995-01-01",\N,"Assessment of cheY binding regions using 2D NMR and paramagnetic ligands",\N
2951,"2951","1995-01-01",\N,"Assessment of cheY binding regions using 2D NMR and paramagnetic ligands",\N
2956,"2956","1995-01-01",\N,"Importance of Protein and DNA Phosphate Ester Backbone Flexibility in Protein-DNA Recognition",\N
2957,"2957","1995-01-01",\N,"Complete Assignment of the 1H NMR Spectrum of the Aromatic Residues of Lysozyme",\N
2958,"2958","1995-01-01",\N,"High-resolution Three-Dimensional Structure of Reduced Recombinant Human Thioredoxin in Solution",\N
2959,"2959","1995-01-01",\N,"High-resolution Three-Dimensional Structure of Reduced Recombinant Human Thioredoxin in Solution",\N
2960,"2960","1995-01-01",\N,"Computer-Aided Sequential Assignment of Protein 1H NMR Spectra",\N
2968,"2968","1995-01-01",\N,"Hydrogen exchange in Pseudomonas cytochrome c-551",\N
2990,"2990","1995-01-01",\N,"Different conformations for the same polypeptide bound to chaperones DnaK and GroEL",\N
2991,"2991","1995-01-01",\N,"Different conformations for the same polypeptide bound to chaperones DnaK and GroEL",\N
2999,"2999","1995-01-01",\N,"Sequence-Specific Assignments of the 1H Nuclear Magnetic Resonance Spectra of Reduced High-Potential Ferredoxin (HiPIP) from Chromatium vinosum",\N
3000,"3000","1995-01-01",\N,"Sequence-Specific Assignments of the 1H Nuclear Magnetic Resonance Spectra of Reduced High-Potential Ferredoxin (HiPIP) from Chromatium vinosum",\N
3032,"3032","1995-01-01",\N,"Changing the Inhibitory Specificity and Function of the Proteinase Inhibitor Eglin c by Site-Directed Mutagenesis: Functional and Structural Investigation",\N
3036,"3036","1995-01-01",\N,"Effect of Trifluoroethanol on Protein Secondary Structure: An NMR and CD Study Using a Synthetic Actin Peptide",\N
3065,"3065","1995-01-01",\N,"Studies of the structure of bacteriophage lambda cro protein in solution Analysis of the aromatic region of the 1H NMR spectrum",\N
3078,"3078","1995-01-01",\N,"1H NMR Assignments and Secondary Structure of Human beta2-Microglobulin in Solution",\N
3079,"3079","1995-01-01",\N,"1H NMR Assignments and Secondary Structure of Human beta2-Microglobulin in Solution",\N
3084,"3084","1995-01-01",\N,"The interaction of acetate and formate with cobalt carbonic anhydrase An NMR study",\N
3085,"3085","1995-01-01",\N,"The interaction of acetate and formate with cobalt carbonic anhydrase An NMR study",\N
3118,"3118","1995-01-01",\N,"Stoichiometry of Calcium Binding to a Synthetic Heterodimeric Troponin-C Domain",\N
3119,"3119","1995-01-01",\N,"Stoichiometry of Calcium Binding to a Synthetic Heterodimeric Troponin-C Domain",\N
3127,"3127","1995-01-01",\N,"Proton Nuclear Magnetic Resonance Studies of Porcine Intestinal Calcium Binding Protein",\N
3128,"3128","1995-01-01",\N,"Proton Nuclear Magnetic Resonance Studies of Porcine Intestinal Calcium Binding Protein",\N
3322,"3322","2001-09-19",\N,"Characterisation of a cellulosome dockerin domain from the anaerobic fungus Piromyces equi",\N
3394,"3394","1995-01-01",\N,"The solution structure of the leucine zipper motif of the Jun oncoprotein homodimer",\N
3404,"3404","1995-01-01",\N,"A Single-Stranded Amphiphatic alpha-Helix in Aqueous Solution: Design, Structural Characterization, and Its Application for Determining alpha-Helical Propensities of Amino Acids",\N
3427,"3427","1995-01-01",\N,"NMR Solution Structure of Human Parathyroid Hormone(1-34)",\N
3433,"3433","1995-01-01",\N,"1H and 15N assignments and secondary structure of the Src Sh3 domain",\N
3435,"3435","1995-01-01",\N,"Proton NMR Conformational Study of an Annexin I Fragment: Influence of a Phospholipidic Micellar Environment",\N
3436,"3436","1995-01-01",\N,"Proton NMR Conformational Study of an Annexin I Fragment: Influence of a Phospholipidic Micellar Environment",\N
3437,"3437","1995-01-01",\N,"Proton NMR Conformational Study of an Annexin I Fragment: Influence of a Phospholipidic Micellar Environment",\N
3440,"3440","1995-01-01",\N,"1H- and 15N-NMR assignment and solution structure of the chemotactic Escherichia coli Che Y protein",\N
3441,"3441","1995-01-01",\N,"1H-NMR analysis of turkey egg-white lysozyme and comparison with hen egg-white lysozyme",\N
3442,"3442","1995-01-01",\N,"Sequential assignment of proton resonances in the NMR spectrum of Zn-substituted alpha chains from human hemoglobin",\N
3449,"3449","1995-01-01",\N,"Stabilized NMR structure of human parathyroid hormone(1-34)",\N
3456,"3456","1995-01-01",\N,"Two-dimensional 1H NMR study of recombinant insect defensin A in water: Resonance assignments, secondary structure and global folding",\N
3466,"3466","1995-01-01",\N,"Proton Nuclear Magnetic Resonance Sequential Assignments and Secondary Structure of an Immunoglobulin Light Chain-Binding Domain of Protein L",\N
3471,"3471","1995-01-01",\N,"Symmetrical Rearrangement of the Cation-Binding Sites of Parvalbumin upon Ca2+/Mg2+ Exchange. A Study by 1H 2D NMR",\N
3472,"3472","1995-01-01",\N,"Symmetrical Rearrangement of the Cation-Binding Sites of Parvalbumin upon Ca2+/Mg2+ Exchange. A Study by 1H 2D NMR",\N
3485,"3485","1995-01-01",\N,"1H-n.m.r. study of the solution properties and secondary structure of neurotoxin III from the sea anemone Anemonia sulcata",\N
3524,"3524","1995-01-01",\N,"13C NMR Determination of the Tautomeric and Ionization States of Folate in Its Complexes with Lactobacillus casei Dihydrofolate Reductase",\N
3525,"3525","1995-01-01",\N,"13C NMR Determination of the Tautomeric and Ionization States of Folate in Its Complexes with Lactobacillus casei Dihydrofolate Reductase",\N
3548,"3548","1995-01-01",\N,"Two-dimensional nuclear magnetic resonance study of brain natriuretic peptide in aqueous solution.",\N
4001,"4001","1996-10-01",\N,"1H, 13C, and 15N resonance assignments for reduced apo-S100beta",\N
4010,"4010","1997-05-14",\N,"Resonance Assignments for the OB-fold Sub-Domain of Staphylococcal Nuclease (SNOB) -> Nuclease 1-103 (V66L, G88V)",\N
4011,"4011","1997-03-21",\N,"1H and 15N Assignments and Secondary Structure of the Starch-binding Domain of Glucoamylase from Aspergillus niger",\N
4012,"4012","1997-04-18",\N,"Structure of the Acid State of E. coli Ribonuclease HI",\N
4019,"4019","1999-04-14",\N,"1H, 13C and 15N Resonance Assignments of Recombinant Poplar Plastocyanin",\N
4020,"4020","1997-05-07",\N,"Solution Structure of the Immunodominant Region of Protein G of Bovine Respiratory Syncytial Virus",\N
4022,"4022","1997-05-21",\N,"Sequential NMR Assignment of 1H, 13C, and 15N Resonances of Human Carbonic Anhydrase I (HCAI) by Triple-Resonance NMR Techniques and Extensive Amino Acid Specific 15N Labeling",\N
4023,"4023","1998-06-27",\N,"1H, 13C and 15N Resonance Assignments for the Z Domain of Staphylococcal Protein A at pH* 6.5 and Temperature of 30 deg. C",\N
4024,"4024","1998-02-23",\N,"1H Resonance Assignments for the First Zinc Finger Domain of SWI5",\N
4027,"4027","1997-04-28",\N,"Sequence Specific 1H, 13C, and 15N assignment of the S. aureus TMP-resistant dihydrofolate reductase mutant DHFR(F98Y) in the ternary complex with TMP and NADPH",\N
4028,"4028","1997-11-30",\N,"Chemical Shift Mapping of the RNA-binding Interface to the Multiple-RBD Protein Sex-Lethal: Chemical Shifts for the Protein-RNA Complex",\N
4029,"4029","1997-11-30",\N,"Chemical Shift Mapping of the RNA-binding Interface to the Multiple-RBD Protein Sex-Lethal: Chemical Shifts for the Free Protein",\N
4030,"4030","1997-04-23",\N,"Refinement of the Solution Structure of Calcium-Free, Myristoylated Recoverin",\N
4031,"4031","1997-06-25",\N,"1H, 13C and 15N Resonance Assignments for the Bovine Pancreatic Ribonuclease A at pH* 4.6 and Temperature of 20 Deg. C",\N
4032,"4032","1997-06-25",\N,"1H, 13C and 15N Resonance Assignments for the Bovine Pancreatic [C65S, C72S] Ribonuclease A at pH* 4.6 and Temperature of 20 deg. C",\N
4033,"4033","1997-07-08",\N,"NMR Spectroscopic Studies of the DNA Binding Domain of the Monomer-Binding Nuclear Orphan Receptor, Human ERR2. The Carboxy-Terminal Extension to the Zinc-Finger Region is Unstructured in the Free Form of the Protein.",\N
4034,"4034","1997-07-08",\N,"NMR Spectroscopic Studies of the DNA Binding Domain of the Monomer-Binding Nuclear Orphan Receptor, Human ERR2. The Carboxy-Terminal Extension to the Zinc-Finger Region is Unstructured in the Free Form of the Protein.",\N
4035,"4035",\N,"2005-04-21","Solution Structure of the DNA-Binding Domain of a Human Papillomavirus E2 Protein: Evidence for Flexible DNA-Binding Regions",\N
4036,"4036","1997-06-18",\N,"Sequential 1H, 13C, and 15N, NMR Assignments and Solution Conformation of Apokedarcidin",\N
4037,"4037","1997-06-18",\N,"Secondary Structure and Backbone Resonance Assignments of the Periplasmic Cyclophilin Type Peptidyl-Prolyl Isomerase from Escherichia Coli",\N
4038,"4038","1997-12-31",\N,"Detailed NMR Analysis of the Heme-Protein Interactions in Component IV Glycera Dibranchiata Monomeric Hemoglobin-CO",\N
4039,"4039","1997-09-10",\N,"Assignments of the 1H, 15N and 13C resonances of the calcium-free form of the first C2-domain of synaptotagmin I",\N
4040,"4040","1997-11-30",\N,"Main-Chain NMR Assignments for AsiA",\N
4041,"4041","1997-09-10",\N,"Assignments of the 1H, 15N and 13C resonances of the calcium-bound form of the first C2-domain of synaptotagmin I",\N
4042,"4042","1997-07-14",\N,"Sequence-specific Assignment of the 1H and 15N Nuclear Magnetic Resonance Spectra of the Reduced Recombinant High-potential Iron-sulfur Protein I from Ectothiorhodospira halophila",\N
4043,"4043","1997-07-14",\N,"Solution Structure of an Old World-like Neurotoxin from the Venom of the New World Scorpion Centruroides sculpturatus Ewing",\N
4044,"4044","1997-07-14",\N,"Secondary Structure of Uracil-DNA Glycosylase Inhibitor Protein",\N
4045,"4045","1997-07-14",\N,"Solution Structure of the C-Terminal Single-Stranded DNA-Binding Domain of Escherichia Coli Topoisomerase I",\N
4046,"4046","1997-07-14",\N,"NMR Evidence for Similarities between the DNA-Binding Regions of Drosophila melanogaster Heat Shock Factor and the Helix-Turn-Helix and HNF-3/forkhead Families of Transcription Factors",\N
4047,"4047","1997-07-14",\N,"1H, 13C, 15N Resonance Assignments and Secondary Structure Analysis of the HU Protein from Bacillus stearothermophilus Using Two- and Three- Dimensional Double- and Triple-Resonance Heteronuclear Magnetic Resonance Spectroscopy",\N
4048,"4048","1997-07-14",\N,"Solution Structure of the tetrameric minimum transforming domain of p53",\N
4049,"4049","1997-07-14",\N,"Solution Structure of the Amino-Terminal Fragment of Urokinase-Type Plasminogen Activator",\N
4050,"4050","1998-02-24",\N,"1H, 13C, 15N Chemical Shift Assignments for Reduced Clostridium Pasteurianum Rubredoxin",\N
4051,"4051","1998-02-24",\N,"1H, 13C, and 15N Chemical Shift Assignments for Oxidized Clostridium pasteurianum Rubredoxin",\N
4052,"4052","2002-06-03",\N,"Solution structures of Staphylococcal Nuclease from multidimensional, multinuclear NMR: nuclease-H124L and its ternary complex with Ca2+ and Thymidine-3'-5'-bisphosphate",\N
4053,"4053","2002-06-03",\N,"Solution structures of Staphylococcal Nuclease from multidimensional, multinuclear NMR: nuclease-H124L and its ternary complex with Ca2+ and Thymidine-3'-5'-bisphosphate",\N
4054,"4054","1998-05-03",\N,"Alpha-Helical Coiled Coil Trimerization Domain of Chicken Cartilage Matrix Protein (Reduced C5-C7 Disulfide Bonds)",\N
4055,"4055","1998-05-09",\N,"Alpha-Helical Coiled Coil Trimerization Domain of Chicken Cartilage Matrix Protein (Oxidized)",\N
4056,"4056","1998-09-03",\N,"Solution Structure of Calmodulin-W-7 Complex: The Basis of Diversity in Molecular Recognition",\N
4057,"4057","1998-05-03",\N,"Three-Dimensional Structures of Three Engineered Cellulose-Binding Domains of Cellobiohydrolase I from Trichoderma reesei",\N
4058,"4058","1998-05-03",\N,"Three-Dimensional Structures of Three Engineered Cellulose-Binding Domains of Cellobiohydrolase I from Trichoderma reesei",\N
4059,"4059","1998-05-03",\N,"Three-Dimensional Structures of Three Engineered Cellulose-Binding Domains of Cellobiohydrolase I from Trichoderma reesei",\N
4060,"4060","1998-02-06","2007-03-26","Multinuclear Backbone NMR Resonance Assignments and the Secondary Structure of Escherichia coli Thioesterase/Protease I - A Member of a New Subclass of Lipolytic Enzymes",\N
4061,"4061","1998-05-03",\N,"Overexpression of Myoglobin and Assignment of Its Amide, C Alpha and C Beta Resonances",\N
4062,"4062","1998-05-05",\N,"1H and 15N Resonance Assignments and Secondary Structure of the Carbon Monoxide Complex of Sperm Whale Myoglobin",\N
4063,"4063","1998-05-03",\N,"Resonance Assignments for Oncostatin M, a 24-kDa Alpha-Helical Protein",\N
4064,"4064","1998-01-14",\N,"Assignments, Secondary Structure and Dynamics of the Inhibitor-Free Catalytic Fragment of Human Fibroblast Collagenase",\N
4065,"4065","1998-10-14",\N,"Sequence-Specific Resonance Assignments for a Designed Four-Alpha-Helix-Bundle Protein",\N
4066,"4066","1998-06-18",\N,"Amplification of One-Bond 1H/2H Isotope Efects on 15N Chemical Shifts in Clostridium pasteurianum Rubredoxin by Fermi-Contact Effects through Hydrogen Bonds --Fe(III)",\N
4067,"4067","1998-03-05","2005-10-20","Complete 1H and Partial 13C Resonance Assignments at 37 and 22 C for Brazzein, an Intensely Sweet Protein",\N
4068,"4068","1998-05-01",\N,"Assignment of 1H, 13C, and 15N Signals of Turkey Ovomucoid Third Domain at pH 2.0",\N
4069,"4069","1998-01-09",\N,"Secondary Structure Determination of 15N-Labelled Human Long-[Arg-3]-Insulin-Like Growth Factor-I by Multidimensional NMR Spectroscopy",\N
4070,"4070","1998-07-15",\N,"Sequence-Specific 1H, 15N and 13C Assignments of the Periplasmic Chaperone FimC from Escherichia coli",\N
4071,"4071","1998-02-27",\N,"1H Chemical Shift Assignments and Interproton 3JNHA Coupling Constants of Raphanus sativus Antifungal Protein 1 (Rs-AFP1), a Plant Defensin Isolated from Seeds of Radish",\N
4072,"4072","1998-02-23",\N,"Sequence Specific 1HA, 15N, 13CA, and 13CB Assignments for RNA-1 Modulator Protein ROM",\N
4073,"4073","1999-08-20","2007-03-26","Backbone 1H, 13C and 15N Chemical Shift Assignments for Oxidized Human Ferredoxin",\N
4074,"4074","1999-08-20","2007-03-26","Backbone 1H, 13C and 15N Chemical Shift Assignments for Reduced Human Ferredoxin",\N
4075,"4075","1998-10-12",\N,"Backbone NMR Assignments and Secondary Structure of the N Terminal Domain of DnaB Helicase from E. coli",\N
4076,"4076","1998-12-17",\N,"1H, 15N, 13C Chemical Shift Assignments of Outer Surface Protein A from Borrelia burgdorferi",\N
4077,"4077","1997-12-17",\N,"1H, 13C, 15N Assignments and Secondary Structure of the FK506 Binding Protein When Bound to Ascomycin",\N
4078,"4078","1997-12-17",\N,"1H, 15N and 13C Resonance Assignments and Secondary Structure of Group II Phospholipase A2 from Agkistrodon piscivorus piscivorus: Presence of an Amino-Terminal Helix in Solution",\N
4079,"4079","1997-12-17",\N,"Structure of the A-Domain of HMG1 and Its Interaction with DNA As Studied by Heteronuclear Three- and Four-Dimensional NMR Spectroscopy",\N
4080,"4080","1997-12-17",\N,"NMR Solution Structure of Calcium-Saturated Skeletal Muscle Troponin C",\N
4081,"4081","1998-03-20",\N,"Sequence-specific 1H, 13C and 15N NMR Assignments of Recombinant Human Interferon Alpha-2a",\N
4082,"4082","1998-01-05",\N,"Characterization of the Three-Dimensional Solution Structure of Human Profilin: 1H, 13C, and 15N NMR Assignments amd Global Folding Pattern",\N
4083,"4083","1998-01-05",\N,"Assignments, Secondary Structure, Global Fold, and Dynamics of Chemotaxis Y Protein Using Three- and Four-Dimensional Heteronuclear (13C, 15N) NMR Spectroscopy",\N
4084,"4084","1998-01-05",\N,"Determination of the Secondary Structure and Folding Topology of an RNA Binding Domain of Mammalian hnRNP A1 Protein Using Three-Dimensional Heteronuclear Magnetic Resonance Spectroscopy",\N
4085,"4085","1998-01-05",\N,"Resonance Assignments and Solution Structure of the Second RNA-Binding Domain of Sex-lethal Determined by Multidimensional Heteronuclear Magnetic Resonance",\N
4086,"4086","1998-01-05",\N,"Tumor Suppressor p16ink4a: Structural Characterization of Wild-Type and Mutant Proteins by NMR and Circular Dichroism",\N
4087,"4087","1998-10-12",\N,"E2 DNA-binding domain from papillomavirus bpv-1",\N
4088,"4088","2001-07-05",\N,"Solution Structure of Compstatin, a Potent Complement Inhibitor",\N
4089,"4089","1999-06-09",\N,"Peptide Deformylase Catalytic Core (Residues 1 - 147)",\N
4090,"4090","2000-04-04",\N,"Solution NMR Structure of the I gamma Subdomain of the Mu end DNA Binding Domain of Mu Phage Transposase, Minimized Average Structure",\N
4091,"4091","1998-03-14",\N,"1H, 15N, 13C, and 13CO Assignments and Secondary Structure Determination of Basic Fibroblast Growth Factor using 3D Heteronuclear NMR Spectroscopy",\N
4092,"4092","1998-06-09",\N,"Complete Heteronuclear NMR Resonance Assignments, Secondary Structure, and Mapping of Core Binding Factor a Binding Site for Core Binding Factor b (1-141)",\N
4093,"4093","1998-03-02",\N,"Secondary Structure of the Ribonuclease H Domain of the Human Immunodeficiency Virus Reverse Transcriptase in Solution Using Three-Dimensional Double and Triple Resonance Heteronuclear Magnetic Resonance Spectroscopy",\N
4094,"4094","1998-03-02",\N,"1H, 15N, and 13CO Assignments of Human Interleukin-4 Using Three Dimensional Double- and Triple-Resonance Heteronuclear Magnetic Resonance Spectroscopy",\N
4095,"4095","1998-09-04",\N,"From Genetic to Structural Characterization of a New Class of RNA-Binding Domain Within the SacY/BglG family of Antiterminator",\N
4096,"4096","1998-06-13","2007-03-26","Solution Structure and Backbone Dynamics of Component IV Glycera dibranchiata Monomeric Hemoglobin-CO",\N
4097,"4097","1999-01-25",\N,"Backbone 1H, 13C and 15N Chemical Shift Assignment for the HIV-1 RNase H Domain",\N
4098,"4098","1998-12-21",\N,"1H, 15N and 13C Resonance Assignments and Secondary Structure of Apo Liver Fatty Acid-Binding Protein",\N
4099,"4099","1998-08-12",\N,"The Ca2+-Dependent Interaction of S100B(bb)with a Peptide Derived from p53",\N
4100,"4100","1999-03-22",\N,"Resonance Assignments of the Mrf-2 DNA-binding Domain",\N
4101,"4101","1998-07-15",\N,"1H, 13C, and 15N Resonance Assignments of Fusarium Solani Pisi Cutinase and Preliminary Features of the Structure in Solution",\N
4102,"4102","1998-10-09",\N,"1H, 13C and 15N NMR Backbone Assignments of 25.5 KDa Metallo-beta-lactamase",\N
4103,"4103","1998-07-14","2010-07-15","1H, 13C and 15N Chemical Shift Assignments of the 14mer DNA Duplex BS2",\N
4104,"4104","1998-07-14","2010-07-15","1H, 13C and 15N Chemical Shift Assignments of the 14mer DNA Duplex BS2 in the Complex with the Antennapedia Homeodomain",\N
4105,"4105","1999-03-22",\N,"1H, 13C, and 15N Resonance Assignments for Reduced Calcium-Bound S100B from Rat",\N
4106,"4106","2000-06-19",\N,"Solution Structure of the 30 Kda N-terminal Domain of Enzyme I of the Escherichia coli Phosphoenolpyruvate:Sugar Phosphotransferase System by Multidimensional NMR",\N
4107,"4107","1998-03-04",\N,"Acid Denatured Cold Shock Protein A (CspA)",\N
4108,"4108","1998-03-04",\N,"Acid/Urea denatured cold shock protein A (CspA)",\N
4109,"4109","1999-02-02",\N,"Sequence Specific 1H, 13C and 15N Resonance Assignment of Rat CD2 Domain 1",\N
4110,"4110","1998-10-14",\N,"1H, 13C, 15N Resonance Assignment of the 20 KDa Double Stranded RNA Binding Domain of PKR",\N
4111,"4111","1999-01-21",\N,"Sequential Assignment of the Triple Labelled 30 kDa Cell-adhesion Domain from Enteropathogenic E.coli",\N
4112,"4112","1999-02-02",\N,"Sequence-specific 1H Assignment and Secondary Structure of the Bacteriocin AS-48 Cyclic Peptide.",\N
4113,"4113","1999-02-22",\N,"1H, 13C, and 15N NMR Resonance Assignments of Vaccinia Glutaredoxin-1 in the Fully Reduced Form",\N
4114,"4114","2001-07-09",\N,"Chicken B-MYB DNA Binding Domain, Repeat 2 and Repeat 3",\N
4115,"4115","1999-02-24","2006-10-30","Assignment of 1H, 13C and 15N Signals of the Inhibitor Protein Im9 Bound to the DNase Domain of Colicin E9",\N
4116,"4116","1999-02-24","2006-10-30","1H, 13C and 15N Chemical Shift Assignments of the Colicin E9 Immunity Protein from Escherichia coli",\N
4117,"4117","1999-02-02",\N,"1H, 15N and 13C Chemical Shift Assignment of the Guanine Nucleotide Exchange Domain of Human Elongation Factor-one Beta",\N
4120,"4120","2001-06-19",\N,"NMR Structure of a Classical Pseudoknot: Interplay of Single- and Double-Stranded RNA",\N
4121,"4121","1998-10-09",\N,"1H, 13C and 15N Assignment of the Isl-1 Homeodomain",\N
4122,"4122","1999-02-02",\N,"Solution Structure of the Human Hck SH3 Domain and Identification of its Ligand Binding Site",\N
4123,"4123","1999-02-02",\N,"Main-chain Signal Assignment for the PDZ2 Domain from Human Protein Tyrosine Phosphatase hPTP1E and its Complex with a C-terminal Peptide from the Fas Receptor",\N
4124,"4124","1999-02-02",\N,"Main-chain Signal Assignment for the PDZ2 Domain from Human Protein Tyrosine Phosphatase hPTP1E and its Complex with a C-terminal Peptide from the Fas Receptor",\N
4125,"4125","1998-04-07",\N,"The NMR Structure of 31mer RNA Domain of Escherichia Coli RNase P RNA Using Its Non-uniformly Deuterium Labelled Counterpart [the 'NMR-window' concept]",\N
4126,"4126","1999-08-06",\N,"Solution Structure and Dynamics of a De Novo Designed Three-helix Bundle Protein",\N
4127,"4127","1999-03-04",\N,"Sequence-specific 1H, 13C, and 15N Resonance Assignment of the Origin DNA-binding Domain of SV40 T Antigen",\N
4128,"4128","1999-02-03",\N,"NMR Backbone Assignments of the Cyanobacterial Transcriptional Factor, SmtB, that Senses the Zinc Concentration in the Cell",\N
4129,"4129","2000-04-03",\N,"1H and 15N Resonance Assignment of the Calcium-bound Form of the Nereis Diversicolor Sarcoplasmic Calcium(2+)-binding Protein.",\N
4130,"4130","1998-08-12",\N,"1H, 15N, 13C Chemical Shifts of Recombinant Rat Ferrocytochrome b5, A conformation",\N
4131,"4131","1998-08-12",\N,"1H, 15N, 13C chemical shifts of recombinant rat ferrocytochrome b5, B conformation",\N
4132,"4132","1999-05-25",\N,"Backbone Resonance Assignments of Human UBC9",\N
4133,"4133","1998-10-01","2006-06-12","The Structure of the N-terminus of Striated Muscle Alpha-Tropomyosin in a Chimeric Peptide: Solution Nuclear Magnetic Resonance Structure and Circular Dichroism Studies.",\N
4134,"4134","1999-05-28",\N,"NMR Assignments for Denatured LysN",\N
4135,"4135","2000-12-15",\N,"Assignments of a RNA Duplex Including the C-U Mismatch: Unusual Chemical Shifts of a Cytidine Amino Group in the C-U Pair.",\N
4136,"4136","1998-06-30",\N,"Chemical Shift Assignments, 3JHNHA Coupling Constants and Secondary Structure of E.coli Multidrug Resistance Protein (EmrE)",\N
4137,"4137","1998-06-18",\N,"Amplification of One-Bond 1H/2H Isotope Efects on 15N Chemical Shifts in Clostridium pasteurianum Rubredoxin by Fermi-Contact Effects Through Hydrogen Bonds --Fe(II)",\N
4138,"4138","1998-06-15",\N,"Proton Resonance Assignments of RC-RNase",\N
4140,"4140","1999-02-03",\N,"Sequence-specific 1H, 13C and 15N Assignment of the EH1 Domain of Mouse Eps15",\N
4141,"4141","2001-03-07","2010-07-14","vnd/NK-2 Homeodomain DNA Complex Protein 1H, 13C, and 15N Chemical Shifts and HNHA Coupling Constant",\N
4142,"4142","1999-03-01",\N,"1H Chemical Shift Assignments of the Complex between Palmitate and a Non-Specific Lipid Transfer Protein (ns-LTP1) Isolated from Barley Seeds",\N
4143,"4143","2000-03-02",\N,"1H and 15N Resonance Assignment of Neural Cell Adhesion Molecule module 2",\N
4144,"4144","1998-10-05",\N,"1H, 13C, 15N Sequential Assignment of the RNA Polymerase 'H' Subunit from Methanococcus jannaschii",\N
4145,"4145","1999-02-03",\N,"Assignment of 1H and 15N Resonances of Murine Tec SH3 Domain",\N
4146,"4146","1998-08-14",\N,"Solution Structure of the Transmembrane H+-Transporting Subunit c of the F1Fo ATP Synthase",\N
4147,"4147","1999-02-03",\N,"Resonance Assignment and Secondary Structure of the Cold Shock Domain of the Human YB-1 Protein",\N
4148,"4148","2000-03-02",\N,"Solution Structure of the Cellulose-binding Domain of Endoglucanase I from Trichoderma reesei and Its Interaction with Cello-oligosaccharides",\N
4149,"4149","1999-02-03",\N,"Solution Structure of Gallium-Substituted Putidaredoxin Mutant: GaPdx C85S",\N
4150,"4150","2000-04-04",\N,"The Signal Transducer gp130: Solution Structure of the Carboxy-terminal Domain of the Cytokine Receptor Homology Region",\N
4151,"4151","2000-03-02",\N,"1H, 13C, and 15N Assignment and Secondary Structure of the High pH Form of Subunit c of the F1FO ATP Synthase",\N
4152,"4152","2000-03-02",\N,"1H, 13C and 15N Backbone Resonance Assignment of Escherichia coli Adenylate Kinase, a 23.6 kDa Protein",\N
4153,"4153","2000-06-30",\N,"High-Resolution Solution Structure of the Retinoid X Receptor DNA-Binding Domain",\N
4154,"4154","1999-08-11",\N,"13C and Stereospecific 13C and 1H Resonance Assignments for Oxidized Putidaredoxin",\N
4155,"4155","1999-03-01",\N,"Solution Structure of Eotaxin: A Chemokine that Selectively Recruits Eosinophils in Allergic Inflammation",\N
4156,"4156","1999-08-06",\N,"The Structure in Solution of the b Domain of Protein Disulfide Isomerase",\N
4157,"4157","2000-02-03",\N,"Three-dimensional Solution Structure of Lactoferricin B, an Antimicrobial Peptide Derived from Bovine Lactoferrin",\N
4158,"4158","2000-03-08",\N,"1H and 15N Nuclear Magnetic Resonance Chemical Shifts of the Cytotoxic Ribonuclease Alpha-sarcin",\N
4159,"4159","2000-03-02",\N,"Solution Structure of LSIII, a Long Neurotoxin from the Venom of Laticauda semifasciata",\N
4160,"4160","2000-02-23",\N,"Resonance Assignments of the Tn916 Integrase DNA-Binding Domain and Integrase: DNA Complex",\N
4161,"4161","2000-03-21",\N,"1H, 13C and 15N Assignment of the DNA Binding Domain of Interferon Regulatory Factor-2",\N
4162,"4162","2000-03-08",\N,"1H, 13C and 15N Resonance Assignment of the Neural Cell Adhesion Molecule Module-1",\N
4163,"4163","2000-02-25",\N,"1H Chemical Shift Assignments and Interproton 3JNHA and 3JHAHB Coupling Constants of Aesculus hippocastanum Antimicrobial Protein 1 (Ah-AMP1), a Plant Defensin Isolated from Horse Chestnuts.",\N
4164,"4164","2002-06-11",\N,"Bacterial Iron Transport: 1H NMR Determination of the Three-dimensional Structure of the Gallium Complex of Pyoverdin G4R, the Peptidic Siderophore of Pseudomonas putida G4R",\N
4165,"4165","2000-03-16","2010-07-14","1H, 13C, and 15N Chemical Shift Assignments for Tn916 N-terminal DNA Binding Domain complex with DNA",\N
4166,"4166","2000-03-27",\N,"Backbone H, CA, N Chemical Shift Assignments for C2A/Ca2+ Binary Complex",\N
4167,"4167","2000-03-27",\N,"Backbone H, CA, N chemical shift assignments for C2A/Ca2+/6PS ternary complex",\N
4168,"4168","2000-03-27",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for the Receptor Binding Domain of Human Alpha-2-macroglobulin",\N
4169,"4169","2002-06-11",\N,"Bacterial Iron Transport: 1H NMR Determination of the Three-dimensional Structure of the Gallium Complex of Pyoverdin G4R, the Peptidic Siderophore of Pseudomonas putida G4R",\N
4170,"4170","2000-03-31","2010-07-19","2'-Deoxy-Isoguanosine Base Paired to Thymidine, NMR Minimized Average Structure",\N
4171,"4171","2000-03-02",\N,"Backbone and C beta Assignments of the Anti-gp120 Antibody Fv Fragment Complexed with an Antigenic Peptide",\N
4172,"4172","2000-12-14","2010-07-15","Response Element of the Orphan Nuclear Receptor Rev-erb Beta",\N
4173,"4173","2000-04-03",\N,"Solution Structure of the Catalytic Domain of Human Stromelysin-1 Complexed to a Potent, Non-peptidic Inhibitor",\N
4174,"4174","2000-04-03",\N,"Chemical Shift Assignments of the Mg2+-Loaded State of the N-Terminal Domain of Calmodulin",\N
4175,"4175","2000-04-04",\N,"SL3 Hairpin from the Packaging Signal of HIV-1",\N
4176,"4176","2000-03-20","2010-07-19","NMR Solution Structure of a DNA Dodecamer Containing Single G:T Mismatches",\N
4177,"4177","2001-03-01",\N,"Monocyte Chemoattractant Protein-3",\N
4179,"4179","1999-12-23",\N,"1H Chemical Shift Assignments for the Peptide H1a",\N
4180,"4180","1999-12-23",\N,"1H Chemical Shift Assignments for the Peptide L1",\N
4181,"4181","2000-07-08",\N,"The Solution Structure of Parsley [2Fe-2S] Ferredoxin",\N
4182,"4182","2001-08-09",\N,"Solution Structure of Reduced Clostridium pasteurianum Rubredoxin",\N
4183,"4183","1999-03-01",\N,"Expression and Assignment of 1H, 15N,and 13C Resonances of the C-terminal Domain of the Diphtheria Toxin Repressor",\N
4184,"4184","2000-01-11",\N,"Structure and Asn-Pro-Phe Binding Pocket of the Eps15 Homology Domain",\N
4185,"4185","1999-12-23",\N,"1H Chemical Shift Assignments for Gurmarin",\N
4186,"4186","2000-03-08",\N,"NMR Solution Structure of Human Cellular Retinoic Acid Binding Protein-Type II",\N
4187,"4187","2000-01-11","2010-07-16","Nuclear Magnetic Resonance Structure of d(GCATATGATAG).d(CTATCATATGC): A Consensus Sequence for Promoters Recognized by Sigma-K RNA Polymerase",\N
4188,"4188","2000-03-08",\N,"C2 Domain of Cytosolic Phospholipase A2",\N
4189,"4189","2000-03-08",\N,"Solution Structure of Reduced Horse Heart Cytochrome c",\N
4190,"4190","2000-04-04",\N,"BmTX1 Toxin from Scorpion Buthus martensii Karsch",\N
4191,"4191","2000-04-04",\N,"BmTX2 Toxin from Scorpion Buthus martensii Karsch",\N
4192,"4192","2000-04-04",\N,"Helical Structure of Polypeptides from the C-terminal Half of HIV-1 Vpr",\N
4193,"4193","1999-09-29",\N,"Sequence-Specific 1H, 15N and 13C Assignment of Adenylate Kinase from Escherichia coli in Complex with the Inhibitor AP5A",\N
4194,"4194","1999-12-23","2005-09-26","Structural Studies of D-Pro Melittin",\N
4195,"4195","2000-03-08",\N,"Solution NMR Structure of the Complex of Alpha-Bungarotoxin with a Library-Derived Peptide (NMR, Average Structure)",\N
4197,"4197","1999-11-24",\N,"Solution NMR Structures of the Major Coat Protein of Filamentous Bacteriophage M13 Solubilized in Sodium Docecyl Sulphate Micelles, 25 Lowest Energy Structures",\N
4198,"4198","1999-12-01",\N,"Three-dimensional Structure of an Evolutionarily Conserved N-terminal Domain of Syntaxin 1A",\N
4199,"4199","1999-12-22",\N,"Determination of the Solution Structure of the N-Domain Plus Linker of Antarctic Eel Pout Antifreeze Protein RD3",\N
4200,"4200","2000-03-23",\N,"NMR Solution Structure of the c-Myc-Max Heterodimeric Leucine Zipper",\N
4201,"4201","2000-03-08",\N,"Role of the 6-20 Disulfide Bridge in the Structure and Activity of Epidermal Growth Factor",\N
4202,"4202","2000-04-04",\N,"Solution Structure of Reduced Monomeric Q133M2 Copper, Zinc Superoxide Dismutase(SOD). Why SOD is a Dimeric Enzyme?",\N
4203,"4203","2000-03-08",\N,"An NMR Conformational Analysis of Synthetic Peptide Cn2(1-15)NH2-S-S-AcetylCn2(52-66)NH2 from the New World Centruroides Noxius 2(Cn2) Scorpion Toxin. Comparison of the Structure with those of the Centruroides Scorpion Toxins.",\N
4204,"4204","1999-12-22",\N,"Three-Dimensional Structure of Human Insulin-Like Growth Factor-I (IGF-I) Determined by 1H-NMR and Distance Geometry",\N
4205,"4205","1999-12-22",\N,"Structure of the Ets-1 Pointed Domain and Mitogen-activiated Protein Kinase Phosphorylation Site.",\N
4206,"4206","2000-03-10",\N,"Solution NMR Structure of Linked Cell Attachment Modules of Mouse Fibronectin Containing the RGD and Synergy Regions, 20 Structures",\N
4207,"4207","2000-03-10",\N,"CRO Repressor Insertion Mutant K56-[DGEVK]",\N
4208,"4208","2000-04-05","2007-07-13","The Y64A Mutant of Cytochrome c553 from Desulfovibrio vulgaris Hildenborough",\N
4209,"4209","2000-02-03",\N,"Solution NMR structures of the major coat protein of filamentous bacteriophage M13 solubilized in Dodecyl Phosphocholine micelles, 25 lowest energy structures",\N
4210,"4210","2000-03-10",\N,"DNA-binding domain of human telomeric protein, hTRF1",\N
4211,"4211","2002-03-29","2007-06-19","Ragweed pollen allergen from Ambrosia trifida V",\N
4212,"4212","2000-02-23",\N,"Synthetic peptide corresponding to the major immunogen site of FMD virus",\N
4213,"4213","2000-03-10",\N,"Retro-inverso analogue of G-H loop of VP1 in FMD virus",\N
4214,"4214","2000-06-17",\N,"N-terminal Domain of Tissue Inhibitor of Metalloproteinase-2 (N-TIMP-2)",\N
4215,"4215","2000-10-02",\N,"Staphylokinase (NMR, Sakstar Variant)",\N
4216,"4216","2000-04-04",\N,"Structure of Transcriptional Activation Domain of CRE-BP1/ATF-2",\N
4217,"4217","2000-04-04",\N,"The 3D structure of the streptomyces metalloproteinase inhibitor, SMPI, isolated from streptomyces nigrescens TK-23",\N
4218,"4218","2000-05-04",\N,"Solution structure of toxin 2 from centruroides noxius hoffmann,a beta scorpion neurotoxin acting on sodium channels",\N
4219,"4219","1999-12-06","2007-07-13","Effects of Glycosylation on the Structure and Dynamics of Eel Calcitonin",\N
4220,"4220","2000-04-07",\N,"HIV-1 capsid protein major homology region peptide analog",\N
4221,"4221","2000-06-17",\N,"Solution Structures of Human Immunodeficiency Virus Type 1 (HIV-1) and Moloney Murine Leukemia Virus (MoMLV) Capsid Protein Major Homology Region Peptide Analogs by NMR Spectroscopy",\N
4222,"4222","2000-05-01",\N,"High-Resolution Solution Structure of a Sweet Protein Single-Chain Monellin (SCM) determined by Nuclear Magnetic Resonance Spectroscopy and Dynamical Simulated Annealing Calculations",\N
4223,"4223","1999-12-06",\N,"Solution Structure of a TBP-TAFII230 Complex: Protein Mimicry of the Minor Groove Surface of the TATA Box Unwound by TBP",\N
4224,"4224","2000-07-05","2012-10-31","Solution Structure of Myotrophin",\N
4225,"4225","2000-03-09",\N,"NMR structure of Escherichia coli glutaredoxin3-glutathione mixed disulfide complex",\N
4226,"4226","1999-12-23",\N,"The Lead-Dependent Ribozyme",\N
4227,"4227","2001-07-09",\N,"NMR structures (20) of the J-domain (residues 1-77) of the Escherichia coli N-terminal fragment (residues 1-78) of the Molecular Chaperone DNAJ",\N
4228,"4228","2001-07-09",\N,"NMR structures (20) of the J-Domain (residues 1-77) of the Escherichia coli n-terminal fragment (residues 1-104) of the molecular chaperone DNAJ",\N
4229,"4229","2000-05-01",\N,"Artificial Fe8S8 ferredoxin: the D13C variant of Bacillus schlegelii Fe7S8 ferredoxin",\N
4230,"4230","2000-04-18","2007-07-13","Solution Structure of delta-5-3-Ketosteroid Isomerase Complexed with the Steroid 19-Nortestosterone- Hemisuccinate",\N
4231,"4231","2001-07-09",\N,"Artificial Fe8S8 ferredoxin: the D13C variant of Bacillus schlegelii Fe7S8 ferredoxin",\N
4232,"4232","1999-05-25",\N,"N-Domain of Troponin C from Chicken Skeletal Muscle.",\N
4233,"4233","1998-12-21",\N,"1H Chemical Shift Assignments for Omega-Atracotoxin-Hv1a",\N
4234,"4234","1998-12-21",\N,"1H Chemical Shift Assignments for Delta-Atracotoxin-Hv1 (Versutoxin)",\N
4235,"4235","1999-02-08","2010-07-19","NMR Solution Structure of [d(GCGAATTCGC)2]",\N
4236,"4236","2000-12-18",\N,"Sequence-specific Resonance Assignments for the NADP(H)-binding Component (domain III) of Proton-translocating Transhydrogenase from Rhodospirillum rubrum.",\N
4237,"4237","1999-12-23",\N,"Backbone and side-chain 1H, 15N, and 13C Assignments for the Topological Specificity Domain of the MinE cell Division Protein",\N
4239,"4239","2000-03-17",\N,"Sequence-specific 1H, 13C and 15N assignment of the single-stranded DNA binding protein of the bacteriophage f29",\N
4240,"4240","2000-05-01","2010-07-19","Minor conformer of a benzo[a]pyrene diol epoxide adduct of DA in duplex DNA",\N
4241,"4241","1999-11-29",\N,"1H and 15N Assignments of Internal xylan binding domain from XYLD",\N
4242,"4242","1999-01-25",\N,"Motile Major Sperm Protein (MSP) of Ascaris suum",\N
4243,"4243","2000-05-01","2010-07-19","Intercalated d(TCCCGTTTCCA) dimer",\N
4244,"4244","2000-03-02","2010-07-19","NMR Solution Structure of [d(GCGAAT-3'-3'-alphaT-5'-5'-CGC)2]",\N
4245,"4245","1999-09-15",\N,"Assessing Potential Bias in the Determination of Rotational Correlation Times of Proteins by NMR Relaxation",\N
4246,"4246","2000-05-02",\N,"3D Structure of the M8L Mutant of Squash Trypsin Inhibitor CMTI-I, NMR, 6 Structures",\N
4247,"4247","1999-09-27","2010-07-16","1H Chemical Shift Assignments of the 8mer Chimeric Hybrid Duplex r(GCAGUGGC).r(RCCA)d(CTGC)",\N
4248,"4248","1999-11-23","2010-07-14","LEF1 HMG Domain (From Mouse), Complexed with DNA (15bp), NMR, 12 Structures",\N
4249,"4249","1999-08-06",\N,"Solution Structure of the DNA- and RPA-binding Domain of the Human Repair Factor XPA",\N
4250,"4250","2000-02-25",\N,"Structure of the 3' hairpin of the TYMV pseudoknot: Preformation in RNA folding",\N
4251,"4251","1999-11-26",\N,"Triple Resonance Assignment for Abl SH(32) and One in the Complex with a Consolidated Ligand",\N
4252,"4252","1999-11-26","2007-07-13","Triple Resonance Assignment for Abl SH(32) and One in the Complex with a Consolidated Ligand",\N
4253,"4253","1999-11-29",\N,"An Examination of Coaxial Stacking of Helical Stems in a Pseudoknot Motif: the Gene 32 Messenger RNA Pseudoknot of Bacteriophage T2",\N
4254,"4254","1999-10-26",\N,"1H, 15N and 13C Assignments of the DNA Binding Domain of Transcription Factor Mbp1 from Sassharomyces cerevisiae in Both Its Free and DNA Bound Forms and 1H Assignments of the Free DNA",\N
4255,"4255","1999-11-23",\N,"Human Translation Initiation Factor eIF1",\N
4256,"4256","1999-11-23","2010-07-14","1H, 15N and 13C Assignments of the DNA Binding Domain of Transcription Factor Mbp1 from S. cerevisiae in Both Its Free and DNA Bound Forms, and 1H Assignments of the Free DNA",\N
4257,"4257","1999-11-23",\N,"(52-96)C-Terminal Domain of the HIV-1 Regulatory Protein VPR",\N
4258,"4258","1999-11-23","2010-07-19","1H Chemical Shift Assignments of the Palindromic 12mer d(TTTGACGCGTCAA)2 (MCB12T) which Contains the Recognition Site for the Yeast Transcription Factor Mbp1.",\N
4259,"4259","1999-11-23",\N,"Sequential Assignment and Solution Secondary Structure of Doubly Labelled Ribonuclease Sa",\N
4260,"4260","1999-11-29",\N,"Effects of Glycosylation on the Structure and Dynamics of Eel Calcitonin in Micelles and Lipid Bilayers Determined by NMR Spectroscopy",\N
4261,"4261","1999-12-03",\N,"Effects of Glycosylation on the Structure and Dynamics of Eel Calcitonin in Micelles and Lipid Bilayers Determined by NMR Spectroscopy",\N
4262,"4262","2000-03-02","2007-07-13","NMR SOLUTION STRUCTURE AND DYNAMICS OF THE COMPLEX OF LACTOBACILLUS CASEI DIHYDROFOLATE REDUCTASE WITH THE NEW LIPOPHILIC ANTIFOLATE DRUG TRIMETREXATE",\N
4263,"4263","1999-10-05",\N,"dNumb PTB Domain Complexed with a Phosphotyrosine Peptide, NMR, Ensemble of Structures.",\N
4264,"4264","2000-05-02",\N,"Complex of the amino terminal domain of enzyme I and the histidine-containing phosphocarrier protein HPr from Escherichia coli nmr, restrained regularized mean structure",\N
4265,"4265","1999-09-27",\N,"1H, 15N and 13C Resonance Assignments for the 22KDa LC1 Light Chain from Chlamydomonas Outer Arm Dynein",\N
4266,"4266","1999-10-05",\N,"The Solution Structure of a Superpotent B-chain-shortened Single-replacement Insulin Analogue",\N
4267,"4267","1999-10-12",\N,"Chemical shift assignments, 3JHNHA coupling constants and secondary structure of HNGAL (Human Neutrophil Gelatinase-Associated Lipocalin) in its apo form.",\N
4268,"4268","1999-10-14",\N,"7-Fe Ferredoxin from Bacillus Schlegelii",\N
4269,"4269","1999-10-14",\N,"1H, 15N and 13C Chemical Shift Assignments for the Catalytic Core of Resolvase",\N
4270,"4270","1999-10-05","2007-07-13","Chemical Shift Assignment of Ca2+/calmodulin (1H, 13C, and 15N) Complexed with Its Binding Domain from Rat Ca2+/calmodulin Dependent Protein Kinase Kinase (1H).",\N
4271,"4271","2000-05-25",\N,"Sequence Specific 1H, 13C and 15N Assignments of a Calcium Binding Protein from Entamoeba Histolytica",\N
4272,"4272","1999-10-26",\N,"1H, 15N, 13C Resonance Assignments of SynaptobrevinII",\N
4273,"4273","1999-11-26",\N,"Candidacidal Activity Prompted by N-terminus Histatin-like Domain of Human Salivary Mucin (MUC7)",\N
4276,"4276","2000-06-17",\N,"Solution Structure and Dynamics of the Plasminogen Kringle 2-AMCHA Complex: 3/1-Helix in Homologous Domains",\N
4278,"4278","2001-02-21",\N,"Backbone 1H and 15N Chemical Shift Assignments for Long-[L60]-IGF-I, an Insulin-Like Growth Factor 1 Analogue (IGF-I)",\N
4279,"4279","1999-09-27","2005-11-10","Solution Structure of a beta-Neurotoxin from the New World Scorpion Centruroides sculpturatus Ewing",\N
4280,"4280","1999-10-06",\N,"Sequence Specific 1H, 13C and 15N Assignment of the Methyl Binding Domain of the Methyl-CpG-binding Protein MeCP2.",\N
4281,"4281","2000-01-11","2005-08-17","Backbone and Side Chain 1H, 13C, and 15N Chemical Shift Assignments for AbrBN",\N
4282,"4282","2000-05-03",\N,"1H, 15N, and 13C Resonance Assignments for the N-terminal 20 kDa Domain of the DNA Single-Strand Break Repair Protein XRCC1",\N
4283,"4283","1999-10-01",\N,"NMR Structure of the Angiogenesis Marker Oncofoetal Fibronectin ED-B Domain",\N
4284,"4284","1999-10-01",\N,"NMR Solution Structure of a Complex of Calmodulin with a Binding Peptide of the Ca2+-Pump",\N
4285,"4285","1999-10-01",\N,"1H, 13C and 15N NMR Sequence-Specific Resonance Assignments for Rat Apo-S100A1(aa).",\N
4286,"4286","1999-10-01",\N,"1H and 15N Chemical Shift Assignments of the Unstructured Yeast Vesicular SNARE Snc1.",\N
4287,"4287","1999-10-05",\N,"1H and 15N Chemical Shift Assignments of the Unstructured Yeast Target Membrane SNARE Sso1.",\N
4288,"4288","1999-10-06",\N,"Sequence-specific 1H, 13C and 15N Assignment and Secondary Structure of the Apo EH2 Domain of Mouse Eps15.",\N
4289,"4289","2001-03-02",\N,"1H and 15N Chemical-Shift Assignments of a Carboxy-Terminal Functional Domain of the Bacteriophage P22 Scaffolding Protein",\N
4290,"4290","2000-10-30",\N,"Sequence-specific 1H Assignment of Antimicrobial Protein Tachycitin.",\N
4291,"4291","1999-03-15",\N,"Solution Structure of Desulfovibrio Vulgaris (Hildenborough) Ferrocytochrome C3: Structural Basis for Functional Cooperativity",\N
4292,"4292","2000-03-02",\N,"NMR Structure of PSP1, Plasmatocyte-spreading Peptide from Pseudoplusia includens",\N
4293,"4293","1999-03-09","2006-10-30","Assignment of 1H, 13C and 15N Signals of the DNase Domain of Colicin E9",\N
4294,"4294","2000-12-18",\N,"Resonance Assignments, Secondary Structure and 15N Relaxation data of the Human Transcriptional Coactivator hMBF1(57-148)",\N
4295,"4295","1999-02-12",\N,"Titin Module A71 from Human Cardiac Muscle",\N
4296,"4296","1999-02-10",\N,"1H, 13C, and 15N Chemical Shift Assignments for E. coli Cold-shock Protein A (CspA)",\N
4297,"4297","1999-02-22",\N,"Chemical Shifts (1H, 13C, 15N) and J-couplings (3JHNHA, 3JNHB, 3JHAHB) for the N-terminal Domain of E. coli DnaB Helicase, DnaB(24-136)",\N
4298,"4298","1999-03-10",\N,"A Synthetic Cyclic Peptide Corresponding to the Complete V3 Loop of the RF HIV-1 Strain in Water Solution",\N
4299,"4299","1999-08-12",\N,"1H, 13C and 15N Resonance Assignments of Escherichia coli 6-hydroxymethyl-7,8-dihydropterin Pyrophosphokinase and its Complex with MgAMPPCP",\N
4300,"4300","1999-08-12",\N,"1H , 13C, 15N Assigned Chemical Shifts for HPPK-AMPPCP Complex",\N
4301,"4301","1999-03-01",\N,"1H, 13C and 15N Chemical Shift Assignments of the Pathogenesis-related Protein P14a",\N
4302,"4302","1999-08-12",\N,"Assignment of 1H, 13C and 15N Resonances of the a' Domain of Protein Disulfide Isomerase",\N
4303,"4303","2000-12-14",\N,"Chemical Shift Assignment of Rb. sphearoides LH1b",\N
4304,"4304","2000-12-15",\N,"1H, 13C, and 15N Chemical Shift Assignment of the Extended Neuronal Nitric Oxide Synthase PDZ Domain Complexed with an Associated Peptide",\N
4305,"4305","2000-12-15",\N,"1H, 13C, 15N Assignment of PIN: A Protein Inhibitor of Neuronal Nitric Oxide Synthase",\N
4306,"4306","2000-08-16",\N,"Backbone NMR asignment of a cyanobacterial transcriptional factor, SmtB, that has bound zinc ions",\N
4307,"4307","2000-05-10",\N,"1H, 13C, and 15N Chemical Shift Assignments for SHa rPrP(90-231).",\N
4308,"4308","2000-01-05",\N,"1H and 15N Chemical Shift Assignments for Domain 4 of the Common Beta-Chain of the IL-3, IL-5 and GM-CSF Receptors",\N
4309,"4309","1999-08-12",\N,"Backbone NMR Assignment and Secondary Structure of the 19 kDa Hemophore HasA",\N
4310,"4310","2000-05-24",\N,"Calmodulin SEF2-1 Complex",\N
4311,"4311","1999-08-12",\N,"Sequence-Specific 1H, 13C and 15N Chemical Shift Assignment and Secondary Structure of the HTLV-I Capsid Protein",\N
4312,"4312","1999-03-03",\N,"1H, 15N and 13C Resonance Assignments for the Bromodomain of the Histone Acetyltransferase hsP/CAF",\N
4313,"4313","2000-01-05","2007-11-13","1H, 13C and 15N NMR Assignments for a Carbon Monoxide Generating Metalloenzyme from Klebsiella pneumoniae, Acireductone Dioxygenase (ARD)",\N
4314,"4314","1999-03-22",\N,"1H Assignments for the Human Chemokine HCC2",\N
4315,"4315","1999-03-10",\N,"Assignment of the Backbone of Oxidized Fe-superoxide Dismutase, a 42kDa Paramagnet- containing Enzyme",\N
4316,"4316","1999-05-27",\N,"1H, 13C and 15N Chemical Shift Assignements for Subunit c of the ATP Synthase from Propionigenium modestum",\N
4317,"4317","1999-06-11",\N,"1H, 13C, and 15N Chemical Shift Assignments for NS1(1-73)",\N
4318,"4318","1999-08-12",\N,"Assignment of 1H, 13C, and 15N Resonances of Reduced Escherichia coli Glutaredoxin 2",\N
4319,"4319","2001-09-09","2010-01-06","1H-15N and 1H-13C Dipolar Splittings and Calculated Dipolar Shifts for Oxidized Clostridium Pasteurianum Rubredoxin",\N
4320,"4320","2001-09-09","2010-01-06","1H-15N and 1H-13C Dipolar Splittings and Calculated Dipolar Shifts for Reduced Clostridium Pasteurianum Rubredoxin",\N
4321,"4321","2000-12-14",\N,"1H, 13C, and 15N Chemical Shift Assignments for the Catalytic Domain of Tetrahymena GCN5 Histone Acetyltransferase in Complex with CoA",\N
4322,"4322","1999-04-29","2007-03-26","1H Chemical Shift Assignment for the Complete Consensus V3 Loop Peptide of the Envelope Protein gp120 of HIV-1 in 20% Trifluoroethanol/Water.",\N
4323,"4323","2000-12-15",\N,"1H, 13C, 15N NMR backbone assignments of 37 kDa surface antigen OspC from Borrelia burgdorferi",\N
4324,"4324","1999-07-12",\N,"Characterization of Monomeric and Dimeric B-domain of Staphyococcal Protein A: Sources of Stabilization of a 3-helix Bundle Protein.",\N
4325,"4325","1999-09-13",\N,"Characterization of Monomeric and Dimeric B-domain of Staphylococcal Protein A.",\N
4326,"4326","1999-05-19",\N,"Complete 1H, 13C, and 15N Chemical Shift Assignments for the N-terminal Domain of DNA Polymerase B (residues 2-87).",\N
4327,"4327","1999-10-26",\N,"1H, 13C, and 15N Resonance Assignment and Secondary Structure of the N-terminal Inhibitory Domain of Human Tissue Inhibitor of Metalloproteinases-1",\N
4328,"4328","1999-09-13",\N,"1H, 13C, and 15N Chemical Shift Assignments for Human Rad51(1-114)",\N
4329,"4329","1999-10-26",\N,"Sequential Assignment and Secondary Structure Analysis of the NADP(H)-Binding Domain of Escherichia coli Transhydrogenase",\N
4330,"4330","2000-10-02",\N,"A Single-Chain T Cell Receptor",\N
4331,"4331","1999-05-24",\N,"Backbone 1H, 13C, and 15N Resonance Assignments of Streptomyces Subtilisin Inhibitor",\N
4332,"4332","1999-05-25",\N,"1H and 15N Chemical Shift Assignments for Recombinant Bovine Alpha-Lactalbumin",\N
4333,"4333","2000-12-15",\N,"The Three-dimensional Solution Structure and Dynamic Properties of the Human FADD Death Domain",\N
4334,"4334","1999-06-07",\N,"1H, 13C, 15N Resonance Assignments of ARID Domain of Dead-Ringer Protein.",\N
4335,"4335","1999-12-22",\N,"NMR Assignments, Secondary Structure and Global Fold of Calerythrin, an EF-hand Calcium-binding Protein from Saccharopolyspora erythraea.",\N
4336,"4336","1999-05-10","2007-11-02","Backbone and Sequence-Specific Assignment of Three Forms of the Lipoate Containing H-protein of the Glycine Decarboxylase Complex.",\N
4337,"4337","1999-05-10",\N,"Backbone and Sequence-Specific Assignment of Three Forms of the Lipoate-Containing H-protein of the Glycine Decarboxylase Complex.",\N
4338,"4338","1999-05-10",\N,"Backbone and Sequence-Specific Assignment of Three Forms of the Lipoate-Containing H-protein of the Glycine Decarboxylase Complex.",\N
4339,"4339","1999-09-10",\N,"1H, 13C, and 15N Chemical Shift Assignments for Yeast Ribosomal Protein L30 Free in Solution",\N
4340,"4340","2000-05-15",\N,"Complete 1H, 15N and 13C Assignment of a Recombinant Mouse Major Urinary Protein",\N
4341,"4341","1999-11-30",\N,"Assignment of the Backbone Resonances of Oxidized Fe-superoxide Dismutase, a 42 kDa Paramagnet-containing Enzyme",\N
4342,"4342","2000-01-05",\N,"Assignment of the 1H, 15N, and 13C Resonances of the C-terminal Domain of Frataxin, the Protein Involved in Friedreich Ataxia.",\N
4343,"4343","2003-01-06",\N,"Resonance assignment and topology of a 22 kDa C-terminal fragment of the polypyrimidine tract binding protein (PTB) containing two RNA binding domains",\N
4344,"4344","1999-05-25",\N,"1H and 15N Chemical Shift Assignments for Apo-CopZ",\N
4345,"4345","2000-03-08",\N,"1H, 13C, and 15N Chemical Shift Assignments for Yeast Ribosomal Protein L30 in Complex with Its mRNA in Solution",\N
4346,"4346","2000-03-08",\N,"1H, 13C, and 15N Chemical Shift Assignments for the Regulatory mRNA of the Yeast Ribosomal Protein L30",\N
4347,"4347","1999-05-13",\N,"1H Chemical Shift Assignments and Interproton 3JHNHA Coupling Constants of Alpha2-D, a Nativelike de Novo Designed Four Helix Bundle",\N
4348,"4348","1999-10-06",\N,"1H, 15N and 13C Chemical Shift Assignments for NtrC-C-term-3Ala",\N
4349,"4349","2000-01-05","2007-07-13","Backbone Resonance Assignments for the Fv Fragment of the Catalytic Antibody NPN43C9 with Bound p-nitrophenol",\N
4350,"4350","1999-09-27",\N,"1H,15N Resonance Assignment of Escherichia coli Adenylate Kinase with Its Bi-Substrate Analog AP5A",\N
4351,"4351","2000-12-15",\N,"A 30-residue Fragment of the Carp Granulin-1 Protein Folds into a Stack of two Beta-hairpins Similar to that found in the Native Protein",\N
4352,"4352","1999-10-07","2006-10-30","Backbone 1H, 13C, and 15N Chemical Shift Assignments for the Inhibitor-Bound DNase Domain of Colicin E9.",\N
4353,"4353","1999-09-15",\N,"1H, 13C, and 15N Resonance Assignments of C-terminal Domain of MutY",\N
4354,"4354","1999-08-25","2007-07-13","Solution NMR Studies of a 42kDa Escherichia coli Maltose Binding Protein/ Beta-Cyclodextrin Complex: Chemical Shift Assignments and Analysis",\N
4355,"4355","1999-10-07",\N,"Backbone 1H, 13C, 15N Chemical Shift Assignments for the Asymmetric Strands of the Tetramerization Domain of the Mnt Repressor",\N
4356,"4356","2001-02-01","2007-07-13","Sequential Backbone Assignments of HIV-I protease tethered dimer",\N
4357,"4357","1999-11-30",\N,"NMR studies of the Pbx1 TALE Homeodomain Protein free in Solution and bound to DNA : Proposal for a Mechanism of HoxB1-Pbx1-DNA Complex Assembly",\N
4358,"4358","1999-11-30",\N,"NMR studies of the Pbx1 TALE Homeodomain Protein free in Solution and bound to DNA : Proposal for a Mechanism of HoxB1-Pbx1-DNA Complex Assembly",\N
4359,"4359","1999-11-30","2010-07-19","NMR studies of the Pbx1 TALE Homeodomain Protein free in Solution and bound to DNA : Proposal for a Mechanism of HoxB1-Pbx1-DNA Complex Assembly",\N
4360,"4360","1999-09-10",\N,"1H, 13C and 15N Chemical Shift Assignments for the C2B-domain of Rabphilin 3",\N
4361,"4361","2000-12-04","2010-07-19","Structure determination by restrained molecular dynamics using NMR pseudocontact shifts as experimentally determined constraints",\N
4362,"4362","2000-12-04","2010-07-16","Structure determination by restrained molecular dynamics using NMR pseudocontact shifts as experimentally determined constraints",\N
4363,"4363","1999-10-08",\N,"NMR Structure of the Sea Urchin (Strongylocentrotus purpuratus) Metallothionein MTA",\N
4364,"4364","2000-11-30",\N,"Dynamics of Stromelysin/Inhibitor Interactions Studied by 15N NMR Relaxation Measurements: Comparison of Ligand Binding to the S1-S3 and S1-S3PSubsites",\N
4365,"4365","2000-11-30","2007-07-13","Dynamics of Stromelysin/Inhibitor Interactions Studied by 15N NMR Relaxation Measurements: Comparison of Ligand Binding to the S1-S3 and S1-S3 Subsites",\N
4366,"4366","2000-11-30","2007-07-13","Dynamics of Stromelysin/Inhibitor Interactions Studied by 15N NMR Relaxation Measurements: Comparison of Ligand Binding to the S1-S3 and S1-S3 Subsites",\N
4367,"4367","2000-03-23",\N,"Backbone assignments of a Borrelia OspA mutant containing an extended single-layer beta-sheet",\N
4368,"4368","2000-06-29","2010-07-14","Chemical Shift Assignments for A35T vnd/NK2 Mutant Homeodomain",\N
4369,"4369","1999-10-26",\N,"1H, 15N and 13C Assigned Chemical Shifts of S19 from Thermus thermophilus",\N
4370,"4370","2000-12-14",\N,"1H and 15N chemical shift assignments for HP-RNase",\N
4371,"4371","1999-11-23",\N,"Sequence-specific 1H, 13C and 15N Resonance Assignments of Recombinant Onconase/P-30 Protein",\N
4372,"4372","2000-06-17","2010-07-19","Solution Structure of a Quadraplex Forming DNA and Its Intermediate",\N
4373,"4373","2000-12-14",\N,"1H, 15N, and 13C Resonance Assignment of the PH Domain from C. elegans UNC-89",\N
4374,"4374","2002-04-08",\N,"Mutational and structural analyses of the ribonucleotide reductase inhibitor sml1 define its rnr1 interaction domain whose inactivation allows suppression of mec1 and rad53 lethality",\N
4375,"4375","2001-02-27","2006-12-11","1H, 13C and 15N Assignments of Ubiquitin Unfolded in 8M Urea, pH2 and Analysis of Chemical shift Dispersion in Unfolded Proteins",\N
4376,"4376","1999-10-13",\N,"Chemical shift assignments, 3JHNHA coupling constants, secondary structure and 15N{1H} Heteronuclear NOE values of the N-domain of VAT (VCP like ATPase of Thermoplasma). A group II AAA ATPase.",\N
4377,"4377","2000-03-02",\N,"The Solution Structure of the Type X Cellulose Binding Domain from Pseudomonas xylanase A",\N
4378,"4378","2000-03-13",\N,"1H, 13C and 15N Resonance Assignment of un-myristoylated Ca2+-Frequenin, a Synaptic Efficacy Modulator",\N
4379,"4379","2000-02-01",\N,"NMR Solution Structure of the Human Prion Protein Domain reveals Species Dependent Structural Disorder and Intramolecular Association with the Flexible Tail",\N
4380,"4380","1999-11-29","2007-07-13","1H, 15N and 13C Resonance Assignments and Monomeric Structure of the Amino-Terminal Extracellular Domain of Epithelial Cadherin",\N
4381,"4381","2000-03-20",\N,"Letter to the Editor:Sequence-specific 1H, 13C, and 15N assignments for the third EH domain of Eps15 (EH3)",\N
4382,"4382","2000-11-30",\N,"1H, 13C and 15N Assigned Chemical Shifts for a Eukaryotic Rubredoxin from Guillardia theta",\N
4383,"4383","2000-06-29",\N,"1H Chemicals Shift Assignments for Wheat ns-LTP Complexed with Prostaglandin B2.",\N
4384,"4384","2000-03-07",\N,"Solution Structure and Dynamics of the Rous Sarcoma Virus Capsid Protein and Comparison with Capsid Proteins ofOther Retroviruses",\N
4385,"4385","2000-12-07",\N,"Rapid Fold and Sructure Determination of the Archaeal Translation Elongation Factor 1beta from Methanobacterium thermoautotrophicum",\N
4386,"4386","2001-07-27",\N,"HIGH-RESOLUTION SOLUTION STRUCTURE OF FREE RGS4 BY NMR",\N
4387,"4387","1999-11-29",\N,"Solution structure of thanatin, a potent bactericidal and fungicidal insect peptide, determined from 1H-2D NMR",\N
4388,"4388","2000-03-20",\N,"Backbone NMR Assignments of a High Molecular Weight Protein (47kD), Cyclic AMP Receptor Protein (apo-CRP)",\N
4389,"4389","2000-12-15",\N,"Backbone NMR Assignment and Secondary Structure of Ribosome Recycling Factor (RRF) from Pseudomonas aeruginosa",\N
4390,"4390","2001-06-08",\N,"Backbone dynamics of the human CC-chemokine eotaxin",\N
4391,"4391","2000-08-07",\N,"Isolation, purification, 1H NMR assignments and secondary structure characterization of a neurotoxin from Bungarus candidus",\N
4392,"4392","1999-11-21","2010-07-19","Binding of AR-1-144, a tri-imidazole DNA minor groove binder, to CCGG sequence analyzed by NMR spectroscopy",\N
4393,"4393","2000-12-07",\N,"1H, 15N, and 13C NMR Backbone Assignments of the N Terminal Region of Human Erythrocyte Alpha Spectrin Including One Repeating Unit.",\N
4394,"4394","1999-11-29",\N,"Translation initiation factor IF3 from Escherichia coli Ribosome binding domain (residues 84-180)",\N
4395,"4395","2000-03-08",\N,"RIBOSOMAL PROTEIN L25 FROM ESCHERICHIA COLI, NMR,",\N
4396,"4396","2000-10-06","2007-06-19","Anticoagulant protein from the nematode Ancylostoma caninum",\N
4397,"4397","1999-11-21",\N,"Solution Structure of the CX3C Chemokine Domain of Fractalkine",\N
4398,"4398","2000-03-08",\N,"Structure of a neuropeptide Y Y2 agonist",\N
4399,"4399","2000-03-08",\N,"Alpha-conotoxin ImI",\N
4400,"4400","1999-10-26","2010-07-16","Structure and Mechanism of Formation of the H-y5 ismomer of an Intramolecular DNA Triple Helix.",\N
4401,"4401","1999-10-20","2005-05-26","Structure and Interaction Site of the Regulatory Domain of Troponin-C when Complexed with the 96-148 Region of Troponin-I",\N
4402,"4402","2000-02-01",\N,"1H, 13C and 15N chemical shift assignment of human prion protein hPrP(23-230)",\N
4403,"4403","2001-02-15",\N,"1H, 13C and 15N Resonance Assignment and Secondary Structure of the J Domain of Murine Polyomavirus T Antigens",\N
4404,"4404","2000-12-07",\N,"Solution Structure of the Major alpha-amylase Inhibitor of the crop plant Amaranth",\N
4405,"4405","1999-11-29",\N,"C-TERMINAL KH DOMAIN OF HNRNP K (KH3)",\N
4406,"4406","1999-10-26",\N,"The cyclic peptide contryphan-R from Conus radiatus",\N
4407,"4407","1999-11-11",\N,"NMR chemical shift assignment of human GAIP (Galpha Interacting Protein): A regulator of G protein signaling",\N
4408,"4408","1999-11-26",\N,"Minor Form of the Cyclic Peptide Contryphan-R from Conus radiatus",\N
4409,"4409","2000-12-15","2013-08-09","DNA DECAMER DUPLEX CONTAINING T-T DEWAR PHOTOPRODUCT",\N
4410,"4410","1999-10-26",\N,"Three dimensional structure of Selenocosmia huwena Lectin-I (SHL-I) from the venom of the spider Selenocosmia huwena by 2D-NMR",\N
4411,"4411","2000-03-17",\N,"Backbone 1H and 15N Chemical Shift Assignments for Transforming Growth Factor beta",\N
4412,"4412","2000-06-19","2013-08-09","DNA DECAMER DUPLEX CONTAINING T5-T6 PHOTOADDUCT",\N
4413,"4413","1999-12-06",\N,"STRUCTURE OF THE C-TERMINAL DOMAIN OF P73",\N
4414,"4414","2000-02-21",\N,"NMR Solution Structure of Plastocyanin from the Photosynthetic Prokaryote, Prochlorothrix hollandica (minimized average structure)",\N
4415,"4415","1999-12-06","2013-08-16","Solution-state structure of a DNA dodecamer duplex containing a cis-syn thymine cyclobutane dimer.",\N
4416,"4416","2000-06-17","2010-07-16","Solution-State Structure of a DNA Dodecamer Duplex Containing a Cis-Syn Thymine Cyclobutane Dimer.",\N
4417,"4417","2000-01-11",\N,"1H, 13C and 15N Chemical Shift Assignments of the Birch Pollen Allergen Bet v 1",\N
4418,"4418","1999-11-24",\N,"NMR structure with tightly bound water molecules of cytotoxin II (cardiotoxin) from Naja naja oxiana in aqueous solution (minor form)",\N
4419,"4419","1999-11-12",\N,"NMR structure with tightly bound water molecules of cytotoxin II (cardiotoxin) from Naja naja oxiana in aqueous solution (major form)",\N
4420,"4420","1999-11-24",\N,"NMR SOLUTION STRUCTURE OF ALPHA-CONOTOXIN IM1",\N
4421,"4421","2001-05-01",\N,"13C,15N and 1H Assigned Chemical Shifts for PhoB DNA-binding Domain.",\N
4422,"4422","2000-12-19",\N,"NMR Solution Structure of Apis mellifera Chymotrypsin Inhibitor (AMCI).",\N
4423,"4423","2000-03-09",\N,"Solution structure of the N-terminal zinc finger of murine GATA-1",\N
4424,"4424","1999-12-23",\N,"NMR Structure of the N-terminal Domain of Saccharomyces cerevisiae RNase HI Reveals a Fold with a Strong Resemblance to the N-terminal Domain of Ribosomal Protein L9",\N
4425,"4425","1999-12-23",\N,"Solution structure of apo-biotinyl domain from acetyl coenzyme A carboxylase of Escherichia coli determined by triple-resonance NMR spectroscopy",\N
4426,"4426","2000-06-12",\N,"Solution Structure of Holo-biotinyl Domain from Acetyl Coenzyme A Carboxylase of Escherichia coli Determined by Triple-Resonance NMR Spectroscopy",\N
4427,"4427","1999-12-22",\N,"PI7, an orphan peptide isolated from the scorpion Pandinus Imperator: a 1H NMR analysis using a Nano-nmr probe.",\N
4428,"4428","2001-07-30",\N,"Solution Structure of the Headpiece Domain of Chicken Villin",\N
4429,"4429","1999-12-23",\N,"1H and 15N Chemical Shift Assignments for ribosomal protein L7",\N
4430,"4430","2000-10-02",\N,"High resolution solution structure of apo rabbit calcyclin",\N
4431,"4431","2000-03-07",\N,"Structure of the Soluble Methane Monooxygenase Regulatory Protein B",\N
4432,"4432","2002-12-23",\N,"1H-NMR Spectral Assignment of Second Transmembrane Segments of Human Glycine Receptor",\N
4433,"4433","2002-12-23",\N,"1H-NMR Spectral Assignment of Second Transmembrane Segments of Human Glycine Receptor",\N
4434,"4434","2000-02-01",\N,"NMR Solution Structure of the Human Prion Protein",\N
4435,"4435","2000-12-07",\N,"Structural Basis for the Network of Functional Cooperativities in Cytochrome c(3) from Desulfovibrio gigas: Solution Structures of the Oxidised and Reduced states",\N
4436,"4436","2000-12-07",\N,"Proton Assignment of the Ferrocytochrome C3 from Desulfovibrio gigas.",\N
4437,"4437","1999-12-22",\N,"Solution structure of an EGF module pair from the Plasmodium falciparum merozoite surface protein 1",\N
4438,"4438","2000-03-23",\N,"1H, 13C and 15N chemical Shift Assignments for SCP2",\N
4439,"4439","2000-01-12",\N,"Hyperfine Cys Proton Signals from Oxidized Human Ferredoxin",\N
4440,"4440","2000-01-12",\N,"Hyperfine Cys Proton Signals from Reduced Human Ferredoxin",\N
4441,"4441","2000-05-05",\N,"Hyperfine Cys Proton Signals from Anabaena 7120 Vegetative Ferredoxin",\N
4442,"4442","2000-05-24",\N,"Hyperfine Cys Proton Signals from Reduced Anabaena 7120 Vegetative Ferredoxin",\N
4443,"4443","2000-03-09",\N,"NMR Solution Structure of Butantoxin",\N
4444,"4444","2000-04-03",\N,"1H, 13C and 15N chemical shift assignments and secondary structure of Halobacterium salinarum ferredoxin",\N
4445,"4445","2000-07-18",\N,"1H, 13C, and 15N Chemical Shift Assignments and coupling constants for the HRDC domain from S. cerevisiae Sgs1 RecQ helicase",\N
4446,"4446","2000-03-10",\N,"NMR solution structure of a novel thioredoxin from Bacillus acidocaldarius: possible determinants of protein stability.",\N
4447,"4447","2000-03-14",\N,"Backbone assignment of the 19kDa translationally controlled tumor-associated protein p23fyp from Schizosaccharomyces pombe",\N
4448,"4448","2000-05-09",\N,"1H, 13C and 15N backbone assignment and secondary structure of the 19 kDa diadenosine 5',5'''-P1,P4 tetraphosphate hydrolase from Lupinus angustifolius L.",\N
4449,"4449","2000-03-22",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for Intramolecular Dimer Antifreeze Protein RD",\N
4450,"4450","2000-03-10",\N,"Sequence-specific 1H, 15N and 13C Resonnace assignment of the Inhibitory Prodomain of Human Furin",\N
4451,"4451","2000-12-15",\N,"Structure of the CAD Domain of Caspase-activated DNase and Interaction with the CAD Domain of its Inhibitor",\N
4452,"4452","2000-01-12",\N,"The Solution structure of Type II Antifreeze Protein Reveals a New Member of the Lectin Family",\N
4453,"4453","2000-03-22",\N,"Assignment of the 1H, 13C and 15N Resonances of the C-terminal EF-Hands of Alpha Actinin in a 14 kDa Complex with Z-Repeat 7 of Titin",\N
4454,"4454","2000-03-22",\N,"1H and 15N Chemical Shift Assignments for Titin Z-repeat 7 in the Complex with Alpha-actinin C-terminal EF-hands",\N
4455,"4455","1999-12-22",\N,"Glycan-free mutant adhesion domain of human CD58 (LFA-3)",\N
4456,"4456","2000-06-19",\N,"1H Chemical Shift Assignments for the cytoplasmic domain of aIIb integrin",\N
4457,"4457","2000-03-17",\N,"Sequence-specific assignments and partial unfolding of extracellular domains II and III of E-cadherin.",\N
4458,"4458","2000-01-14","2005-06-03","1H Chemical Shift Assignments and Interproton 3JNHHA Coupling Constants of Reduced Bacteriophage T4 Glutaredoxin",\N
4459,"4459","2000-01-14","2005-06-03","1H Chemical Shift Assignments and Interproton 3JNHHA Coupling Constants of Oxidized Bacteriophage T4 Glutaredoxin",\N
4460,"4460","2000-03-23","2005-04-25","1H, 15N and 13C Resonance Assignments for the C-terminal Protein Interaction Region of the 32 kDa Subunit of Human Replication Protein A",\N
4461,"4461","2000-03-23",\N,"1H NMR Solution Structure of Cycloviolacin O1 - A Macro-cyclic Polypeptide Isolated from Viola odorat",\N
4462,"4462","2000-03-24",\N,"1H Chemical Shift Assignements for mouse [Cd7]-metallothionein-1",\N
4463,"4463","2000-12-15",\N,"Sequential NMR assignment of the Ras-binding domain of Byr2",\N
4464,"4464","2000-05-03",\N,"Chemical shifts of the major form of the cyclic peptide contryphan-Sm",\N
4465,"4465","2000-06-19",\N,"The Structural role of the Copper-coordinating and Surface-exposed Histidine Residue in the Blue Copper Protein Azurin",\N
4466,"4466","2002-06-11","2007-03-26","Chemical Shift assignments for Cu(I) Pseudoazurin from Paracoccus pantotrophus",\N
4467,"4467","2000-12-15",\N,"Sequence-specific 1H, 13C, and 15N Assignments of the MAR-binding Domain of Chicken MeCP2/ARBP",\N
4468,"4468","2000-05-04",\N,"Chemical shifts of the minor form of the cyclic peptide contryphan-Sm",\N
4469,"4469","2000-05-24",\N,"Chemical shifts of the major form of the cyclic peptide Des[Gly1]-contryphan-R",\N
4470,"4470","2001-02-15",\N,"Solution Structure of ThiS and Implications for the Evolutionary Roots of Ubiquitin",\N
4471,"4471","2000-04-03",\N,"Complete 1H, 15N and 13C assignment of the functional domain of Paracoccus denitrificans cytochrome c552 in the reduced state",\N
4472,"4472","2000-12-15",\N,"1H, 13C, and 15N signal assignments for BeFx-activated CheY from E. coli",\N
4473,"4473","2000-05-25",\N,"The molecular basis for Protein Kinase A anchoring revealed by solution NMR",\N
4475,"4475","2000-06-17",\N,"Low Density Lipoprotein Receptor-Related protein complement repeat 8",\N
4476,"4476","2002-06-11",\N,"Control of K+ channel gating by protein phosphorylation: structural switches of the inactivation gate",\N
4477,"4477","2002-06-07",\N,"Control of K+ channel gating by protein phosphorylation: structural switches of the inactivation gate",\N
4478,"4478","2000-05-25",\N,"PKD domain 1 from Human polycystein-1",\N
4481,"4481","2000-05-08",\N,"NMR structure of heparin binding site of non collagenous domain I (NC1) of collagen facit XIV",\N
4483,"4483","2000-06-29",\N,"Local interactions drive the formation of non-native structure in the denatured state of human alpha-lactalbumin: A high resolution structural characterization of a peptide model in aqueous solution",\N
4486,"4486","2000-06-17",\N,"METHANE MONOOXYGENASE COMPONENT B",\N
4487,"4487","2000-06-17",\N,"Putative ancestral protein encoded by a single sequence repeat of the multidomain proteinase inhibitor from nicotiana alata",\N
4488,"4488","2000-08-04","2010-07-16","DNA decamer duplex containing T-T (6-4) photoadduct",\N
4490,"4490","2000-07-05",\N,"Solution structure of the major alpha-amylase inhibitor of the crop plant Amaranth",\N
4491,"4491","2000-06-17",\N,"Solution structure of the apo EH1 domain of mouse Eps15",\N
4492,"4492","2000-06-16",\N,"Unmyristoylated GCAP-2 with three calcium ions bound",\N
4493,"4493","2000-06-16",\N,"Solution structure of the designed hydrophobic core mutant of ubiquitin, 1D7",\N
4494,"4494","2000-06-16",\N,"Solution Structure and Backbone Dynamics of Human Long-[Arg3]Insulin-Like Growth Factor 1",\N
4496,"4496","2000-03-23",\N,"Solution nmr structure of the mitochondrial protein import receptor Tom20 from rat in a complex with a presequence peptide derived from rat aldehyde dehydrogenase (ALDH)",\N
4497,"4497","2000-06-16",\N,"High resolution solution structure of the Heat shock cognate -70 kd substrate binding domain obtained by multidimensional NMR techniques",\N
4498,"4498","2000-06-16",\N,"Nucleocapsid Protein from Mason-Pfizer Monkey Virus (MPMV)",\N
4500,"4500","2000-07-21",\N,"w-conotoxin MVIIC from Conus magus",\N
4503,"4503","2000-12-18",\N,"Solution Structure of Alpha-conotoxin SI",\N
4506,"4506","2000-10-02",\N,"Solution structure of carnobacteriocin B2",\N
4507,"4507","2001-03-06",\N,"Solution Structure of Carnobacteriocin B2 and Implications for Structure- Activity Relationships Among Type IIa Bacteriocins from Lactic Acid Bacteria",\N
4509,"4509","2000-10-06",\N,"Automated 2D NOESY Assignment and Structure Calculation of crambin(S22/I25) with Self-Correcting Distance Geometry Based NOAH/DIAMOND Programs",\N
4510,"4510","2000-05-25",\N,"The Second Type II Module From Human Matrix Metalloproteinase 2",\N
4514,"4514","2001-05-07",\N,"NMR solution structure of complement-like repeat CR3 from the low density lipoprotein receptor-related protein (LRP). Evidence for specific binding to the receptor binding domain of human alpha-2 macroglobulin",\N
4516,"4516","2000-12-15",\N,"Solution Structure of the PDZ2 Domain from Human Phosphatase hPTP1E and its Interactions with C-terminal Peptides from the Fas Receptor",\N
4519,"4519","2000-07-12",\N,"HUMAN TRANSLATION INITIATION FACTOR EIF1A",\N
4522,"4522","2001-05-07",\N,"The restrained and minimized average NMR structure of MAP30.",\N
4524,"4524","2002-03-29",\N,"Solution Structure of a Type-I Dockerin Domain, a Novel Prokaryotic, Extracellular Calcium-Binding Domain",\N
4526,"4526","2001-03-08",\N,"SOLUTION NMR STRUCTURE OF TUMOR SUPPRESSOR P16INK4A, 20 STRUCTURES",\N
4527,"4527","2000-06-16",\N,"1H, 13C, and 15N Chemical Shift Assignments for the N-terminal receiver domain of NtrC (unphosphorylated)",\N
4528,"4528","2000-06-16",\N,"1H, 13C, and 15N Chemical Shift Assignments for the N-terminal receiver domain of NtrC (phosphorylated)",\N
4536,"4536","2000-09-01",\N,"Structural basis for uracil DNA glycosylase interaction with uracil: NMR study",\N
4540,"4540","2000-06-16",\N,"Averaged NMR model of switch ARC, a double mutant of ARC repressor",\N
4541,"4541","2000-02-23",\N,"Solution Structure of the Potassium Channel Scorpion Toxin HsTX1",\N
4542,"4542","2000-12-06","2010-07-16","Solution structure of a uracil containing hairpin DNA",\N
4547,"4547","2000-12-06","2010-07-16","Solution structure of a DNA.RNA hybrid containing an alpha-anomeric thymidine and polarity reversals: d(ATGG-3'-3'-(alpha-T)-5'-5'-GCTC).r(gagcaccau)",\N
4550,"4550","2006-02-17","2010-07-19","NMR structure of the palindromic DNA decamer d(GCGTTAACGC)2",\N
4551,"4551","2003-01-06",\N,"SOLUTION STRUCTURE OF THE N-TERMINAL DOMAIN OF RIBOSOMAL PROTEIN L9",\N
4552,"4552","2000-05-05",\N,"Structure of the Bovine Antimicrobial Peptide Indolicidin bound to Dodecylphosphocholine and Sodium Dodecyl Sulfate Micelles",\N
4553,"4553","2000-12-12",\N,"Assignment of 1H, 13C and 15N Resonances of the I-domain of Human Leukocyte Function Associated Antigen-1",\N
4554,"4554","2000-04-03",\N,"Backbone HN, N, Ca, C' and Cb assignments of the 19 kDa DHFR/NADPH complex at 9C and pH 7.6",\N
4555,"4555","2000-01-11","2010-07-15","31P NMR analysis of the DNA conformation induced by protein binding:SRY-DNA complexes",\N
4556,"4556","2000-01-11","2010-07-19","31P NMR analysis of the DNA conformation induced by protein binding:SRY-DNA complexes",\N
4557,"4557","2001-08-06",\N,"Structure of the active domain of the herpes simplex virus protein ICP47 in water/sodium dodecyl sulfate solution determined by nuclear magnetic resonance spectroscop",\N
4558,"4558","2000-05-05",\N,"1H, 13C, and 15N Assignments for YopH-NT",\N
4559,"4559","2000-10-06",\N,"The NMR structure of the nucleocapsid protein from the mouse mammary tumor virus reveals unusual folding of the C-terminal zinc knuckle",\N
4560,"4560","2000-04-03",\N,"Assignment of 1H, 13C and 15N signals of a recombinant effector protein (T4MOD) in Toluene-4-monooxygenase complex",\N
4561,"4561","2006-01-23",\N,"Solution Structure of Imperatoxin A (IpTxa) from the scorpion P. imperator Determined by 1H-NMR Spectroscopy",\N
4562,"4562","2000-01-12",\N,"1H and 13C chemical shift assignments of native hen egg white lysozyme",\N
4563,"4563","2000-05-10",\N,"NMR Structure of the Bovine Prion Protein",\N
4564,"4564","2000-05-24",\N,"NMR Structure of the Bovine Prion Protein",\N
4565,"4565","2000-06-19",\N,"1H, 13C and 15N resonance assignments for a truncated and inhibited catalytic domain of matrix metalloproteinase-2",\N
4566,"4566","2000-09-25",\N,"Assignment of 1H,13C and 15N signals of Bovine Adrenodoxin",\N
4567,"4567","2000-04-03",\N,"1H, 15N and 13C resonance assignments for the catalytic domain of the yeast E2, UBC1",\N
4568,"4568","2000-05-25",\N,"Native and non-native secondary structure and dynamics in the pH 4 intermediate of apomyoglobin",\N
4570,"4570","2000-01-14",\N,"NMR Study of Sso7d Mutant (F31A) Minimized Average Structure",\N
4571,"4571","2000-12-19",\N,"Zinc-bundle Structure of the Essential RNA Polymerase Subunit RPB10 from Methanobacterium thermoautotrophicum",\N
4572,"4572","2000-10-23",\N,"Conformational changes in the PBX Homeodomain and C-terminal Extension upon Binding DNA and HOX-derived YPWM Peptides",\N
4573,"4573","2004-05-15",\N,"1HN,15N,13CO,13Ca,13Cb chemical shifts of 7,8-dihydroneopterin aldolase (DHNA) from Staphylococcus aureus",\N
4574,"4574","2001-03-02",\N,"CIDE-N Domain of Human CIDE-B",\N
4575,"4575","2000-04-03",\N,"Letter to the Editor: Backbone resonance assignment of the N-terminal 24 kDa fragment of the gyrase B subunit from S. aureus complexed with novobiocin",\N
4576,"4576","2000-05-25","2010-07-19","Solution Structure of [d(CGC)r(aaa)d(TTTGCG)]2 Hybrid Junctions Flanked by DNA Duplexes",\N
4577,"4577","2000-03-06",\N,"1H, 13C, and 15N Chemical Shift Assignments for Ribosomal Protein S4 delta 41",\N
4578,"4578","2000-11-29",\N,"1H, 13C and 15N NMR Assignment of the Hyperstable Quintuple Mutant of Pseudomonas aeruginosa Cytochrome c-551.",\N
4579,"4579","2000-06-19",\N,"Sequence-specific 1H, 15N and 13C resonance assignments of the EEA1 FYVE domain.",\N
4580,"4580","2000-05-25",\N,"Backbone 1H,13C,and 15N assignments of the anti-dansyl antibody Fv fragment",\N
4581,"4581","2000-12-18",\N,"Site-site Communication in the EF-hand Ca2+ Binding Protein Calbindin D9k",\N
4583,"4583","2000-12-19",\N,"The C-terminal Domain of the RNA Polymerase Alpha Subunit from Thermus Thermophilus",\N
4584,"4584","2001-05-02",\N,"Solution Structure of the DNA-binding Domain of TraM",\N
4585,"4585","2000-12-05",\N,"Solution Structure of BmP02, a new Potassium channel Blocker from the Venom of the Chinese Scorpion Buthus martensi Karsch",\N
4587,"4587","2000-12-29",\N,"NMR STRUCTURAL DETERMINATION OF VISCOTOXIN A3 FROM VISCUM ALBUM L.",\N
4588,"4588","2000-11-29",\N,"Proton and nitrogen chemical shift assignments for the chitin-binding domain of Bacillus circulans WL-12 Chitinase A1",\N
4589,"4589","2001-03-08",\N,"NMR Solution Structure of the Last Unknown Module of the Cellulosomal Scaffoldin Protein CIPC of Clostridum cellulolyticum",\N
4590,"4590","2001-03-08",\N,"Solution structure of the human chemokine Eotaxin-2",\N
4591,"4591","2001-03-06",\N,"Solution structure of the syndecan-4 whole cytoplasmic domain",\N
4592,"4592","2001-03-06",\N,"Solution structure of the syndecan-4 whole cytoplasmic domain in the presence of phosphatidylinositol 4,5-bisphosphate",\N
4593,"4593","2001-03-02",\N,"Rous sarcoma virus capsid protein: C-terminal domain",\N
4595,"4595","2000-12-04",\N,"Cystic fibrosis transmembrane conductance regulator: solution structures of peptides based on the Phe508 region, the most common site of disease-causing DeltaF508 mutation -- P25",\N
4596,"4596","2000-12-04",\N,"Cystic fibrosis transmembrane conductance regulator: solution structures of peptides based on the Phe508 region, the most common site of disease-causing DeltaF508 mutation -- P26",\N
4597,"4597","2000-12-04",\N,"Cystic Fibrosis Transmembrane Conductance Regulator: Solution Structures of Peptides Based on the Phe508 Region, the Most Common Site of Disease-Causing DeltaF508 Mutation",\N
4598,"4598","2000-12-04",\N,"Cystic Fibrosis Transmembrane Conductance Regulator: Solution Structures of Peptides Based on the Phe508 Region, the Most Common Site of Disease-Causing DeltaF508 Mutation",\N
4599,"4599","2001-02-01",\N,"High-Resolution Solution Structure of the 18 kDa Substrate-Binding Domain of the Mammalian Chaperone Protein Hsc70",\N
4600,"4600","2000-12-21",\N,"Nucleocapsid protein from Mason-Pfizer monkey virus (MPMV)",\N
4601,"4601","2001-02-15",\N,"Solution structure of the channel-former Zervamicin IIB (peptaibol antibiotic)",\N
4602,"4602","2000-12-06",\N,"Solution Structure of Oxidized Microsomal Rabbit Cytochrome b5. Factors Determining the Heterogeneous Binding of the Heme",\N
4603,"4603","2001-07-30",\N,"Tertiary structure of apo-D-alanyl carrier protein",\N
4604,"4604","2001-02-01",\N,"NMR STRUCTURE OF THE PEPTAIBOL CHRYSOSPERMIN C BOUND TO DPC MICELLES",\N
4607,"4607","2001-03-08",\N,"Solution Structure Determination and Mutational Analysis of the Papillomavirus E6-interacting Peptide of E6AP",\N
4609,"4609","2001-01-04","2010-07-19","NMR observation of T-tetrads in a parallel stranded DNA quadruplex formed by Saccharomyces cerevisiae telomere sequence",\N
4610,"4610","2000-12-22","2010-07-20","NMR Observation of A-tetrad in a DNA Quadruplex",\N
4612,"4612","2000-12-19","2010-07-19","NMR observation of a novel C-tetrad in a DNA quadruplex",\N
4614,"4614","2000-11-30",\N,"The G7(syn)-G4(anti) structure of r(GCAGGCGUGC)2",\N
4615,"4615","2002-01-23",\N,"Solution Structure of PAFP-S: A new Knottin-type Antifungal Peptide from the seeds of Phytolacca americana",\N
4616,"4616","2000-12-04",\N,"Light-harvesting complex 1 beta subunit from Rhodobacter sphaeroides",\N
4617,"4617","2001-03-08",\N,"Structure of hetero complex of non structural protein (NS) of hepatitis C virus (HCV) and synthetic peptidic compound",\N
4618,"4618","2000-12-06","2010-07-19","The Solution Structure of [d(CGC)r(aaa)d(TTTGCG)]2: Hybrid Junctions Flanked by DNA Duplexes",\N
4619,"4619","2000-12-05",\N,"N-terminal zinc-binding HHCC domain of HIV-2 integrase",\N
4620,"4620","2000-12-06",\N,"Human prion protein variant R220K",\N
4621,"4621","2001-05-02",\N,"N-terminal RING finger domain of human NOT-4",\N
4622,"4622","2002-04-04",\N,"Solution structure, Hydrodynamics and thermodynamics of the UvrB C-terminal domain",\N
4623,"4623","2001-02-15",\N,"Internal xylan binding domain from C. fimi Xyn10A, R262G mutant",\N
4628,"4628","2002-04-08",\N,"Heavy Chain Variable domain from LLama",\N
4630,"4630","2001-05-07",\N,"NMR STRUCTURE OF THROMBOMODULIN EGF(4-5)",\N
4631,"4631","2001-05-07",\N,"PEPTIDE FRAGMENT THR671-LEU690 OF THE RABBIT SKELETAL DIHYDROPYRIDINE RECEPTOR",\N
4632,"4632","2001-06-15",\N,"Solution Structure of a Pro-Apoptotic Protein BAX",\N
4633,"4633","2002-12-23",\N,"Solution Structure, Backbone Dynamics, and stability of a Double Mutant Single-Chain Monellin. Structural origin of sweetness",\N
4634,"4634","2001-05-07",\N,"Structural analysis of multi-functional peptide motifs present in human bifunctional tRNA synthetase: Identification of RNA-binding residues and functional implications for tandem repeats",\N
4635,"4635","2001-05-07",\N,"Solution structure of the interacting domains of the Mad-Sin3 complex: implications for recruitment of a chromatin-modifying complex",\N
4636,"4636","2001-07-30",\N,"Solution structure of the N-terminal domain of the TNFR1 associated protein, TRADD",\N
4637,"4637","2001-07-09",\N,"SOLUTION STRUCTURE OF THE MATA1 HOMEODOMAIN",\N
4638,"4638","2001-05-07",\N,"SOLUTION STRUCTURE OF MNEI, A SWEET PROTEIN",\N
4639,"4639","2002-04-03",\N,"NMR structure of the hRap1 Myb motif reveals a canonical three helix bundle lacking the positive surface charge typical of Myb DNA binding domains",\N
4640,"4640","2001-05-07",\N,"Solution structure and activity of the four disulfide bond Mediterranean mussel defensin MGD-1",\N
4641,"4641","2001-05-17",\N,"Human Prion Protein Mutant E200K Fragment 90-231",\N
4642,"4642","2001-05-07",\N,"SOLUTION STRUCTURE OF HUMAN BETA-DEFENSIN-2",\N
4643,"4643","2002-09-23",\N,"The solution structure of sheep myeloid antimicrobial peptide (smap29) and its relationship to biological function",\N
4644,"4644","2001-05-09",\N,"Solution structures of two CCHC zinc fingers from the FOG family protein U-shaped that mediate protein-protein interactions",\N
4645,"4645","2001-05-15",\N,"A Peptide Derived from the C-Terminal Part of a Plant Cysteine Protease Folds into a Stack of Two Beta-Hairpins, a Scaffold Present in the Emerging Family of Granulin-Like Growth Factors",\N
4646,"4646","2002-12-23","2010-07-16","Structural NMR characterization of an 11-mer DNA Duplex Containing a 2'-deoxyaristeromycin 8-oxo-Guanine pair, nonhydrolyzable substrate analog for the DNA repair enzyme MutY",\N
4647,"4647","2001-05-23","2010-07-16","HPRT Gene Mutation Hotspot with a BPDE2(10R) Adduct",\N
4648,"4648","2001-05-09",\N,"Solution Structure and Dynamics of an Open B-sheet, Glycolytic Enzyme-monomeric 23.7 kDa Phosphoglycerate Mutase from Schizosaccharomyces pombe",\N
4649,"4649","2001-05-09",\N,"NMR Structure of N-terminal Domain of HTLV-I CA1-134",\N
4650,"4650","2002-06-26",\N,"Sheep prion protein synthetic peptide spanning helix 1 and b strand 2 (residues 142 to 166) shows b hairpin structure in solution",\N
4651,"4651","2001-05-09",\N,"Helix 7 Bovine Rhodopsin",\N
4652,"4652","2001-05-09",\N,"Solution Structure of Amino Terminus of Bovine Rhodopsin (residues 1-40)",\N
4653,"4653","2001-05-09",\N,"Solution structure of third intradiskal loop of bovine rhodopsin (residues 268-293)",\N
4654,"4654","2001-05-10",\N,"Solution structure of 2nd intradiskal loop of bovine rhodopsin (residues 172-205)",\N
4655,"4655","2001-05-10",\N,"Solution Structure of Intradiskal Loop 1 of Bovine Rhodopsin (Rhodopsin Residues 93-123)",\N
4656,"4656","2001-05-10",\N,"Design and Solution Structure of a Well-folded Stack of Two Beta-hairpins Based on the Amino-terminal Fragment of Human Granulin A",\N
4661,"4661","2000-03-07",\N,"Solution structure of APAF-1 CARD",\N
4663,"4663","2000-06-16",\N,"Rotamer Strain as a Determinant of Protein Structural Specificity",\N
4664,"4664","2000-07-08",\N,"Sequence-Specific Resonance Assignments of Q83, a Lipocalin Highly Expressed in v-myc-Transformed Avian Fibroblasts",\N
4666,"4666","2000-05-26",\N,"Biotin carboxyl carrier domain of transcarboxylase (TC 1.3S)",\N
4667,"4667","2000-12-19",\N,"NMR SOLUTION STRUCTURE OF CO(II)-Bleomycin A2",\N
4668,"4668","2001-05-03",\N,"Assignment of 1H, 13C and 15N Resonances of FKBP from Methanococcus thermolithotrophicus",\N
4669,"4669","2002-04-01",\N,"Structural Analysis of the Immunodominant Antigenic Region of the Hepatitis C Virus Capsid Protein by NMR",\N
4670,"4670","2000-07-24",\N,"Sequence-specific 1H,13C and 15N chemical shift backbone NMR assignment and secondary structure of the Arabidopsis thaliana PIN1At",\N
4671,"4671","2000-09-27",\N,"Sequence-specific 1H, 13C and 15N Resonance Assignments of the Major Cherry Allergen Pru a 1",\N
4673,"4673","2000-05-24",\N,"Solution structure of Ileal Lipid Binding Protein in complex with glycocholate",\N
4674,"4674","2002-09-23",\N,"Structural Proteomics of M. thermoautotrophicum: A global survey of non-membrane protein expression, solubility and structure",\N
4675,"4675","2000-07-08",\N,"1H, 13C and 15N resonance assignments of the DNA binding domain of the human forkhead transcription factor AFX",\N
4676,"4676","2001-08-09",\N,"Assignment of 1H, 13C and 15N Resonances in Unfolded Apomyoglobin at pH 2.3",\N
4677,"4677","2001-05-03",\N,"Solution Structure of the Cysteine-rich Domain of the Escherichia coli Chaperone Protein DnaJ",\N
4678,"4678","2000-12-18","2009-07-16","Solution Structure of the RNA Polymerase Subunit RPB5 from Methanobacterium thermoautotrophicum","/ftp/pub/bmrb/timedomain/bmr4678"
4679,"4679","2002-04-01",\N,"1H, 15N, 13C, and 13CO Assignments and Secondary Structure Determination of Collagenase-3 (MMP-13) Complexed with a Hydroxamic acid Inhibitor",\N
4680,"4680","2000-12-18",\N,"The Structure of a LysM Domain from E.coli Membrane-bound Lytic Murein Transglycosylase D (MltD)",\N
4681,"4681","2000-03-20",\N,"Backbone and side-chain 1H, 13C, and 15N Chemical Shift Assignments for apo-CRBPII",\N
4682,"4682","2000-08-03",\N,"Backbone and side-chain 1H, 13C, and 15N Chemical Shift Assignments for holo-CRBP II",\N
4683,"4683","2000-06-19",\N,"Multiple Modes of Peptide Recognition by the PTB Domain of the cell fate Determinant Numb",\N
4684,"4684","2003-08-27",\N,"Three-Dimensional Solution Structure of the Isolated Cd4-alpha Domain of Metallothionein 2. Determination by Homonuclear and Heteronuclear Magnetic Resonance Spectroscopy",\N
4685,"4685","2000-03-23",\N,"Backbone and side-chain 1H chemical shifts for J-atracotoxin-Hv1c",\N
4686,"4686","2000-06-16",\N,"The Human CC Chemokine I-309, Structural Consequences of the Additional Disulfide Bond.",\N
4687,"4687","2000-06-16","2010-07-19","1H chemical shift assignments of the dimeric form of d<pCATTCATT>",\N
4688,"4688","2000-07-24",\N,"Assignment and secondary structure identification of the ribosomal protein L18 from Thermus thermophilus",\N
4689,"4689","2002-04-01",\N,"NMR Studies of the Backbone Flexibility and Structure of Human Growth Hormone: a Comparison of High and Low pH Conformations",\N
4692,"4692","2001-03-02","2010-07-15","SOLUTION STRUCTURE OF A HUMAN TELOMERE FRAGMENT",\N
4694,"4694","2000-06-16","2010-07-19","NMR structure of two cyclic oligonucleotides. A monomer-dimer equlilibrium between dumbbell and quadruplex structures.",\N
4695,"4695","2000-03-23",\N,"Effect of the single mutation His 64->Phe on the stability and folding of apomyoglobin",\N
4696,"4696","2000-06-16",\N,"A new fold in the scorpion toxin family, associated with an activity on ryanodine-sensitive calcium channel",\N
4697,"4697","2001-07-09","2006-06-26","Structure of the fMet-tRNAfMet-binding domain of B. stearothermophilus initiation factor IF2",\N
4698,"4698","2000-09-25",\N,"1H, 13C, and 15N backbone assignments of TGF-beta type II receptor ligand binding domain",\N
4699,"4699","2000-03-29",\N,"The transmembrane domains of hepatitis C virus envelope glycoproteins E1 and E2 play a major role in heterodimerisation",\N
4700,"4700","2000-12-18",\N,"Structure of Cdc42 bound to the GTPase Binding Domain of PAK",\N
4701,"4701","2000-05-09",\N,"Tumor suppressor INK4: refinement of p16/INK4A structure and determination of p15/INK4B structure by comparative modeling and NMR data",\N
4702,"4702","2000-12-18",\N,"Structure of the Negative Regulatory Domain of p53 bound to S100B",\N
4703,"4703","2001-09-12",\N,"1H sequential assignment and solution secondary structure of mouse MIP-3a chemokine",\N
4704,"4704","2000-05-08",\N,"Analysis of the dynamic properties of Bacillus circulans xylanase upon formation of a covalent glycosyl-enzyme intermediate",\N
4705,"4705","2000-05-08",\N,"Analysis of the dynamic properties of Bacillus circulans xylanase upon formation of a covalent glycosyl-enzyme intermediate",\N
4706,"4706","2000-05-26",\N,"Structure and Binding Specificity of the Second N-Terminal Cellulose-Binding Domain from Cellulomonas fimi Endoglucanase C",\N
4707,"4707","2000-04-28",\N,"WT1-KTSs free",\N
4708,"4708","2000-05-01","2010-07-19","WT1-KTS/DNA complex",\N
4709,"4709","2000-05-01",\N,"WT1+KTS/free",\N
4710,"4710","2000-05-01","2010-07-19","WT1+KTS/DNA complex",\N
4711,"4711","2000-09-25",\N,"NMR backbone assignments of the cold-regulated RNA-binding protein, RbpA1, in the cyanobacterium, Anabaena variabilis M3",\N
4712,"4712","2000-07-24",\N,"1H, 15N and 13C Assignments and secondary structure of nFGF",\N
4713,"4713","2000-06-15",\N,"Structural analysis of WW domains and design of a WW prototype",\N
4714,"4714","2000-06-15",\N,"Structural analysis of WW domains and design of a WW prototype",\N
4715,"4715","2000-06-15",\N,"Structural analysis of WW domains and design of a WW prototype",\N
4716,"4716","2000-07-24",\N,"1H, 15N, and 13C NMR Backbone Assignments and Secondary Structure of the C-terminal Recombinant Fragment of Auxilin Including the J-domain",\N
4717,"4717","2000-05-24",\N,"1H, 15N, 13C, and 13CO Assignments for ZipA",\N
4718,"4718","2001-05-01",\N,"Assignments of amide 1H, amide 15N, and Ca, CO, Cb 13C shifts for the replication terminator protein",\N
4719,"4719","2001-03-15",\N,"Backbone 1H, 13C and 15N chemical shift assignments of the Ras-binding domain (RBD) of AF6",\N
4720,"4720","2000-09-26","2007-03-27","Backbone 1H, 15N, and 13C Resonance Assignments of Inhibitor-2-- a Protein Inhibitor of Protein Phosphatase-1",\N
4721,"4721","2000-12-18",\N,"Structure of the Central Core Domain of TFIIEbeta with a Novel Double-stranded DNA-binding Surface",\N
4722,"4722","2000-06-15",\N,"1H,13C and 15N resonance assignments of Aquifex aeolifex aeolicus shikimate kinase in complex with shikimate",\N
4723,"4723","2000-05-08",\N,"Involvement of Electrostatic Interactions in the Mechanism of Peptide Folding Induced by Sodium Dodecyl Sulfate Binding",\N
4724,"4724","2000-05-09",\N,"Involvement of Electrostatic Interactions in the Mechanism of Peptide Folding Induced by Sodium Dodecyl Sulfate Binding",\N
4725,"4725","2002-04-03",\N,"Determination of the three dimensional structure and HN--S hydrogen bonding of the synthetic 113Cd3-beta-N domain of lobster MT-1 by Nuclear Magnetic Resonance",\N
4726,"4726","2000-12-07",\N,"Structure of a Conserved Domain Common to the Transcription Factors TFIIS, elongin A, and CRSP70",\N
4727,"4727","2000-12-07",\N,"Another piece of the Ribosome: Solution Structure of S16 and its Location in the 30S Subunit",\N
4728,"4728","2000-05-11",\N,"1H assignments of the EGF-like module 3 from vitamin K-dependent protein S",\N
4729,"4729","2000-05-11",\N,"1H, 15N, 13CA, 13CB, 13C' assignments of the EGF-like module pair 3-4 from vitamin K-dependent protein S",\N
4731,"4731","2001-04-30",\N,"Sequence-specific 1H, 13C, and 15N Assignment of the Human Melanoma Inhibitory Activity (MIA) Protein",\N
4732,"4732","2000-05-11",\N,"HMG-D complexed to a bulge DNA: an NMR study",\N
4733,"4733","2000-05-11","2010-07-16","HMG-D complexed to a bulge DNA: an NMR study",\N
4734,"4734","2000-05-11","2010-07-14","HMG-D complexed to a bulge DNA: an NMR study",\N
4735,"4735","2000-09-25",\N,"Sequence-specific NMR resonance assignments for the backbone atoms of olfactory marker protein (OMP)",\N
4736,"4736","2000-07-05",\N,"1H, 13C, 15N Chemical Shift Assignment for the human prion protein variant M166V",\N
4737,"4737","2000-06-13",\N,"The Structure of the Transcriptional Antiterminator NusB from Escherichia Coli",\N
4738,"4738","2001-10-17",\N,"Determination by High Field NMR Spectroscopy of the Longitudinal Electron Relaxation Rate in Cu(II)Plastocyanin from Anabaena variablis.",\N
4739,"4739","2000-12-18",\N,"NMR solution structure of the calcium-bound C-terminal domain (W81-S161) of Calcium Vector Protein from Amphioxus",\N
4740,"4740","2002-04-01",\N,"Solution Structure of a 8.3 kDa Protein (gene MTH1184) from Methanobacterium thermoautotrophicum",\N
4741,"4741","2002-04-08",\N,"Structure and folding of Glucagon-like Peptide 1-7-(7-36)-amide in aqueous trifluoroethanol studied by NMR",\N
4742,"4742","2000-06-15",\N,"Proton and nitrogen chemical shift assignments for the chitin-binding domain of Bacillus circulans WL-12 Chitinase A1",\N
4743,"4743","2000-07-13",\N,"1H Chemical Shift Assignments for fully reduced cytochrome c7 from Desulfuromonas acetoxidan",\N
4744,"4744","2000-07-13",\N,"1H Chemical Shift Assignments for fully oxidized cytochrome c7 from Desulfuromonas acetoxidans",\N
4745,"4745","2000-12-18",\N,"Solution Conformation of a Bulged Adenosine in an RNA Duplex by Relaxation Matrix Refinement",\N
4746,"4746","2000-06-29","2010-07-19","Average solution structure of d(TTGGCCAA)2 bound to Chromomycin-A3 and cobalt",\N
4747,"4747","2000-11-21",\N,"Random Coil Chemical Shifts in Acidic 8 M Urea and Their Implementation into NMRView",\N
4748,"4748","2001-02-15",\N,"Three-Dimensional Solution Structure of Oryzacystatin-I, a Cysteine Proteinase Inhibitor of the Rice, Oryza sativa L. japonica",\N
4749,"4749","2000-06-16","2010-07-14","NMR structure of a DNA three-way junction",\N
4750,"4750","2000-07-06",\N,"NMR structure of the most conserved RNA motif in Srp RNA",\N
4751,"4751","2000-12-18",\N,"Assignment of 1H and 15N resonances of mouse lysozyme",\N
4752,"4752","2000-09-27",\N,"1H,13C,15N chemical shift assignments for the DNA binding domain of gpNu1",\N
4753,"4753","2000-07-12","2010-07-16","Average solution structure of d(TTGGCCAA)2 bound to Chromomycin-A3 and zinc",\N
4754,"4754","2002-04-03",\N,"Determination of the three dimensional structure of the synthetic 113Cd3-beta-C domain of lobster MT-1 by Nuclear Magnetic Resonance",\N
4755,"4755","2001-02-15",\N,"Solution structure of HpTx2, a toxin from heteropoda venatoria spider that blocks Kv4.2 potassium channel",\N
4757,"4757","2000-06-27",\N,"1H, 13C, 15N Chemical Shift Assignment for the UBA(2) Domain of HHR23A",\N
4758,"4758","2001-05-01",\N,"A novel killer toxin-like protein, SKLP, is a member of the single-domain beta-gamma crystallin family proteins",\N
4759,"4759","2000-07-21",\N,"Backbone 1H, 15N and 13Calpha assigned chemical shifts for reduced Escherichia coli cytochrome b562",\N
4760,"4760","2000-06-27",\N,"Structural and Functional Differences of Two Toxins from the Scorpion Pandinus Imperator",\N
4761,"4761","2001-08-09",\N,"Magnetic Susceptibility Tensor and Heme Contact Shifts Determinations in the Rhodobacter capsulatus Ferricytochrome c': NMR and Magnetic Susceptibility Studies",\N
4762,"4762","2002-04-11",\N,"15N relaxation data and model-free parameters for the N-terminal receiver domain of wild-type unphosphorylated NtrC receiver domain (NtrCr)",\N
4763,"4763","2002-04-11",\N,"15N relaxation data and model-free parameters for the N-terminal receiver domain of double-mutant (D86N/A89T) unphosphorylated NtrC receiver domain (NtrCr(D86N/A89T))",\N
4764,"4764","2002-04-11",\N,"15N relaxation data and model-free parameters for the N-terminal receiver domain of phosphorylated NtrC receiver domain (P-NtrCr)",\N
4765,"4765","2000-09-27",\N,"Backbone 1H,13C, and 15N resonance assignments of an 18.2kDa protein, E.Coli peptidyl-prolyl cis-trans isomerase b (EPPIb)",\N
4766,"4766","2000-10-30",\N,"Backbone and partial side chain resonance assignments of Vesl-1S",\N
4767,"4767","2002-09-23",\N,"1Ha and 13Ca, 13Cb shifts of apocytochrome b562 at pH 5.1 (temperature 293 K)",\N
4768,"4768","2000-12-07",\N,"Structure of parvulin hPar14",\N
4769,"4769","2001-05-03",\N,"Backbone 1H, 13C and 15N assignments for yeast ubiquitin at pH 7.5",\N
4770,"4770","2003-06-12",\N,"Backbone 1HN, 15N and 13C shifts for GDP-loaded Cdc42 from Candida albicans",\N
4771,"4771","2000-10-30",\N,"Assignment of the 1H, 15N and 13C resonances of the C-terminal domain of the TolA protein of Escherichia coli, involved in the cell envelope integrity",\N
4772,"4772","2000-08-04",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for the N-terminal RNA-binding domain of human RNA-binding protein with multiple splicing",\N
4773,"4773","2001-08-09",\N,"Backbone assignments for OspA N-terminal fragment[27-163]",\N
4774,"4774","2001-05-03",\N,"Three-dimensional Structure of the Histidine-containing Phosphocarrier Protein (Hpr) from Enterococcus faecalis in Solution",\N
4775,"4775","2000-08-04",\N,"Solution structure of the spindle assembly checkpoint protein human MAD2",\N
4776,"4776","2001-01-19",\N,"Letter to the Editor: Backbone resonance assignment and secondary structure of the 30 kDa Sud dimer from Wolinella succinogenes",\N
4777,"4777","2000-12-18",\N,"Complete 1H, 15N and 13C Assignment of the Functional Domain of Paracoccus denitrificans Cytochrome c552 in the Oxidized state",\N
4778,"4778","2004-02-13",\N,"Backbone 1HN, 15N and 13C shifts for GMPPNP-loaded Cdc42 from Candida albicans",\N
4779,"4779","2000-12-18",\N,"Backbone sequential resonance assignments of the ligand binding domain of the human TGF-beta type II receptor",\N
4780,"4780","2002-04-04",\N,"NMR Structure of Stem-loop SL2 of the HIV-1 Psi RNA Packaging Signal Reveals a Novel A-U-A Base-triple Platform",\N
4781,"4781","2002-04-04",\N,"NMR Structure of Stem-loop SL2 of the HIV-1 Psi RNA Packaging Signal Reveals a Novel A-U-A Base-triple Platform",\N
4782,"4782","2000-11-29",\N,"1H, 13C and 15N NMR assignments of the C-type lectin TC14",\N
4784,"4784","2001-07-17",\N,"1H and 15N chemical shift assignments and interproton 3JHNHA coupling constants of the DNA-binding domain of the tyrosine repressor from Haemophilus influenzae, a transcription factor that belongs to the prokaryotic NtrC superfamily",\N
4785,"4785","2000-10-30",\N,"1H, 13C, and 15N assignment of a bleomycin resistance protein in its native form and in a complex with Zn(2+) ligated bleomycin",\N
4786,"4786","2000-10-30",\N,"1H, 13C, and 15N assignment of a bleomycin resistance protein in its native form and in a complex with Zn(2+) ligated bleomycin",\N
4787,"4787","2001-02-14",\N,"Assignment of 1H, 13C and 15N resonances of domain III of the ectodomain of apical membrane antigen 1 from Plasmodium falciparum",\N
4788,"4788","2000-12-18",\N,"1H,15N, and 13C NMR resonance assignments for the Eps15 Homology domain Resp1",\N
4789,"4789","2000-08-16",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for TAZ2 domain of CBP",\N
4790,"4790","2001-08-01",\N,"1H, 13C and 15N Resonance Assignments of the SNT PTB Domain in Complex with FGFR1 Peptide",\N
4791,"4791","2001-05-03",\N,"Sequence-specific 1H, 15N and 13C Resonance Assignments for an Engineered Arginine-rich Domain of the Hepatitis C Virus NS3 RNA Helicase",\N
4792,"4792","2002-04-04",\N,"Backbone NMR Assignment and Secondary Structure of the Dimeric ParD Protein",\N
4793,"4793","2001-02-15",\N,"Structure-based Functional Classification of Hypothetical Protein MTH538 from Methanobacterium thermoautotrophicum",\N
4794,"4794","2000-11-13",\N,"Chemical Shift Assignments for Human WT Gelsolin Domain 2",\N
4795,"4795","2000-11-13",\N,"Chemical Shift Assignments for Human D187N Gelsolin Domain 2",\N
4796,"4796","2002-01-23",\N,"Solution structure of hypothetical protein MTH1175 from Methanobacterium thermoautotrophicum",\N
4797,"4797","2000-11-29",\N,"Sequence-specific resonance assignments of the potent cytolysin equinatoxin II",\N
4798,"4798","2000-09-03",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for Frq1",\N
4799,"4799","2000-12-29",\N,"Solution Structure of Human Immunodeficiency Virus Type 1 Vpr (13-33) Peptide in Micells",\N
4800,"4800","2001-03-12",\N,"Chemical shifts of 1H resonances of the heme protons and of the side chain protons of the two axial ligands, His69 and Met106, and of Trp109 of the isolated c domain of Paracoccus pantotrophus in the reduced state",\N
4801,"4801","2001-03-12",\N,"Chemical shifts of 1H resonances of the heme protons and of the side chain protons of the two axial ligands, His69 and Met106, of the isolated c domain of Paracoccus pantotrophus in the oxidized state",\N
4802,"4802","2001-01-23",\N,"1H, 13C, and 15N sequential assignment of the triple labelled N-terminal domain of the Histone like Nucleoid Structuring protein (H-NS) from Salmonella typhimurium (first 64 residues of the protein)",\N
4803,"4803","2000-11-15",\N,"1H,13C and 15N chemical shifts of bovine ferrous cytochrome b5",\N
4804,"4804","2000-11-15",\N,"1H,13C and 15N chemical shifts of bovine ferrous cytochrome b5-N17D",\N
4805,"4805","2000-11-15",\N,"1H, 13C and 15N chemical shifts of bovine ferric cytochrome b5 in complex with horse heart ferric cytochrome c",\N
4806,"4806","2000-11-15",\N,"1H, 13C and 15N chemical shifts of bovine ferric cytochrome b5",\N
4807,"4807","2000-11-15",\N,"1H, 13C and 15N chemical shifts of bovine ferric cytochrome b5-N17D",\N
4808,"4808","2000-11-15",\N,"1H, 13C and 15N chemical shifts of bovine ferrous cytochrome b5 in complex with horse heart ferrous cytochrome c",\N
4809,"4809","2000-11-15",\N,"1H, 13C and 15N chemical shifts of bovine ferrous cytochrome b5-N17D in complex with horse heart ferrous cytochrome c",\N
4810,"4810","2000-11-15",\N,"1H, 13C and 15N chemical shifts of bovine ferric cytochrome b5 in complex with horse heart ferric cytochrome c",\N
4811,"4811","2000-11-13",\N,"1H and 15N Chemical Shift Assignments for Apo-Recombinant Bovine alpha-Lactalbumin",\N
4812,"4812","2000-11-13",\N,"1H Chemical Shift Assignments for Weak Toxin WTX from Naja kaouthia venom",\N
4813,"4813","2000-11-13","2010-07-14","NMR structure of lac repressor HP62-DNA complex",\N
4814,"4814","2001-02-14",\N,"Complete 1H, 15N, and 13C assignments of an exchangeable apolipoprotein, Locusta migratoria apolipophorin III",\N
4815,"4815","2000-11-13",\N,"NMR structure of Cardiotoxin in DPC-micelle",\N
4816,"4816","2002-04-04",\N,"Structural Features of an Influenza Virus Promoter and their Implications for Viral RNA Synthesis",\N
4817,"4817","2000-12-07","2012-11-08","Backbone and side chain 1H, 15N and 13C chemical shifts for Mj0307 from Methanococcus jannascii",\N
4818,"4818","2001-11-14","2012-11-08","1H, 15N and 13C Resonance Assignments for the N-Terminal Domain of the MAPK Phosphatase MKP3",\N
4819,"4819","2000-12-29",\N,"High precision NMR structure of YhhP, a novel Esherichia coli protein implicated in the cell division",\N
4820,"4820","2001-01-29",\N,"1H and 13Ca Chemical Shift Assignments for the Pheromone Er-22",\N
4821,"4821","2000-11-29",\N,"Assignment of 1H, 13C, and 15N resonances to the sensory domain of membraneous two-component fumarate sensor (histidine protein kinase) DcuS of Escherichia coli",\N
4822,"4822","2001-03-12",\N,"Conformations of the Regulatory Domain of Cardiac Troponin C Examined by Residual Dipolar Couplings; Apo form",\N
4823,"4823","2001-03-12",\N,"Conformations of the Regulatory Domain of Cardiac Troponin C Examined by Residual Dipolar Couplings; Holo form",\N
4824,"4824","2001-03-12",\N,"Conformations of the Regulatory Domain of Cardiac Troponin C Examined by Residual Dipolar Couplings; Complex with peptide",\N
4825,"4825","2000-11-13",\N,"1H, 15N and 13C NMR Resonance Assignments of RC-RNase 2",\N
4827,"4827","2002-04-08",\N,"Structural comparison between WT and P25S human cystatin A by NMR spectroscopy. Does this mutation affect the alpha-helix conformation? -- Part I wild type assignments",\N
4828,"4828","2002-04-08",\N,"Structural comparison between WT and P25S human cystatin A by NMR spectroscopy. Does this mutation affect the alpha-helix conformation? -- Part II P25S",\N
4829,"4829","2001-11-14",\N,"1H, 15N and 13C resonance assignments for the DNA-binding domain of interleukin enhancer binding factor",\N
4830,"4830","2001-08-01",\N,"The Hairpin Structure of the (6)F1(1)F2(2)F2 Fragment from Human Fibronectin Enhances Gelatin Binding",\N
4831,"4831","2001-05-01",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for Lysozyme",\N
4832,"4832","2000-12-07",\N,"Insulin Like Growth Factor 1",\N
4833,"4833","2001-07-11",\N,"1H, 13C, and 15N assignments for the Antifungal protein from Streptomyces tendae Tu901",\N
4834,"4834","2001-02-14",\N,"Backbone (1H, 15N, 13C) Resonance Assignments of a 21 kDa construct of S. aureus Peptide Deformylase",\N
4835,"4835","2000-12-07","2010-07-19","NMR Structure of the palindromic DNA decamer D(GCGTTAACGC)2",\N
4836,"4836","2000-11-09","2007-03-26","Complete 1H, 13C and 15N Backbone Assignments for the Hepatitis A Virus 3C Protease",\N
4837,"4837","2001-07-11",\N,"Solution Structure of Methylophilus methylotrophus Cytochrome C'': Insights into the Structural Basis of Heme-ligand Detachment",\N
4838,"4838","2000-11-20",\N,"NMR Mapping and Secondary Structure Determination of the Major Acetylcholine Receptor alpha-Subunit Determinant Interacting with alpha-Bungarotoxin",\N
4839,"4839","2001-04-26",\N,"Full assignments of RSVPR deltaLAM",\N
4840,"4840","2001-02-14",\N,"1H, 13C and 15N resonance assignment and secondary structure of Mycobacterium tuberculosis adenylate kinase",\N
4841,"4841","2001-04-26",\N,"1H, 15N and 13C chemical shift assignments for the PAH2 domain of mSin3B complexed to Mad1-SID",\N
4842,"4842","2000-11-29",\N,"NMR solution structure of porcine peptide YY",\N
4843,"4843","2001-02-14",\N,"Secondary Structure and Backbone Resonance Assignments for Human Interleukin-13",\N
4844,"4844","2001-05-17",\N,"Backbone HN, N , Ca, C' and Cb assignment of the 25 kDa peptide methionine sulfoxide reductase from Erwinia chrysanthemi",\N
4845,"4845","2001-03-12",\N,"NMR solution structure of alpha-conotoxin Im1 point mutation variant R11E",\N
4846,"4846","2001-03-12",\N,"NMR solution structure of alpha-conotoxin Im1 point mutation variant R7L",\N
4847,"4847","2001-03-12",\N,"NMR solution structure of alpha-conotoxin Im1 point mutation variant D5N",\N
4848,"4848","2001-11-14",\N,"Conformational Changes in the Isolated N-terminal Domain of 5-Enolpyruvylshikimate-3-phosphate Synthase upon Shikimate-3-phosphate Binding",\N
4849,"4849","2001-02-14",\N,"NMR Assignment of the A form of the Pheromone-binding Protein of Bombyx mori",\N
4850,"4850","2001-03-12",\N,"Glutaredoxin 3 from Escherichia coli in the fully oxidized form",\N
4851,"4851","2000-10-23",\N,"CDC4P from Schizosaccharomyces pombe",\N
4852,"4852","2000-10-23",\N,"1H and 15N chemical shift assignments for Herpersvirus-8 MIP-II",\N
4853,"4853","2000-10-23",\N,"1H Chemical Shift Assignment for the Major Conformer in Solution of the Alpha-like Scorpion Toxin LqhIII",\N
4854,"4854","2001-11-14",\N,"Chemical shift assignments for the isolated N-terminal domain of EPSP synthase",\N
4855,"4855","2000-11-29",\N,"(14-38, 30-51) Double-disulphide intermediate in folding of Bovine Pancreatic Trypsin Inhibitor: A two-dimensional 1H nuclear magnetic resonance study",\N
4856,"4856","2002-01-23",\N,"Structural Insight into Human Zn(2+)-bound S100A2 from NMR and Homology Modeling",\N
4857,"4857","2000-11-29",\N,"Solution structure and dynamic character of the histidine-containing phosphotransfer domain of anaerobic sensor kinase ArcB from Escherichia coli",\N
4858,"4858","2001-11-14",\N,"SOLUTION STRUCTURE OF NUCLEOLIN RBD1",\N
4859,"4859","2002-04-04",\N,"HIGH RESOLUTION SOLUTION STRUCTURE OF THE PROTEIN PART OF CU7 METALLOTHIONEIN",\N
4860,"4860","2000-12-07",\N,"1H, 13C, and 15N Chemical Shift Assignments for human lymphocyte specific kinase (Lck) unique and SH3 domain",\N
4862,"4862","2000-11-29",\N,"[ALA31, AIB32]-NEUROPEPTIDE Y",\N
4863,"4863","2001-11-14",\N,"SOLUTION STRUCTURE OF NUCLEOLIN RBD2",\N
4864,"4864","2000-12-04",\N,"NMR Chemical shift mapping of the binding site of a protein proteinase inhibitor: changes in the 1H, 13C and 15N NMR chemical shifts of turkey ovomucoid third domain upon binding to bovine chymotrypsin Aa",\N
4865,"4865","2000-12-04",\N,"Backbone 1H, 13C, 15N Chemical shift Assignment for OMTKY3 bound to bovine Chymotrypsin Aa",\N
4866,"4866","2000-12-18",\N,"Backbone Resonance Assignment of Human UBC4",\N
4867,"4867","2001-11-14",\N,"SOLUTION STRUCTURE OF NUCLEOLIN RBD12 IN COMPLEX WITH SNRE RNA",\N
4868,"4868","2000-11-29",\N,"Sequential 1H assignments for BPTI-R52 (= BPTI with Met to Arg mutation at position 52)",\N
4869,"4869","2001-11-14",\N,"HMG PROTEIN NHP6A FROM SACCHAROMYCES CEREVISIAE",\N
4870,"4870","2001-06-29",\N,"Sequence-specific 1H, 15N, and 13C resonance assignments for the whole region 4 of Escherichia coli RNA polymerase sigma70 subunit",\N
4871,"4871","2001-11-14",\N,"1H, 13C and 15N Resonance Assignments and Secondary Structure of the c-Myc Binding Domain (MBD) and the SH3 Domain of the Tumor Suppressor Bin1",\N
4872,"4872","2000-12-04",\N,"Interhelical Ion Pairing in Coiled Coils: Solution Structure of a Heterodimeric Leucine Zipper and Determination of pKa Values of Glu Side Chains",\N
4873,"4873","2000-11-29",\N,"Partially folded conformation of the (30-51) intermediate in the disulphide folding pathway of bovine pancreatic trypsin inhibitor. 1H and 15N resonance assignments and determination of backbone dynamics from 15N relaxation measurements",\N
4874,"4874","2001-04-26",\N,"Sequence-specific assignment of the PAH2 domain of Sin3B free and complexed to Mad1",\N
4875,"4875","2000-11-29",\N,"1H NMR Analysis of the partly-folded non-native two-disulphide intermediates (30-51, 5-14) and (30-51, 5-38) in the folding pathway of bovine pancreatic trypsin inhibitor",\N
4876,"4876","2001-04-30",\N,"1H,13C,15N assignment of Ca2+-bound state of Canine Milk Lysozyme at 30deg",\N
4877,"4877","2000-11-29",\N,"1H NMR Analysis of the partly-folded non-native two-disulphide intermediates (30-51, 5-14) and (30-51, 5-38) in the folding pathway of bovine pancreatic trypsin inhibitor",\N
4878,"4878","2001-03-12",\N,"Three-dimensional Structure Topology of the Calreticulin P-domain based on NMR Assignment",\N
4879,"4879","2001-04-26",\N,"Assignment of the 1H, 13C and 15N Signals of Sortase",\N
4880,"4880","2001-02-27",\N,"1H, 15N and 13C resonance assignments of the N-terminal region of calponin",\N
4881,"4881","2000-12-05",\N,"Backbone 1H, 13C, 15N and 13CB and 1HB chemical shift assignments for Azotobacter vinelandii C69A holoflavodoxin",\N
4882,"4882","2001-07-11",\N,"1H NMR Study on the Binding of Pin1 Trp-trp domain with Phosphothreonine Peptides",\N
4883,"4883","2001-04-30",\N,"1H,15N assignment of Ca2+-free state of Canine Milk Lysozyme at 20deg",\N
4884,"4884","2001-03-12",\N,"1st LIM domain of PINCH protein",\N
4885,"4885","2001-11-14",\N,"Backbone 1H, 15N and 13C Resonance Assignments of the NTPase Subdomain of the Hepatitis C Virus NS3 RNA Helicase",\N
4886,"4886","2000-12-04",\N,"Backbone 1H and 15N and 1HB chemical shift assignments for Azotobacter vinelandii C69A apoflavodoxin",\N
4887,"4887","2001-04-30",\N,"1H,15N assignment of Ca2+-bound state of Canine Milk Lysozyme at 20deg",\N
4888,"4888","2002-01-23",\N,"Backbone 1H and 15N Chemical Shift Assignment of c-Src SH3 in high salt solution",\N
4889,"4889","2002-01-23",\N,"Backbone 1H and 15N Chemical Shift Assignment of c-Src SH3 complexed with RLP2 ligand in high salt solution",\N
4890,"4890","2000-12-04",\N,"1H resonance assignments for the N-ter domain of the human TFIIH MAT1 subunit",\N
4891,"4891","2000-12-04",\N,"1H chemical shift assignments for cobrotoxin II",\N
4892,"4892","2001-04-27",\N,"1H, 13C, and 15N Chemical Shift Assignments for apo-Mts1 (S100A4)",\N
4893,"4893","2001-11-20",\N,"1H, 15N and 13C NMR Resonance Assignments of RC-RNase 4",\N
4894,"4894","2000-12-06",\N,"RNA recognition by a staufen double-stranded RNA-binding domain",\N
4895,"4895","2001-11-14",\N,"Solution NMR Structure of the Cold-shock Protein from the Hyperthermophilic Bacterium Thermotoga maritima",\N
4896,"4896","2001-04-26",\N,"Sequential Assignment and Secondary Structure of the 14kDa chemotactic Protein CheY2 from Sinorhizobium meliloti",\N
4897,"4897","2001-02-27",\N,"Sequential assignment, secondary structure and binding site of the carbohydrate-binding domain of papg from Uropathogenic E.coli",\N
4898,"4898","2002-04-08","2005-06-02","Assignment of 1H, 13C, 15N and 31P resonances of the FYVE domain in the complex with phosphatidylinositol 3-phosphate.",\N
4899,"4899","2001-05-03",\N,"SMN Tudor Domain Structure and its Interaction with the Sm Proteins",\N
4900,"4900","2001-08-08",\N,"1H and 15N chemical shift assignments of the C-terminal xylan binding module of C. fimi xylanase 11A",\N
4901,"4901","2001-04-26",\N,"1H, 15N, 13C assignments of the N-terminal domain of the human TFIIH p62 subunit",\N
4902,"4902","2001-04-26",\N,"Complete sequence-specific 1H, 13C and 15N resonance assignments of a novel hPTK6 SH2 domain",\N
4905,"4905","2001-08-08",\N,"1H, 13C and 15N Chemical Shift Assignments for Urea-denatured G88W-110 Fragment of Staphylococcal Nuclease",\N
4906,"4906","2001-05-09",\N,"Solution Structure of a C-Terminal Coiled-Coil Domain from Bovine IF1 - the Inhibitor Protein of F1 ATPase",\N
4907,"4907","2000-12-22",\N,"NMR Solution Structure of Phospholamban",\N
4908,"4908","2001-11-14",\N,"Assignment of 1H, 13C and 15N resonances of the a'-domain of ERp57",\N
4909,"4909","2001-05-17",\N,"Assignment of 1H, 15N and 13C resonances of the carbohydrate recognition domain of human galectiin-3",\N
4910,"4910","2002-02-01","2005-11-11","1H and 15N chemical shift assignments for LEKTI domain one (HF6478)",\N
4911,"4911","2001-08-08",\N,"Structural Basis of Diverse Sequence-dependent Target Recognition by the 8kDa Dynein light chain",\N
4912,"4912","2001-08-08",\N,"Structural Basis of Diverse Sequence-dependent Target Recognition by the 8kDa Dynein light chain",\N
4913,"4913","2001-08-08",\N,"Backbone 1H, 15N, and 13C Resonance Assignments of ARPP-19",\N
4914,"4914","2001-01-23",\N,"Backbone 1H chemical shift assignments for vMIP-II",\N
4915,"4915","2001-03-07",\N,"Structure and Function of the C-terminal PABC Domain of Human Poly(A)-binding Protein",\N
4916,"4916","2001-08-08",\N,"RECEPTOR-BOUND CONFORMATION OF PACAP21",\N
4917,"4917","2001-01-09",\N,"Solution structure of a lipid transfer protein extracted from rice seeds. Comparison with homologous proteins",\N
4918,"4918","2001-01-04",\N,"Letter to the Editor: Assignments of 1H and 15N resonances of the Pseudomonas aeruginosa K122-4 pilin monomer.",\N
4919,"4919","2001-08-08",\N,"Thioredoxin fold as a Homodimerization Module in the Putative Chaperone ERp29: NMR Structures of the Domains and Experimental Model of the 51 kDa Dimer",\N
4920,"4920","2001-08-08",\N,"Thioredoxin fold as a Homodimerization Module in the Putative Chaperone ERp29: NMR Structures of the Domains and Experimental Model of the 51 kDa Dimer",\N
4921,"4921","2002-08-22","2005-09-26","Solution structure of poneratoxin",\N
4922,"4922","2001-08-08",\N,"Backbone 1H, 13C and 15N chemical shift assignments for unfolded apoplastocyanin",\N
4923,"4923","2002-09-23",\N,"1H chemical shift assignments for omega-atracotoxin-Hv2a",\N
4924,"4924","2002-04-03",\N,"Interactions of a toxin from the scorpion Tityus serrulatus with a cloned K+ channel from squid (SqKv1A).",\N
4925,"4925","2001-09-12",\N,"Structural Basis for the Functional switch of the E. Coli Ada Protein",\N
4926,"4926","2001-03-06",\N,"1H and 15N Chemical Shifts of CI2 with a ten glutamine repeat between residues 59 and 60",\N
4927,"4927","2002-04-04",\N,"1H, 13C, 15N Resonance Assignments of a Circular Permuted Variant of CV-N (cpCV-N)",\N
4928,"4928","2001-01-19",\N,"Structure of the PHD Zinc finger from human Williams-Beuren syndrome transcription factor",\N
4929,"4929","2001-05-17",\N,"The 1H, 15N and 13C resonance assignments for the Tctex1 dynein light chain from Chlamydomonas flagella",\N
4930,"4930","2001-01-04",\N,"1H and 15N Chemical Shift Assignments for the homodimer of human TFF1",\N
4931,"4931","2001-08-22",\N,"Solution structure of dynein light chain 8 (DLC8) and bim peptide complex",\N
4932,"4932","2001-01-09",\N,"NMR Structure of wheat nonspecific lipid transfer protein",\N
4933,"4933","2001-02-15",\N,"1H and 15N Chemical Shift Assignments for a Cys58Ser mutant of TFF1",\N
4934,"4934","2001-01-23",\N,"Structure and functionality of a designed p53 dimer",\N
4935,"4935","2001-06-29",\N,"Backbone Assignments for Af19",\N
4936,"4936","2001-07-31","2005-09-22","1H, 13C and 15N chemical shift assignments of the outer membrane protein OmpX from E.coli in DHPC micelles",\N
4937,"4937","2001-01-23",\N,"1H chemical shifts for 'Hairpinless' mutant of omega-atracotoxin-Hv1a",\N
4938,"4938","2001-08-22",\N,"Two Different Neurodegenerative Diseases Caused by Proteins with Similiar Structures",\N
4939,"4939","2001-01-23",\N,"Solution Structures of Two CCHC Zinc Fingers from the FOG Family Protein U-shaped that Mediate Protein-Protein Interactions",\N
4940,"4940","2001-06-29",\N,"1H, 13C and 15N chemical shift assignment of the honeybee pheromone carrier protein ASP1",\N
4941,"4941","2002-01-23",\N,"The Three-dimensional Structure of the C-terminal DNA-binding Domain of Human Ku70",\N
4942,"4942","2002-04-03",\N,"1H, 15N and 13C Resonance Assignments and Secondary Structure of the Liver Ribonuclease from Bullfrog Rana catesbeiana",\N
4943,"4943","2003-05-21",\N,"1H Chemical shift Assignments for Lysozymes marketed by Seikagaku and Sigma companies at pH 3.8, 308K",\N
4944,"4944","2001-05-17",\N,"1H, 13C and 15N backbone resonance assignment of the arsenate reductase from Staphylococcus aureus in its reduced state.",\N
4945,"4945","2001-08-22",\N,"VAM3P N-TERMINAL DOMAIN SOLUTION STRUCTURE",\N
4946,"4946","2001-08-22",\N,"Solution Structures of C-1027 Apoprotein and its Complex with the Aromatized Chromophore",\N
4947,"4947","2001-08-22",\N,"Solution Structures of C-1027 Apoprotein and its Complex with the Aromatized Chromophore",\N
4948,"4948","2001-03-09",\N,"1H Chemical Shift Assignments of a-bungarotoxin/ nicotinic acetilcholine receptor mimotope complex",\N
4950,"4950","2001-03-09",\N,"Structure of the Anchor-Domain of Myristoylated and Non-myristoylated HIV-1 Nef Protein",\N
4951,"4951","2001-03-09",\N,"Structure of the Anchor-Domain of Myristoylated and Non-myristoylated HIV-1 Nef Protein",\N
4952,"4952","2001-03-09",\N,"The UBX Domain: A Widespread Ubquitin-like Module",\N
4953,"4953","2001-06-29",\N,"Assignment of 1H, 13C and 15N resonances of the PPIase domain of the trigger factor from Mycoplasma genitalium",\N
4954,"4954","2002-02-01",\N,"1H, 13C and 15N chemical shifts assignments for the N-terminal domain of riboflavin synthase of E. Coli with riboflavin as a bound ligand",\N
4955,"4955","2001-08-22",\N,"NMR Structure of Cysteinyl-phosphorylated Enzyme IIB of the N,N'-diacetylchitobiose-specific Phosphoenolpyruvate-dependent Phosphotransferase System of Escherichia coli",\N
4956,"4956","2001-07-30",\N,"1H, 13C and 15N resonance assignment of YajQ, a protein of unknown structure and function from Escherichia coli",\N
4957,"4957","2002-04-01",\N,"Solution Structure of the Transcriptional Activation Domain of the Bacteriophage T4 Protein, MotA",\N
4958,"4958","2002-04-03","2013-05-07","1H, 13C and 15N Sequence-specific Resonance Assignment of the PSCD4 Domain of Diatom cell wall Protein Pleuralin-1",\N
4959,"4959","2001-05-15",\N,"Solution structure of the epsin N-terminal homology (ENTH) domain of human epsin",\N
4960,"4960","2001-03-09",\N,"Solution Conformation of the Met 61 to His 61 Mutant of Pseudomonas stutzeri substarin ZoBell Ferrocytochrome c-551",\N
4961,"4961","2001-03-07",\N,"1H, 15N and 13C assignments of the N-terminal domain of Yersinia outer protein H in its apo form and in complex with a phosphotyrosine peptide representing the putative binding site on host protein target p130Cas",\N
4963,"4963","2001-04-30",\N,"Chemical Shift Assignments and Coupling Constants for the rat Nedd4 WWIII domain - rat ENaC bP2 Peptide Complex",\N
4964,"4964","2001-08-08",\N,"1H, 13C and 15N resonance assignment for barnase",\N
4965,"4965","2001-03-07","2006-10-11","1H, 15N, and 13C Assignments and Secondary Structure Identification for Full-length Ribosomal Protein L11 from Thermus thermophilus",\N
4966,"4966","2001-03-09",\N,"1H and 13C Chemical Shift Assignments for Cardiotoxin A3 from Naja Atra at Neutral pH",\N
4967,"4967","2001-07-30",\N,"Letter to the Editor: Backbone resonance assignment of Mason-Pfizer Monkey Virus Protease",\N
4968,"4968","2002-02-26",\N,"Bovine Pancreatic Trypsin Inhibitor pH 5.8",\N
4969,"4969","2002-12-23",\N,"Backbone 1H, 13C and 15N chemical shift assignments for the Brucella D4.4 VH antibody fragment",\N
4970,"4970","2003-06-09","2007-03-19","NMR Relaxation data for Protein Calmodulin in complex with the smooth muscle myosin light chain kinase calmodulin binding domain",\N
4971,"4971","2002-04-08",\N,"NMR data for the Carp Granulin 1 3-30 subfragment",\N
4972,"4972","2002-09-23",\N,"1H, 13C, and 15N assignment of Crh, a protein involved in carbon catabolite repression in B. subtilis",\N
4973,"4973","2002-04-04","2009-10-06","Sequential Assignment and Secondary Structure of Saratin, an Inhibitor of von Willebrand factor-dependent Platelet Adhesion to Collagen",\N
4974,"4974","2001-10-17",\N,"Rapid Protein fold Determination using Secondary Chemical Shifts and Cross- hydrogen bond 15N-13C' Scalar Couplings (3hbJNC')",\N
4975,"4975","2001-10-08",\N,"Assignment of selectively 13C-labeled cellopentaose synthesized using an engineered glycosynthase",\N
4976,"4976","2002-04-04",\N,"Antifungal and antibacterial mutant of heliomicin",\N
4977,"4977","2001-05-10",\N,"1H and 15N NMR assignments of the 7kd wheat lipid transfer protein",\N
4978,"4978","2001-07-30",\N,"NMR assignments for the Ca2+-bound B0 isoform of the C-terminal globular domain of agrin (agrin-G3)",\N
4979,"4979","2001-11-09",\N,"1H and 13C chemical shift assignments for the pheromone Er-23 from Euplotes raikovi",\N
4980,"4980","2001-07-30",\N,"1H and 15N sequential assignment and secondary structure of the monomeric N67D mutant of bovine seminal ribonuclease",\N
4981,"4981","2001-05-10",\N,"Identification of the phospholipid binding site of human beta2-glycoprotein I domain V by heteronuclear magnetic resonance",\N
4982,"4982","2003-05-23","2008-07-01","1H, 13C and 15N NMR sequence-specific resonance assignments for bovine apo-S100A1(aa) in oxidized form",\N
4983,"4983","2002-04-03",\N,"Backbone 1H, 15N, 13C and side chain 13C assignment of YUH1-Ub in a 35 kDa complex",\N
4984,"4984","2002-04-04",\N,"The Solution Structure and Interactions of CheW from Thermotoga maritima",\N
4985,"4985","2001-10-08",\N,"Letter to the Editor: 1H, 13C, and 15N assignment of the flavodoxin-like domain of the Escherichia coli sulfite reductase",\N
4986,"4986","2001-09-12",\N,"Backbone 1H,13C and 15N chemical shift assignment for the ligand-free state of maltodextrin-binding protein",\N
4987,"4987","2001-09-12",\N,"Backbone 1H,13C and 15N chemical shift assignment for the maltotriose-bound state of 2H,13C,15N-labeled maltodextrin-binding protein",\N
4988,"4988","2001-05-11",\N,"Three Dimensional Solution Structure of Huwentoxin-II BY 2D 1H-NMR",\N
4989,"4989","2002-04-03",\N,"Solution Structure of B.subtilis Acyl Carrier Protein",\N
4990,"4990","2002-09-23",\N,"Solution structure of betacellulin, a new member of EGF-family ligands.",\N
4991,"4991","2002-08-22",\N,"Identification of a novel archaebacterial thioredoxin: Determination of function through structure.",\N
4992,"4992","2001-10-08",\N,"Assignment of 1H, 13C and 15N NMR signals from the toluene 4-monooxygenase Rieske ferredoxin",\N
4993,"4993","2002-04-04","2012-11-29","Spatial structure of Zervamicin IIB bound to DPC micelles.",\N
4994,"4994","2001-09-12","2010-01-06","Structure of the C-domain of Human Cardiac Troponin C in Complex with the Ca2+ Sensitizing Drug EMD 57033",\N
4995,"4995","2001-10-17","2008-09-26","Solution NMR Structure and Folding Dynamics of the N-terminus of a rat Non-muscle Alpha-tropomyosin in an Engineered Chimeric Protein",\N
4996,"4996","2001-10-08",\N,"NMR-Based Structure of the Conserved Protein MTH865 from the Archea Methanobacterium thermoautotrophicum",\N
4997,"4997","2001-05-21",\N,"1H, 13C Chemical Shift Assignment of PT-insulin in H2O and 35% TFE",\N
4998,"4998","2003-01-07",\N,"1H, 13C and 15N Chemical Shift Assignments for the HPV-18 E2 DNA-binding Domain",\N
4999,"4999","2001-10-08",\N,"Assignment of the 1H, 15N and 13C resonances of the nucleocapsid-binding domain of the Sendai virus Phosphoprotein",\N
5000,"5000","2002-05-09",\N,"1H, 15N and 13C Resonance Assignments for the N-Terminal Domain of the MAPK Phosphatase PAC-1",\N
5003,"5003","2002-04-05",\N,"Backbone Sequential Resonance Assignments of Yeast iso-2 Cytochrome c, Reduced and Oxidized forms",\N
5004,"5004","2002-05-09",\N,"1H, 13C, 13CO, and 15N Chemical Shift Assignments for human IL-13",\N
5005,"5005","2002-04-05",\N,"Backbone Sequential Resonance Assignments of Yeast iso-2 Cytochrome c, Reduced and Oxidized forms",\N
5006,"5006","2001-05-11","2005-02-16","1H Chemical Shift Assignments for alpha-Bungarotoxin",\N
5007,"5007","2001-06-07",\N,"SOLUTION STRUCTURE OF THE VS RIBOZYME SUBSTRATE STEM-LOOP",\N
5008,"5008","2002-08-22",\N,"Assignment of 1H,13C and 15N backbone resonances of p13suc1 proteins -- wild type",\N
5009,"5009","2002-08-22",\N,"Assignment of 1H,13C and 15N backbone resonances of p13suc1 proteins -- PA90",\N
5010,"5010","2002-04-05",\N,"1H, 15N, and 13C chemical shift assignments for DNA polymerase X",\N
5011,"5011","2001-06-14",\N,"Anabaena apoflavodoxin hydrogen exchange: on the stable exchange core of the alfa/beta(21345) flavodoxin-like family",\N
5012,"5012","2001-09-13",\N,"Gelatin-binding Region of Human Matrix Metalloproteinase-2: Solution Structure, Dynamics, and Function of the COL-23 Two-domain Construct",\N
5013,"5013","2002-01-23",\N,"1H, 15N and 13C Assignments of the Catalytic Domain of E6-associated Protein (E6AP)",\N
5014,"5014","2001-05-22","2005-02-16","Sequence Specific Resonance Assignment of the Central Domain of Cardiac Myosin Binding Protein C (MyBP-C)",\N
5018,"5018","2002-05-09",\N,"Solution Structure of the Tumor Necrosis Factor Receptor-1 Death Domain",\N
5019,"5019","2002-04-05",\N,"1H, 13C and 15N Chemical Shift Assignments of the N-terminal PAS Domain of mNPAS2",\N
5020,"5020","2002-04-05",\N,"NMR Ensemble of Ion-Selective Ligand D18 for Platelet Integrin AlphaIIb-Beta3",\N
5021,"5021","2002-04-05",\N,"NMR Ensemble of Ion-Selective Ligand D18 for Platelet Integrin AlphaIIb-Beta3",\N
5022,"5022","2003-01-07",\N,"Converting a DNA Damage Checkpoint Effector (UmuD2C) into a Lesion Bypass Polymerase (UmuD'2C)",\N
5023,"5023","2001-08-20",\N,"Structural and thermodynamic studies on mutant RNA motifs that impair the specificity between a viral replicase and its promoter",\N
5024,"5024","2001-07-05",\N,"The NMR solution structure of alpha-bungarotoxin",\N
5025,"5025","2001-07-16",\N,"The Solution Structure of the Complex Formed between alpha-Bungarotoxin and an 18mer Cognate Peptide Derived from the alpha1 Subunit of the Nicotinic Acetylcholine Receptor from Torpedo californica",\N
5026,"5026","2002-08-22",\N,"Solution structure of cyanoferricytochrome C",\N
5027,"5027","2002-01-23",\N,"NMR Structure of Human Fibronectin EDA",\N
5028,"5028","2001-05-23",\N,"Solution Structure of MCOTI-II, a Macrocyclic Trypsin Inhibitor",\N
5029,"5029","2001-05-29",\N,"Solution Structure of an Insect-specific Neurotoxin from the New World Scorpion Centruroides sculpturatus Ewing",\N
5030,"5030","2002-05-30",\N,"1H, 13C and 15N Chemical Shift Assignment of the Honeybee Odorant-binding Protein ASP2",\N
5031,"5031","2001-05-25",\N,"Sequence-specific 1H, 13C and 15N resonance assignments of the N-terminal, 135-residue domain of KaiA, a clock protein from Synechococcus elongatus",\N
5032,"5032","2001-06-05","2010-07-19","1H, 13C and 15N Resonance Assignments of the DNA Binding Domain of the Human Forkhead Transcription Factor AFX",\N
5033,"5033","2002-01-23",\N,"NMR Solution Structures of the Antifungal Heliomicin",\N
5034,"5034","2002-09-23",\N,"Solution structure of novispirin-2",\N
5036,"5036","2001-07-05",\N,"Solution Structure and Backbone Dynamics of the DNA-Binding Domain of Mouse Sox-5",\N
5037,"5037","2002-09-23",\N,"Solution structure of ovispirin-1",\N
5038,"5038","2001-06-08",\N,"Assignments for human ubiquitin-conjugating enzyme 2b (HsUbc2b)",\N
5039,"5039","2002-04-04",\N,"Solution Structure of Ptu1, a Toxin from the Assassin bug Peirates turpis that blocks the Voltage-sensitive Calcium Channel N-type",\N
5040,"5040","2002-01-23",\N,"Backbone 1H, 15N, and 13C Resonance Assignments of Inhibitor-1--a Protein Inhibitor of Protein Phosphatase-1",\N
5041,"5041","2001-11-08",\N,"Solution structure and backbone dynamics of human DNA ligase IIIalpha BRCT domain",\N
5042,"5042","2001-10-17",\N,"1H, 13C, and 15N Chemical Shift Assignments for Human Lymphotactin",\N
5043,"5043","2001-06-19",\N,"LEM Domain of Human Inner Nuclear Membrane Protein LAP2",\N
5044,"5044","2001-11-14",\N,"1H, 13C, and 15N Chemical shift assignments for the third Immunoglobulin domain from the neural cell adhesion molecule, N-CAM",\N
5046,"5046","2005-11-11",\N,"NMR Structure of HCV IRES RNA Domain IIIC",\N
5047,"5047","2001-11-14",\N,"NMR structure of the LCCL Domain and its Implications for DFNA9 Deafness Disorder",\N
5048,"5048","2002-06-13",\N,"1H and 15N assignments of rat apo cellular retinol-binding protein type I (CRBP-I)",\N
5049,"5049","2002-04-05",\N,"Backbone 1H, 13C, and 15N data for the extracellular domain of human IFNAR2",\N
5050,"5050","2002-08-22",\N,"Solution structure of Bungarus fasciatus IX, a Kunitz-type chymotrypsin inhibitor",\N
5051,"5051","2002-08-22",\N,"Backbone 1H, 13C, and 15N and Side-Chain 1H Chemical Shift Assignments for MTH1692",\N
5052,"5052","2001-06-18",\N,"1H Assigned Chemical Shifts for Neurotoxin II",\N
5053,"5053","2002-08-22",\N,"Solution Structure of the Orphan PABC Domain from Saccharomyces cerevisiae Poly(A)-binding Protein",\N
5054,"5054","2002-04-05",\N,"The Structure of Ap4A Hydrolase Complexed with ATP-MgFx Reveals the Basis of Substrate Binding",\N
5055,"5055","2001-10-16",\N,"Solution Structure of HI0257, a Bacterial Binding Protein",\N
5056,"5056","2003-01-06",\N,"ATT an Arabidopsis thaliana Inhibitor of Trypsin and Chymotrypsin: Sequence-Specific Multinuclear Magnetic Resonance Assignments and Secondary Structure",\N
5057,"5057","2002-01-23",\N,"1H Chemical Shift Assignments for Alzheimer peptide Ab(1-40)",\N
5058,"5058","2001-11-06",\N,"Letter to the Editor: Sequence specific 1H, 13C and 15N resonance assignments of human GABA receptor associated protein",\N
5059,"5059","2002-08-22",\N,"Chemical shift assignments for EC005 from E. coli",\N
5060,"5060","2002-02-20",\N,"1H, 15N, 13C NMR Assignments of TM006 Protein from Thermotoga maritima",\N
5061,"5061","2001-11-07",\N,"1H, 13C, and 15N Chemical Shift Assignments for DNA-binding domain of ADR6",\N
5062,"5062","2002-01-23",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignment for Unfolded HIV-1 protease tethered dimer",\N
5064,"5064","2001-11-06",\N,"Backbone 1H, 13C, and 15N resonance assignments for a 14 kD protein, GABAA receptor associated protein (GABARAP)",\N
5065,"5065","2001-11-14",\N,"Quail Cysteine and Glycine-rich Protein, NMR, 15 Minimized Model Structures",\N
5066,"5066","2001-10-17",\N,"1H and 15N Chemical Shift Assignments for the Alpha-domain of Mouse Metallothionein-3",\N
5067,"5067","2001-11-14",\N,"Solution Structure of the Lipoyl Domain of the Chimeric Dihydrolipoyl Dehydrogenase P64K from Neisseria meningitidis",\N
5068,"5068","2002-02-27","2004-12-22","Recombinant hen lysozyme containing the extra N-terminal Met as the standard reference for the study of hen lysozyme variants",\N
5069,"5069","2002-02-27","2004-12-22","NMR Structural Study of Two-Disulfide Variant of hen Lysozyme: 2SS[6-127, 30-115]-A Disulfide Intermediate with a Partly Unfolded Structure",\N
5070,"5070","2002-03-29",\N,"Structure and dynamics of the anticodon-arm binding domain of Bacillus stearothermophilus tyrosyl-tRNA synthetase",\N
5071,"5071","2001-11-14",\N,"Complex of the C-Domain of Troponin C with Residues 1-40 of Troponin I",\N
5072,"5072","2001-07-17",\N,"CD3 Epsilon and gamma Ectodomain Fragment Complex in Single-Chain Construct",\N
5073,"5073","2003-01-07",\N,"Solution structure of the monomeric variant of the chemokine MIP-1beta",\N
5074,"5074","2003-01-07",\N,"LEM domain of human inner nuclear membrane protein emerin",\N
5075,"5075","2002-02-13",\N,"Solution Structure of Human Apolipoprotein(a) Kringle IV type 6",\N
5076,"5076","2003-01-07",\N,"Resonance Assignment of the unfolded states of Cold Shock Domain of the human YB-1 protein",\N
5077,"5077","2002-05-28",\N,"1H, 15N, 13C NMR Assignments of M156R Protein from myxoma virus, NESG target OP2",\N
5078,"5078","2002-08-22",\N,"Structure and Backbone Dynamics of a Lipoyl Domain from Human Mitochondrial Branched-Chain alpha-Ketoacid Dehydrogenase",\N
5079,"5079","2001-10-16",\N,"Backbone dynamics of the functional domain of Paracoccus denitrificans Cytochrome c552 in the Reduced state",\N
5080,"5080","2001-10-16",\N,"Backbone dynamics of the functional domain of Paracoccus denitrificans Cytochrome c552 in the Oxidized state",\N
5081,"5081","2001-11-07",\N,"1H, 15N and 13C resonance assignments for the Gallium protoporphyrin IX-HasAsm hemophore complex",\N
5082,"5082","2001-11-13",\N,"Solution Structure of a K(+)-Channel Blocker from the Scorpion Tityus cambridgei",\N
5083,"5083","2002-06-18",\N,"1H and 15N chemical shift assignments for human epidermal-type fatty acid-binding protein (E-FABP)",\N
5084,"5084","2003-12-08",\N,"1H and 15N Chemical Shift Assignments for the Complex of C-terminal Domain of Human Poly(A)-Binding Protein and 22-residue Fragment of Paip1",\N
5085,"5085","2003-12-08",\N,"1H, 13C, and 15N Chemical Shift Assignments for the Complex of the C-terminal Domain of Human Poly(A)-binding Protein and C-terminal Fragment of Paip2",\N
5086,"5086","2002-08-22",\N,"Reduced recombinant Hydrogenobacter thermophilus cytochrome c-552 expressed in E. coli periplasm",\N
5087,"5087","2002-08-22",\N,"Characterization of Hydrogenobacter thermophilus Cytochromes c(552) Expressed in the Cytoplasm and Periplasm of Escherichia coli",\N
5088,"5088","2002-08-22",\N,"Characterization of Hydrogenobacter thermophilus Cytochromes c(552) Expressed in the Cytoplasm and Periplasm of Escherichia coli",\N
5089,"5089","2002-08-22",\N,"Characterization of Hydrogenobacter thermophilus Cytochromes c(552) Expressed in the Cytoplasm and Periplasm of Escherichia coli",\N
5090,"5090","2002-08-22",\N,"Letter to the Editor: 1H(N), 15N, 13CO, 13C[agr], 13C[bgr] Assignment and Secondary Structure of a 20 kDa [agr]-L-fucosidase from Pea using TROSY",\N
5091,"5091","2003-06-02",\N,"Solution structure of A67V mutant of rat ferro cytochrome B5",\N
5092,"5092","2001-07-31",\N,"1H chemical shift assignments for the cytoplasmic N-terminus of KCNMB2",\N
5093,"5093","2002-03-04",\N,"Backbone and sidechain 1H, 13C, and 15N Chemical Shift Assignments for Ribosome-binding Factor A (RbfA)",\N
5094,"5094","2003-01-07",\N,"Chemosensory Protein from Moth Mamestra brassicae. Expression and Secondary Structure from 1H and 15N NMR",\N
5096,"5096","2003-06-02",\N,"Solution Structure of a CCHH mutant of the ninth CCHC Zinc Finger of U-shaped",\N
5097,"5097","2001-12-12",\N,"1H Chemical Shift Assignments for Bucandin",\N
5098,"5098","2003-05-14",\N,"A Plant 4-kDa Peptide with Insulin-like Function",\N
5099,"5099","2002-08-22",\N,"Backbone and side chain 1H, 13C, and 15N Chemical Shift Assignments for N-TIMP-1 in N-TIMP-1/MMP-3(E202Q) Complex",\N
5100,"5100","2002-04-05",\N,"1H, 15N and 13C Assignments of FLIN2, an Intramolecular LMO2:ldb1 Complex",\N
5101,"5101","2002-01-25",\N,"Structure and Properties of a Dimeric N-terminal Fragment of Human Ubiquitin",\N
5102,"5102","2002-02-04",\N,"A helical region in the C-terminus of small-conductance Ca2+-activated K+ channels controls assembly with apo-calmodulin",\N
5103,"5103","2001-08-15","2005-09-26","1H, 13C and 15N resonance assignments of the calcium binding protein S100P",\N
5104,"5104","2002-04-08",\N,"An NMR Approach to Structural Proteomics",\N
5105,"5105","2002-04-08",\N,"An NMR Approach to Structural Proteomics",\N
5106,"5106","2002-04-08","2009-07-16","An NMR Approach to Structural Proteomics","/ftp/pub/bmrb/timedomain/bmr5106"
5107,"5107","2001-08-28","2005-02-16","Assignments of the 1H, 13C, and 15N resonances of the substrate-binding SSD domain from Lon protease",\N
5108,"5108","2003-01-28",\N,"Solution structure of lactam analogue (DapE) of HIV gp41 600-612 loop",\N
5109,"5109","2003-01-28",\N,"Solution structure of a lactam analogue (DabD) of HIV gp41 600-612 loop",\N
5110,"5110","2003-01-28",\N,"Solution structure of beta3 analogue peptide (HCYS) of HIV gp41 600-612 loop",\N
5111,"5111","2003-01-28",\N,"Solution structure of HSER (ACE)IWGC(BSE)GKLICTTA analogue of HIV GP41 600-612 loop",\N
5112,"5112","2003-06-02",\N,"High-resolution Structures for the Psi-conotoxins Indicate Differences in Disulfide Bridge Dynamics",\N
5113,"5113","2003-06-02",\N,"High-resolution Structures for the Psi-conotoxins Indicate Differences in Disulfide Bridge Dynamics",\N
5114,"5114","2002-04-08",\N,"Refined Structure and Metal Binding site of the Kalata B1 Peptide",\N
5115,"5115","2002-01-23","2005-01-24","Solution structure of Pyrobaculum aerophilum DsrC, an archaeal homologue of the gamma subunit of dissimilatory sulfite reductase",\N
5116,"5116","2002-01-23",\N,"Solution Structure of Pyrobaculum Aerophilum DsrC/gamma subunit of dissimilatory sulfite reductase (reduced)",\N
5117,"5117","2003-04-09","2013-05-02","Structural and Dynamic Differences of Rhodostomin, an RGD-containing Disintegrin, and its D51E mutant",\N
5119,"5119","2002-08-22",\N,"NMR Investigations of Subunit c of the ATP Synthase from Propionigenium modestum in Chloroform/methanol/water (4:4:1)",\N
5120,"5120","2002-01-25",\N,"1H Chemical Shift Assigments for the mEGF/TGFalpha44-50 chimeric growth factor",\N
5121,"5121","2002-04-08",\N,"In vivo Protein Cyclization Promoted by a Circularly Permuted Synechocystis sp. PCC6803 DnaB Mini-intein",\N
5122,"5122","2002-04-08",\N,"In vivo Protein Cyclization Promoted by a Circularly Permuted Synechocystis sp. PCC6803 DnaB Mini-intein",\N
5123,"5123","2002-01-25",\N,"Characterization of the Structure and Dynamics of Amyloidogenic Variants of Human Lysozyme by NMR Spectroscopy",\N
5124,"5124","2002-01-25",\N,"Characterization of the Structure and Dynamics of Amyloidogenic Variants of Human Lysozyme by NMR Spectroscopy",\N
5125,"5125","2002-01-25",\N,"Characterization of the Structure and Dynamics of Amyloidogenic Variants of Human Lysozyme by NMR Spectroscopy",\N
5126,"5126","2002-04-08",\N,"Complete 1H, 15N and 13C Assignment of the Carboxyl Terminal Domain of the Ciliary Neurotrophic Factor Receptor (CNTFR)",\N
5127,"5127","2002-08-22",\N,"Letter to the Editor: Chemical shift assignment and chemical shift indexing of murine apo-Mts1",\N
5128,"5128","2002-04-08",\N,"GABARAP, GABAA receptor associated protein",\N
5129,"5129","2002-08-22",\N,"1H, 13C, and 15N Chemical Shift Assignments for MTH1880",\N
5130,"5130","2001-11-12",\N,"Assignment of 1H, 13C and 15N resonances of Human Lysozyme at 35 C",\N
5131,"5131","2002-03-11",\N,"Structure, Dynamics and Binding Characteristics of the Second PDZ Domain of PTP-BL",\N
5132,"5132","2003-06-10",\N,"1H and 15N assignments of ATTm+4, a truncated version of ATT, an trypsin/chymotrypsin inhibitor from Arabidopsis thaliana",\N
5133,"5133","2003-06-10",\N,"1H, 13C and 15N assignments of ATTm, a truncated version of ATT, an trypsin/chymotrypsin inhibitor from Arabidopsis thaliana",\N
5134,"5134","2002-08-23","2010-07-15","Solution Structure of dAAUAA DNA Bulge",\N
5135,"5135","2002-08-23","2010-07-15","Solution Structure of dAATAA DNA Bulge",\N
5136,"5136","2003-01-28",\N,"Solution structure of lactam analogue (EDap (Ace)IWGESGKLI(DAB)TTA) of HIV gp41 600-612 loop",\N
5137,"5137","2003-01-28",\N,"Solution structure of lactam analogue (DapD) of HIV gp41 600-612 loop",\N
5138,"5138","2003-01-28",\N,"Solution structure of lactam analogue (EDap (Ace)IWGESGKLI(DNP)TTA analogue of HIV GP41) of HIV gp41 600-612 loop",\N
5139,"5139","2003-01-28",\N,"Solution structure of lactam analogue (DDap) of HIV gp41 600-612 loop",\N
5140,"5140","2003-01-28",\N,"Solution structure of lactam analogue (DDab)of HIV gp41 600-612 loop",\N
5141,"5141","2002-11-04",\N,"Sequence-specific resonance assignments of the N-terminal, 105-residue KaiC-interacting domain of SasA, a protein necessary for a robust circadian rhythm in Synechococcus elongatus",\N
5142,"5142","2002-05-06",\N,"Assignment of 1H, 13C and 15N resonances of Human Lysozyme at 4 C",\N
5143,"5143","2002-04-09",\N,"NMR Structure of the Second Intracellular Loop of the alpha2A adrenergic receptor: evidence for a Novel Cytoplasmic Helix",\N
5144,"5144","2002-04-09",\N,"NMR Structure of the Second Intracellular Loop of the alpha2A adrenergic receptor: evidence for a Novel Cytoplasmic Helix",\N
5145,"5145","2003-02-25",\N,"NMR Structure of the human Doppel Protein",\N
5147,"5147","2001-09-19",\N,"NMR structure of the Cyanobacterial Metallothionein SmtA",\N
5148,"5148","2002-01-23",\N,"NMR Structure of the [2Fe-2S] Ferredoxin Domain from Soluble Methane Monooxygenase Reductase and Interaction with its Hydroxylase",\N
5149,"5149","2002-04-09",\N,"NMR Structure of the Second Intracellular Loop of the alpha2A adrenergic receptor: evidence for a Novel Cytoplasmic Helix",\N
5150,"5150","2002-04-09",\N,"NMR Structure of the Second Intracellular Loop of the alpha2A adrenergic receptor: evidence for a Novel Cytoplasmic Helix (T3-I2-T4)",\N
5151,"5151","2001-10-17",\N,"Designed Protein G Core Variants Fold to Native-like Structures: Sequence Selection by ORBIT Tolerates Variation in Backbone Specification",\N
5152,"5152","2001-10-17",\N,"Designed Protein G Core Variants Fold to Native-like Structures: Sequence Selection by ORBIT Tolerates Variation in Backbone Specification",\N
5153,"5153","2002-02-04",\N,"Backbone dynamics of the N-TIMP-1 bound to MMP-3 catalytic domain",\N
5154,"5154","2002-02-01",\N,"Backbone dynamics of free N-TIMP-1 in solution",\N
5155,"5155","2001-10-18",\N,"NMR structure of the UBX domain from P47 (energy minimised average)",\N
5156,"5156","2002-01-25",\N,"Partial assignment of the calcium-bound calretinin I-II domain (residues 1-100): 1H, 13C and 15N backbone assignments (and partial sidechain assignment) for structured elements",\N
5157,"5157","2002-05-06",\N,"Solution structure of a hydrophobic analogue of the winter flounder antifreeze protein",\N
5158,"5158","2002-01-25",\N,"Conformational and Dynamic Characterization of the Molten Globule state of an Apomyoglobin Mutant with an altered Folding Pathway",\N
5159,"5159","2002-09-30","2005-04-13","Sequence-specific resonance assignment of the second Ran-binding domain of human RanBP2",\N
5160,"5160","2001-10-17",\N,"Microcin from Escherichia coli",\N
5161,"5161","2001-10-17","2005-02-16","Characterization of the ATP-binding Domain of the Sarco(endo)plasmic Reticulum Ca (2+) -ATPase: Probing Nucleotide Binding By Multidimensional NMR",\N
5162,"5162","2002-12-27",\N,"1H, 13C, and 15N resonance assignments and secondary structure of the PWI domain from SRm160 using Reduced Dimensionality NMR",\N
5163,"5163","2002-02-14",\N,"Solution structure of desulfovibrio gigas zinc rubredoxin, NMR, 20 structures",\N
5164,"5164","2002-08-23","2010-07-16","NMR Structure of a Parallel Stranded DNA Duplex at Atomic Resolution",\N
5165,"5165","2002-05-06",\N,"Solution Structure of Methanobacterium Thermoautotrophicum Protein 1598",\N
5166,"5166","2002-05-06","2009-07-16","Solution structure of hemolysin expression modulating protein Hha","/ftp/pub/bmrb/timedomain/bmr5166"
5167,"5167","2002-09-26","2010-07-15","NMR Structure of an AT-Rich DNA with the GAA-Hairpin Loop",\N
5169,"5169","2002-05-06",\N,"NMR solution structure of the human beta2-microglobulin",\N
5170,"5170","2002-05-06",\N,"NMR Structure and Dynamics of the RNA Binding Site for the Histone mRNA Stem-Loop Binding Protein",\N
5171,"5171","2002-05-06",\N,"NMR Structure of BPTI Mutant G37A",\N
5172,"5172","2002-05-06",\N,"1H and 15N Chemical Shift Assignments of oxidized cytochrome c553 from B. pasteurii",\N
5173,"5173","2003-12-08",\N,"NMR structure of human Epiregulin",\N
5174,"5174","2002-09-12",\N,"Molecular structure of the GARP family of plant Myb-related DNA binding motifs of the Arabidopsis response regulators",\N
5175,"5175","2002-05-06",\N,"Backbone 1H, 13C, 15N and sidechain 1H Chemical shift of CPI-17",\N
5176,"5176","2001-11-12",\N,"SOLUTION STRUCTURE OF THE SQUASH TRYPSIN INHIBITOR MCoTI-II, NMR, 30 STRUCTURES.",\N
5177,"5177","2002-05-06",\N,"Backbone and side-chain 1H, 13C, and 15N chemical shift assignments for chick cofilin",\N
5178,"5178","2002-02-14","2011-06-16","Solution Structure of the Fibronectin type III Domain from Bacillus circulans WL-12 Chitinase A1",\N
5179,"5179","2002-08-23",\N,"Solution structure of N-terminal SH3 domain of Vav and the recognition site for Grb2 C-terminal SH3 domain",\N
5180,"5180","2001-11-12",\N,"Solution nmr structure of the dimerization domain of the yeast transcriptional activator Gal4 (residues 50-106)",\N
5181,"5181","2002-05-07",\N,"Virtually complete 1H, 13C and 15N resonance assignments of the second family 4 xylan binding module of Rhodothermus marinus xylanase 10A",\N
5182,"5182","2002-10-17",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for the Extracellular Ligand-Binding Domain of Ionotropic Glutamate Receptor 2",\N
5183,"5183","2002-08-23",\N,"BetaCore, a designed water soluble four-stranded antiparallel b-sheet protein",\N
5184,"5184","2002-05-08",\N,"1H Chemical Shift Assignments for toxin BeKm from the Scorpion Buthus eupeus",\N
5185,"5185","2002-05-07",\N,"1H, 13C, and 15N resonance assignment of the vascular endothelial growth factor receptor-binding domain in complex with a receptor-blocking peptide",\N
5186,"5186","2002-05-07",\N,"1H, 13C, and 15N backbone assignment of the vascular endothelial growth factor receptor-binding domain",\N
5187,"5187","2002-08-22",\N,"Assignments of the 1H, 13C, and 15N resonances of TraR",\N
5188,"5188","2003-02-20",\N,"Solution structure of paralytic peptide of the silkworm, Bombyx mori",\N
5189,"5189","2002-05-07",\N,"1H, 15N and 13C resonance assignments of rabbit apo-S100A11",\N
5190,"5190","2002-05-07",\N,"Backbone NMR assignments of Ribosome Recycling Factors from Escherichia coli",\N
5191,"5191","2002-05-07",\N,"Backbone NMR assignments of Ribosome Recycling Factors from Thermotoga maritima",\N
5192,"5192","2002-06-13",\N,"The NMR-derived Conformation of Neuropeptide F from Moniezia expansa",\N
5193,"5193","2003-01-06",\N,"The solution structure of the mutant 5'AUG3' triloop in the RNA promoter region of the brome mosaic virus genomic (+)-RNA",\N
5194,"5194","2002-02-14",\N,"Three-dimensional Structure of the Synaptotagmin 1 C2B-domain: Synaptotagmin 1 as a Phospholipid Binding Machine",\N
5196,"5196","2003-06-10",\N,"Modified Peptide A (D18-A1) of the Rabbit Skeletal Dihydropyridine Receptor",\N
5197,"5197","2001-11-12",\N,"1H and 13CA chemical shift assignments of the polypeptide mPrP(143-158)",\N
5198,"5198","2002-05-07",\N,"1H, 13C, and 15N Chemical Shift Assignments for v107 in complex with vascular endothelial growth factor",\N
5199,"5199","2003-06-09",\N,"Assignment of the 1H and 15N resonances of the elicitor protein NIP1",\N
5200,"5200","2003-06-10",\N,"Sequence-specific 1H, 13C and 15N chemical shift assignment of DnaA domain IV",\N
5201,"5201","2002-05-07",\N,"NMR ensemble of ion-selective ligand A1 for platelet integrin alphaIIb-beta3",\N
5202,"5202","2002-05-07","2006-06-26","Assignment of the 1H, 13C and 15N resonances of the catalytic domain of the rat 2',3'-cyclic nucleotide 3'-phosphodiesterase",\N
5203,"5203","2002-05-07",\N,"1H, 13C, 15N chemical shift assignments for cysteine-rich domain of KSR",\N
5204,"5204","2002-09-12",\N,"1H, 13C and 15N chemical shift assignments for CRT(189-261)",\N
5205,"5205","2002-09-12",\N,"1H chemical shift assignemnts and coupling constants for CRT(221-256)",\N
5206,"5206","2001-11-14","2007-06-19","Backbone and sidechain 1H, 13C, and 15N Chemical Shift Assignments for Human S100B in Calcium-bound Form",\N
5207,"5207","2002-02-14",\N,"1H Chemical Shifts for the Apo State of the F36G + P43M Mutant of Calbindin D9k",\N
5208,"5208","2002-05-07",\N,"1H, 13C and 15N resonance assignments for the perdeuterated 22 kD palm-thumb domain of DNA polymerase B",\N
5209,"5209","2002-05-09","2005-06-02","1H, 13C and 15N resonance assignments for the perdeuterated 22 kD palm-thumb domain of DNA polymerase B in complex with the XRCC1 N-terminal domain",\N
5210,"5210","2002-02-05",\N,"NMR Solution Structure of sTva47, the Viral-Binding Domain of Tva",\N
5211,"5211","2002-05-08",\N,"SAP/SH2D1A bound to peptide n-Y-c",\N
5212,"5212","2002-05-08",\N,"SAP/SH2D1A bound to peptide n-pY",\N
5213,"5213","2002-02-14",\N,"Copper Trafficking: The Solution Structure of Bacillus subtilis CopZ",\N
5214,"5214","2002-02-04",\N,"Y2 selective analogue-I of neuropeptide Y",\N
5215,"5215","2002-02-05","2005-02-17","Y2 selective analogue-II of neuropeptide Y",\N
5216,"5216","2002-02-05","2005-02-17","Y2 selective analogue-III of neuropeptide Y",\N
5217,"5217","2003-01-14",\N,"Solution Structure and DNA Binding Properties of the C-Terminal Domain of UvrC from E. coli",\N
5218,"5218","2002-08-22",\N,"Backbone 1H, 13C, 15N resonance assignments of the N-terminal 24 kDa fragment of the gyrase B subunit from E. coli",\N
5219,"5219","2002-08-22",\N,"Base excision repair: NMR backbone assignments of Escherichia coli formamidopyrimidine-DNA glycosylase",\N
5220,"5220","2002-08-23",\N,"Solution Structure and dynamics of melanoma inhibitory activity protein",\N
5221,"5221","2002-08-22",\N,"Backbone 1H, 13C, and 15N resonance assignments for the C-Terminal Region of Ku86 (Ku86CTR)",\N
5222,"5222","2002-08-22",\N,"1H, 15N and 13C resonance assignments and secondary structure of Tryparedoxin-I from Crithidia fasciculata",\N
5223,"5223","2002-06-13",\N,"SH3 domain of human Lck tyrosine kinase",\N
5224,"5224","2002-08-22",\N,"1H, 13C and 15N Chemical shifts assignments for the C-terminal domain (region 428-547) of human lamin A/C",\N
5225,"5225","2003-06-09",\N,"Solution Structure of the Peptidyl-Prolyl-cis/trans-Isomerase Parvulin 10 of Escherichia coli",\N
5226,"5226","2002-12-27",\N,"Letter to the Editor: 1H, 15N and 13C resonance assignments and secondary structure determination of the Ssh10b from Hyperthermphilic Archaeon Sulfolobus shibatae",\N
5227,"5227","2002-06-13",\N,"Dissection of the Pathway of Molecular Recognition by Calmodulin",\N
5228,"5228","2002-08-22",\N,"Letter to the Editor: Assignment of a 15 kDa protein complex formed between the p160 coactivator ACTR and the CREB binding protein",\N
5231,"5231","2003-06-09","2010-01-12","Resonance assignments for stromelysin complexed with a beta-sulfonyl hydroxamate inhibitor",\N
5232,"5232","2002-08-22","2010-07-14","1H, 13C, and 15N resonance assignments of the DNA-binding domain of the essential protein Cdc13 complexed with single-stranded telomeric DNA",\N
5233,"5233","2002-08-22",\N,"NMR assignment of human ASC2",\N
5234,"5234","2002-08-22",\N,"Backbone resonance assignment of the 2H,13C,15N labelled 32KDa Central Domain of Escherichia coli TyrR",\N
5235,"5235","2002-08-22",\N,"Resonance assignment and secondary structure determination of a C-terminal fragment of the Lupus Autoantigen (La) protein containing a putative RNA recognition motif (RRM)",\N
5236,"5236","2003-04-30",\N,"1H and 15N Chemical Shift Assignments for the tandem inactivation domain of Kv1.4 (RCK4(1-75))",\N
5237,"5237","2003-12-08",\N,"Assignment of 1H, 13C, and 15N resonances of Type II R67 Dihydrofolate Reductase",\N
5238,"5238","2002-02-08",\N,"1H and 15N chemical shift assignments for the heparin-binding domain of vascular endothelial growth factor",\N
5239,"5239","2002-08-07",\N,"Sequential NMR assignment of the ferri-cytochrome c3 from Desulfovibrio vulgaris Hildenborough",\N
5240,"5240","2004-09-10",\N,"15N assignment of Alicyclobacillus acidocaldarius thermostable thioredoxin",\N
5241,"5241","2004-09-10",\N,"1H and 15N assignment and secondary structure of the double K18G/R82E mutant of Alicyclobacillus acidocaldarius thermostable thioredoxin",\N
5242,"5242","2002-09-10",\N,"Solution Structure of the Prohormone Convertase 1 (PC1) Pro-Domain From Mus Musculus",\N
5243,"5243","2002-06-13","2010-07-14","Solution Structure of the 17mer TF1 Binding Site",\N
5244,"5244","2002-08-22",\N,"Backbone Assignment of Endonuclease V from Bacteriophage T4 with deuterium labeling",\N
5245,"5245","2002-02-08","2010-07-19","Heteroduplex of chirally pure R-methylphosphonate/DNA duplex",\N
5246,"5246","2002-06-13",\N,"Chiral Mutagenesis of Insulin's Hidden Receptor-Binding Surface: Structure of an Allo-isoleucine A2 Analogue",\N
5247,"5247","2002-08-22",\N,"Letter to the Editor: Sequence-specific chemical shift assignment of calcium-loaded murine S100A4",\N
5248,"5248","2002-02-05",\N,"NMR Solution Structure of the Isolated Apo Pin1 WW Domain: Comparison to the X-Ray Crystal Structures of Pin 1",\N
5249,"5249","2003-01-14",\N,"Backbone 1H, 13C and 15N chemical shifts for [Zn(II)/Zn(II)]Dx",\N
5250,"5250","2002-09-26",\N,"1H, 13C and 15N resonance assignment of the RNA-binding domain dimer form Bacillus subtilis transcriptional antiterminator GlcT",\N
5251,"5251","2002-06-13",\N,"Complete backbone and partial side chain 1H, 15N and 13C assignments for human lymphotactin at 45 C",\N
5252,"5252","2002-09-10","2010-07-19","Structural Differences in the NOE-derived Structure of G-T Mismatched DNA relative to Normal DNA are Correlated with Differences in (13)C Relaxation-based Internal Dynamics",\N
5253,"5253","2002-09-10","2010-07-19","Structural Differences in the NOE-derived Structure of G-T Mismatched DNA relative to Normal DNA are Correlated with Differences in (13)C Relaxation-based Internal Dynamics",\N
5254,"5254","2002-09-26",\N,"1H and 13C assigned chemical shifts for chromogranin A, catestatin fragment",\N
5255,"5255","2002-02-08",\N,"Ancestral beta/gamma-crystallin precursor structure in a yeast killer toxin",\N
5256,"5256","2002-09-10",\N,"Solution Structure of the Unmodified Anticodon Stem-loop from E. coli tRNA(Phe)",\N
5257,"5257","2002-02-08",\N,"Thymosin beta-9",\N
5259,"5259","2002-09-10","2005-11-14","Solution Structure of the modified Anticodon Stem-loop from E. coli tRNA(Phe)",\N
5260,"5260","2003-01-14",\N,"Pseudocontact chemical shifts for [Fe(II)/Fe(II)]Dx",\N
5261,"5261","2002-09-10",\N,"Nuclease A Inhibitor (NuiA) Assignments",\N
5262,"5262","2002-06-13",\N,"Backbone 1H and 15N Chemical Shift Assignements for the first fibronectin type II module of MMP-2 (col-1)",\N
5263,"5263","2002-08-22",\N,"Backbone 1H, 13C, 15N chemical Shift assignments fo the CBM28",\N
5264,"5264","2002-06-13",\N,"Solution Structure of Human beta-Defensin 3",\N
5265,"5265","2002-05-13",\N,"The solution structure of antibacterial peptide (Moricin) isolated from the silworm, Bombyx mori",\N
5266,"5266","2003-01-06",\N,"1H, 15N and 13C assignments of the focal adhesion targeting domain of focal adhesion kinase (FAT)",\N
5267,"5267","2002-08-23",\N,"1H, 13C, 15N NMR sequencespecific resonance assignment of a Clostridium thermocellum type II cohesin module",\N
5268,"5268","2002-09-11",\N,"Structure of the Antimicrobial Peptide Tachystatin A",\N
5269,"5269","2002-08-23",\N,"Assignment of the 1H, 13C, and 15N signals of Synechocystis sp. PCC 6803 methemoglobin",\N
5270,"5270","2003-01-06",\N,"Backbone 1H, 15N and 13C resonance assignments of YqgF, an Escherichia coli protein of unknown structure and function",\N
5271,"5271","2003-01-14",\N,"Pseudocontact chemical shifts for [Fe(II)/Zn(II)]Dx",\N
5272,"5272","2002-03-29","2005-11-21","1H, 13C and 15N chemical shift assignments of Schistocerca gregaria chymotrypsin inhibitor",\N
5273,"5273","2002-03-29",\N,"1H chemical shift assignments for SGCI[L30R, K31M]",\N
5274,"5274","2002-03-29",\N,"1H Chemical shift assignments of Schistocerca gregaria trypsin inhibitor",\N
5275,"5275","2002-03-22",\N,"The rhesus rotavirus sialic acid binding domain without ligand",\N
5276,"5276","2002-09-11",\N,"NMR Structure of the Domain-I of the Kazal-type Thrombin Inhibitor Dipetalin",\N
5277,"5277","2002-09-11",\N,"Solution NMR Structure of Surfactant Protein B (11-25) (SP-B11-25)",\N
5278,"5278","2003-02-20",\N,"PEMV-1 P1-P2 Frameshifting Pseudoknot Regularized Average Structure",\N
5279,"5279","2002-04-01",\N,"A Quick Solution Structure Determination of the Fully Oxidized Double Mutant K9-10A Cytochrome c7 from Desulfuromonas acetoxidans and Mechanistic Implications",\N
5280,"5280","2002-08-23",\N,"Assignments of the 1H, 13C, and 15N, resonances of the winged helix domain of the proto-oncoprotein c-Qin (FoxG1B)",\N
5281,"5281","2003-04-30",\N,"A peptide mimetic of human interferon (IFN)-beta",\N
5282,"5282","2003-02-20","2010-07-19","Refinement of d(GCGAAGC) Hairpin Structure Using One- and Two-Bonds Residual Dipolar Couplings",\N
5283,"5283","2002-12-27",\N,"Proton Chemical Shift Assignments for Vpr(34-51) Peptide",\N
5284,"5284","2003-06-25",\N,"1H and 15N Chemical Shift Assignments for Human A54 I-FABP",\N
5285,"5285","2003-06-25",\N,"1H and 15N Chemical Shift Assignments for Human T54 I-FABP",\N
5286,"5286","2002-06-13",\N,"Backbone 1H, 13C, and 15N Chemical shift assigments for [13C,15N]CaM:CaMKIp complex",\N
5287,"5287","2002-06-13",\N,"Backbone 1H and 15N Chemical shift assigments for [2H,15N]CaM:CaMKI(320) complex",\N
5288,"5288","2002-08-23",\N,"Assignment of Backbone 1H, 13C, and 15N Resonances of Human Grb7-SH2 Domain in Complex with a Phosphorylated Peptide Ligand",\N
5289,"5289","2002-03-29",\N,"Investigation of Penetratin Peptides. Part 1: The Environment Dependent Conformational Properties of Penetratin and two of its Derivatives",\N
5290,"5290","2002-03-29",\N,"Investigation of Penetratin Peptides. Part 1: The Environment Dependent Conformational Properties of Penetratin and two of its Derivatives",\N
5291,"5291","2002-03-29",\N,"Investigation of Penetratin Peptides. Part 1: The Environment Dependent Conformational Properties of Penetratin and two of its Derivatives",\N
5292,"5292","2002-06-13",\N,"1H Chemical Shift Assignments for TC5b",\N
5293,"5293","2002-10-31",\N,"NMR Identification and Characterization of the Flexible Regions in the 160 KD Molten Globule-like Aggregate of Barstar at Low pH",\N
5294,"5294","2002-09-11",\N,"Structure of the beta subunit of translation initiation factor 2 from the archaeon Methanococcus jannaschii: A representative of the eIF2beta/eIF5 family of proteins",\N
5295,"5295","2005-09-22",\N,"1H Resonance Assignments at 310K and pH 4.93 for E.coli recombinant Brazzein, an Intensely Sweet Protein",\N
5296,"5296","2005-09-22",\N,"1H Resonance Assignments at 310K and pH 4.90 for E.coli recombinant Brazzein variant brazzein-ins(R18a-I18b), an Non-Sweet variant of Brazzein",\N
5297,"5297","2002-09-11",\N,"1H, 13C, and 15N assignment of the N-terminal, DNA-binding domain of the replication initiation protein from a geminivirus",\N
5298,"5298","2003-06-25",\N,"1H, 13C, and 15N Chemical Shift Assignments for the PPIase domain from E. coli trigger factor",\N
5299,"5299","2002-03-22",\N,"The Mad2 Spindle Checkpoint Protein Undergoes Similar Major Conformational Changes upon Binding to Either Mad1 or Cdc20",\N
5300,"5300","2002-06-27",\N,"Backbone 1H, 13C, and 15N Resonance Assignments for the 20.8 KDa C.elegans gene product ORF C32E8.3. Northeast Structural Genomics Consortium Target WR33.",\N
5301,"5301","2002-09-11",\N,"Principles of Mucin Architecture: Structural Studies on Synthetic Glycopeptides Bearing Clustered Mono-,Di, Tri-, and Hexasacchraride Glycodomains",\N
5302,"5302","2003-06-10",\N,"High-Resolution Structure and Localization of Amylin Nucleation Site in Detergent Micelles",\N
5303,"5303","2003-08-27",\N,"Solution structure and backbone dynamics of beryllofluoride-activated NTRC receiver domain",\N
5304,"5304","2002-06-13",\N,"Solution Structure of a Mono-heme Ferrocytochrome c from Shewanella putrefaciens and Structural Analysis of Sequence-similar Proteins: Functional Implications",\N
5305,"5305","2002-08-22",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for the peptidyl-prolyl cis-trans isomerase Pin1",\N
5306,"5306","2002-05-15",\N,"1H, 13C, and 15N Chemical Shift Assignments for the HIF-1alpha CTAD/p300 CH1 Complex",\N
5307,"5307","2002-03-22","2009-07-16","Basic Pancreatic Trypsin Inhibitor","/ftp/pub/bmrb/timedomain/bmr5307"
5308,"5308","2002-09-11",\N,"Solution Structure and Dynamics of the Human-Escherichia coli Thioredoxin Chimera: Insights into Thermodynamic Stability",\N
5309,"5309","2002-08-22",\N,"1H, 15N and 13C assignments of FLIN4, an intramolecular LMO4:ldb1 complex",\N
5310,"5310","2002-03-29",\N,"Backbone and Sidechain 1H, 13C and 15N resonance assignments for PLC-gamma 1 C-terminal SH2 domain complexed with a PDGFR-derived phosphopeptide",\N
5311,"5311","2002-08-23",\N,"Letter to the Editor: 1H, 15N and 13C assignments of the Pseudomonas effector protein, AvrPto",\N
5312,"5312","2003-02-20",\N,"1H, 13C and 15N chemical shift assignments of aIF2beta from Methanobacterium themoautotrophicum",\N
5313,"5313","2002-08-23",\N,"Sequence-specific resonance assignment of the rat Gap Junction 43 kDa carboxyl terminal domain",\N
5314,"5314","2002-12-23",\N,"Assignment of 1H, 13C, and 15N Resonances of the SH2 Domain of Human Grb14 and Chemical Shift Changes upon Binding a phosphorylated decapeptide",\N
5315,"5315","2003-02-20",\N,"1H, 13C and 15N chemical shift assignment for ribosome-associated factor Y",\N
5316,"5316","2002-07-03",\N,"Structure of the N-terminal 283-Residue Fragment of the HIV-1 Gag Polyprotein",\N
5317,"5317","2002-04-08",\N,"Solution structure of the DNA binding domain of human TRF1",\N
5318,"5318","2002-05-01",\N,"Backbone and Sidechain 1H, 13C and 15N resonance assignments for PLC-gamma 1 C-terminal SH2 domain",\N
5319,"5319","2002-06-13",\N,"1H and 15N assignments of rat holo cellular retinol-binding protein type I (CRBP-I)",\N
5320,"5320","2002-11-04",\N,"1H and 15N Chemical Shift Assignments for Human B-FABP",\N
5321,"5321","2002-05-20","2005-02-17","NMR structure of a SRP19 binding domain in human SRP RNA",\N
5322,"5322","2004-10-14",\N,"Solution Structure of g-Bungarotoxin, an RGD-Containing Neurotoxin",\N
5323,"5323","2002-05-10",\N,"Solution Structure of the Tenebrio molitor Antifreeze Protein",\N
5324,"5324","2002-08-23",\N,"Letters to the Editor: 1H, 15N and 13C assignments of the regulatory domains of a calcium-dependent protein kinase (CDPK)",\N
5325,"5325","2003-06-09",\N,"1H Chemical Shift Assignments for nsLTP2 from Rice",\N
5326,"5326","2002-06-13",\N,"Structure of ALA24/ASP61 to ASP24/ASN61 substituted subunit C of Escherichia coli ATP synthase. Implications for the mechanism of proton transport and rotary movement in the F0 complex",\N
5327,"5327","2002-06-13",\N,"Structural basis for Hif-1alpha/CBP recognition in the cellular hypoxic response",\N
5328,"5328","2006-04-06",\N,"Solution NMR structure of the BRCT domain from Thermus thermophilus DNA ligase",\N
5329,"5329","2003-01-06","2009-07-16","Backbone and Side Chain 1H, 13C, and 15N chemical shift assignments for conserved eukaryotic protein ZK652.3 from C. elegans","/ftp/pub/bmrb/timedomain/bmr5329"
5330,"5330","2002-06-13",\N,"Backbone relaxation data of rat apo cellular retinol-binding protein type I (CRBP-I)",\N
5331,"5331","2002-06-13",\N,"Backbone relaxation data of rat holo cellular retinol-binding protein type I (CRBP-I)",\N
5332,"5332","2002-06-13",\N,"1H, 13C, and 15N Chemical Shift Assignments for E85Q recoverin",\N
5333,"5333","2002-06-13",\N,"Redox-Coupled Conformational Alternations in Cytochrome c3 from D. vulgaris Miyazaki F on the Basis of its Reduced Solution Structure",\N
5334,"5334","2003-06-10",\N,"Backbone 1H, 13C, and 15N resonance assignments and secondary structure of the D54A mutant of HTLV-I capsid protein",\N
5335,"5335","2002-09-09",\N,"Backbone and side chain 1H, 13C, and 15N chemical shift assignments for E.coli protein YacG","/ftp/pub/bmrb/timedomain/bmr5335"
5337,"5337","2002-05-08",\N,"Complete assignments of 1H, 13C and 15N Chemical Shifts for Oxidized Human Adrenodoxin (4-114)",\N
5338,"5338","2002-04-08",\N,"Integrin EGF-like module 3 from the beta-2 subunit",\N
5339,"5339","2002-04-09",\N,"NMR minimized average structure of d(CGTACG)2",\N
5340,"5340","2002-06-07",\N,"Solution Structure for BID, and Intracellular Amplifier of Apoptotic Signaling",\N
5341,"5341","2002-11-04",\N,"1H, 13C, and 15N backbone assignment of an extended N-terminal, DNA-binding domain construct of the replication initiation protein from a geminivirus",\N
5342,"5342","2003-04-10",\N,"1H Chemical Shift Assignments for Superman Zinc Finger Domain",\N
5343,"5343","2002-09-05","2006-06-12","1H, 13C, 15N Assignment of Neocarzinostatin Apo-Protein",\N
5344,"5344","2002-09-05","2006-04-20","1H, 15N Assignment of Neocarzinostatin Apo-Protein Bound to a Synthetic Chromophore",\N
5345,"5345","2002-06-07","2010-07-14","Assignment of lac repressor headpiece complexed of its natural operator",\N
5346,"5346","2004-02-12",\N,"Solution Structure of a Novel Disintegrin, Salmosin from Agkistrondon halys Venom",\N
5347,"5347","2003-02-25",\N,"Solution Structure of the RNase H Domain of the HIV-1 Reverse Transcriptase in Presence of Magnesium",\N
5348,"5348","2002-08-22",\N,"Solution structure of ascidian trypsin inhibitor determined by nuclear magnetic resonance spectroscopy",\N
5349,"5349","2003-01-06","2010-07-14","PBX Homeodomain-DNA complex",\N
5350,"5350","2003-01-06",\N,"1H, 15N, and 13C resonance assignments of low molecular weight human cytoplasmic protein tyrosine phosphatase-A (HCPTP-A)",\N
5351,"5351","2003-01-29",\N,"Backbone HN, N, Ca, Cb and CO assignments of unfolded ACBP",\N
5352,"5352","2002-09-25",\N,"1H, 13C and 15N resonance assignment of Bacillus agaradhaerens xylanase",\N
5353,"5353","2002-09-25",\N,"1H, 15N and 13C resonance assignments of yeast Saccharomyces cerevisiae calmodulin in the Ca2+-free state",\N
5354,"5354","2003-01-27",\N,"Structure and Interactions of PAS kinase N-terminal PAS domain: Model for intramolecular kinase regulation",\N
5355,"5355","2002-09-25",\N,"Backbone resonance assignments of the 25kD N-terminal ATPase domain from the Hsp90 chaperone",\N
5356,"5356","2003-01-06",\N,"Backbone and sidechain chemical shift assignments for GS-a3W protein",\N
5357,"5357","2006-04-06",\N,"1H, 13C, and 15N Chemical Shift Assignments for tm1112",\N
5358,"5358","2002-05-08",\N,"1H, 15N, 13C Backbone Chemical Shift Assignments for Trypsin-Bound Bovine Pancreatic Trypsin Inhibitor (BPTI) at pH 5.8 and 36 Degrees",\N
5359,"5359","2002-05-08",\N,"1H, 15N, 13C Backbone Chemical Shift Assignments for Free Bovine Pancreatic Trypsin Inhibitor (BPTI) at pH 5.8 and 36 Degrees",\N
5360,"5360","2003-02-25",\N,"PsaE sub-unit of the photosystem I of the cyanobacterium Synechocystis sp. PCC 6803",\N
5361,"5361","2002-06-26","2010-07-14","Solution Structure of the DNA Complex of Human TRF1",\N
5362,"5362","2002-09-25",\N,"1H, 15N and 13C Backbone resonance assignments of the 40 kDa LicT-CAT-PRD1 protein",\N
5363,"5363","2003-04-10","2010-07-14","1H, 13C, and 15N Chemical shifts for hERR2 Protein, 1H chemical shifts for DNA",\N
5364,"5364","2002-05-30",\N,"Structure of the C-terminal FG-binding domain of human Tap",\N
5365,"5365","2002-11-04",\N,"1H, 15N, 13C resonance assignments for the DNA-binding domain of myocyte nuclear factor",\N
5366,"5366","2003-02-25",\N,"SOLUTION STRUCTURE OF THE VAM7P PX DOMAIN",\N
5368,"5368","2002-08-23","2005-11-14","Backbone 1H, 13C, and 15N Chemical Shift Assignments for hARF1",\N
5369,"5369","2002-05-30",\N,"A New Zinc Binding Fold Underlines the Versatility of Zinc Binding Modules in Protein Evolution",\N
5370,"5370","2002-05-30",\N,"Structure of a Beta-Alanine-Linked Polyamide Bound to a Full Helical Turn of Purine Tract DNA in the 1:1 Motif",\N
5371,"5371","2002-08-22","2009-06-02","U6 RNA chemical shifts",\N
5372,"5372","2003-06-09",\N,"Solution Structure Of Reduced Horse Heart Cytochrome c in 30% Acetonitrile Solution",\N
5373,"5373","2002-09-25",\N,"Sequence-specific NMR resonance assignments for Human Interleukin-5",\N
5374,"5374","2003-01-06",\N,"Assignment of 1H and 15N resonances and secondary structure of the recombinant RicC3 of 2S albumin storage protein from ricinus communis",\N
5375,"5375","2003-01-06",\N,"Structure of BPTI_8A mutant",\N
5376,"5376","2003-01-06",\N,"C-terminal peptide of alpha-subunit of transducin",\N
5377,"5377","2002-08-23",\N,"Assignments of 1H, 13C and 15N resonances of human Ca2+-S100B in complex with the TRTK-12 peptide",\N
5378,"5378","2003-02-20",\N,"NMR Structure of a Variant Human Prion Protein with Two Disulfide Bridges",\N
5379,"5379","2003-02-20",\N,"Bovine Pancreatic Polypeptide Bound to DPC Micelles",\N
5381,"5381","2003-01-06",\N,"Structure of BPTI_A16V mutant",\N
5382,"5382","2002-12-23",\N,"1H, 13C, and 15N backbone resonance assignment of the C-terminal domain of EPSP synthase",\N
5383,"5383","2003-01-06",\N,"The CXCR3 binding chemokine IP-10/CXCL10: Structure and receptor interactions",\N
5384,"5384","2003-02-25",\N,"Binding of the first ferric ion to glycine-extended gastrin is essential for biological activity",\N
5385,"5385","2003-02-20","2010-07-19","Chemical shift assignments for the 8OG:G mismatched duplex",\N
5386,"5386","2003-02-25",\N,"1H, 13C, 15N Chemical Shift Assignments of cNTnC and cTnI(147-163) in the cNTnC-cTnI(147-163)-Bepridil Ternary complex",\N
5387,"5387","2003-06-12","2009-10-12","Complete 1H, 13C, and 15N chemical shifts for human recombinant ubiquitin in reverse micelles",\N
5388,"5388","2002-11-05",\N,"1H,13C and 15N resonance assignments of gads c-terminal SH3 domain in complex with a peptide of SLP76",\N
5389,"5389","2002-09-25",\N,"1H, 13C and 15N assignments for the cold shock response protein Yfia",\N
5390,"5390","2003-02-25",\N,"1H,13C and 15N Chemical Shifts Assignments for the Oligomerization Domain of H-NS",\N
5391,"5391","2003-07-30",\N,"The NMR Solution Structure of the RIP Death Domain and Characterization of the Interaction with TRADD",\N
5392,"5392","2003-12-08",\N,"Solution structure of HMG box 5 in human upstream binding factor",\N
5393,"5393","2002-09-25",\N,"Sequence-specific (1H, 15N, 13C) resonance assignment of the N-terminal domain of the Cyclase-associated Protein (CAP) from Dictyostelium discoideum",\N
5394,"5394","2003-02-20","2005-11-14","Sculpting of the Eukaryotic Branch Site Recognition Motif by a Conserved Pseudouridine",\N
5395,"5395","2003-02-20",\N,"Chemical Shift Assignments for the Unmodified Branch Site Helix",\N
5396,"5396","2002-11-04",\N,"NMR-based solution structure of the complex of Lactobacillus casei dihydrofolate reductase with trimethoprim and NADPH",\N
5397,"5397","2002-12-23",\N,"1H, 13C and 15N resonance assignment of an affibody-target complex",\N
5398,"5398","2003-02-20",\N,"Backbone and side chain 1H, 13C, and 15N chemical shift assignments for 3-methyladenine DNA glycosylase I (TAG) from Escherichia coli",\N
5399,"5399","2002-11-04",\N,"Conservation of chemical shift and secondary structure of the PNT/SAM domains from the Ets family of transcription factors",\N
5400,"5400","2003-12-08",\N,"Selection of D-amino-acid peptides that bind to Alzheimer's disease amyloid peptide abeta 1-42 by mirror image phage display",\N
5401,"5401","2003-02-20",\N,"Conservation of chemical shift and secondary structure of the PNT/SAM domains from the Ets family of transcription factors",\N
5402,"5402","2002-11-05","2006-04-19","1H, 15N and 13C resonance assignments of the SH2 domain of Bruton's tyrosine kinase",\N
5403,"5403","2003-04-10",\N,"Backbone resonance assignments of the 91 kDa oligomeric TRAP protein from Bacillus staerothermophilus in complex with L-tryptophan",\N
5404,"5404","2005-05-20",\N,"Backbone and Side Chain assignments of Peptide Deformylase complexed with Actinonin",\N
5405,"5405","2002-06-27",\N,"STRUCTURE OF SYNTHETIC 26-MER PEPTIDE CONTAINING 145-169 SHEEP PRION PROTEIN SEGMENT AND C-TERMINAL CYSTEINE IN TFE SOLUTION",\N
5406,"5406","2003-07-30",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for Human Cytochrome c",\N
5407,"5407","2003-02-20",\N,"Solution structure and characterization of the heme chaperone CcmE",\N
5408,"5408","2003-02-25",\N,"1H, 13C, and 15N Chemical Shift Assignments for DFF-C domain of DFF45/ICAD",\N
5409,"5409","2002-08-22",\N,"Backbone Chemical Shift Assignments for 2H, 13C, 15N-labeled Human PTB1 Protein",\N
5410,"5410","2003-02-18",\N,"Solution structure of novel non-RGD containing short disintegrin by high resolution NMR",\N
5411,"5411","2003-03-20",\N,"pKa determinations for OMTKY3",\N
5412,"5412","2003-03-20",\N,"pKa determinations for P2'-Lys OMTKY3",\N
5413,"5413","2003-03-20",\N,"pKa determinations for P2'-His OMTKY3",\N
5414,"5414","2003-03-20",\N,"pKa determinations for P2'-Glu OMTKY3",\N
5415,"5415","2003-03-20",\N,"pKa determinations for P2'-Asp OMTKY3",\N
5416,"5416","2003-03-20",\N,"pKa determinations for P3'-Ala OMTKY3",\N
5417,"5417","2003-03-20",\N,"pKa determinations for P3'-Asp OMTKY3",\N
5418,"5418","2003-03-20",\N,"pKa determinations for P3'-Glu OMTKY3",\N
5419,"5419","2003-03-20",\N,"pKa determinations for P3'-His OMTKY3",\N
5420,"5420","2003-03-20",\N,"pKa determinations for P3'-Lys OMTKY3",\N
5421,"5421","2003-03-20",\N,"pKa determinations for P1'-Asp OMTKY3",\N
5422,"5422","2003-03-20",\N,"pKa determinations for P1'-His OMTKY3",\N
5423,"5423","2003-03-20",\N,"pKa determinations for P1'-Lys OMTKY3",\N
5424,"5424","2003-03-20",\N,"pKa determinations for P1-Asp OMTKY3",\N
5425,"5425","2003-03-20",\N,"pKa determinations for P1-Glu OMTKY3",\N
5426,"5426","2003-03-20",\N,"pKa determinations for P1-Gly OMTKY3",\N
5427,"5427","2003-03-20",\N,"pKa determinations for P1-Ala OMTKY3",\N
5428,"5428","2003-03-20",\N,"pKa determinations for P1-His OMTKY3",\N
5429,"5429","2003-03-20",\N,"pKa determinations for P1-Lys OMTKY3",\N
5430,"5430","2003-03-20",\N,"pKa determinations for P2-Asp OMTKY3",\N
5431,"5431","2003-03-20",\N,"pKa determinations for P2-Glu OMTKY3",\N
5432,"5432","2003-03-20",\N,"pKa determinations for P2-Val OMTKY3",\N
5433,"5433","2003-03-20",\N,"pKa determinations for P2-His OMTKY3",\N
5434,"5434","2003-03-20",\N,"pKa determinations for P2-Lys OMTKY3",\N
5435,"5435","2003-03-20",\N,"pKa determinations for P4-Asp OMTKY3",\N
5436,"5436","2003-03-20",\N,"pKa determinations for P4-Glu OMTKY3",\N
5437,"5437","2003-03-20",\N,"pKa determinations for P4-His OMTKY3",\N
5438,"5438","2003-03-20",\N,"pKa determinations for P4-Lys OMTKY3",\N
5439,"5439","2003-03-20",\N,"pKa determinations for P4-Asp OMTKY3 (not salt added)",\N
5440,"5440","2003-03-20",\N,"pKa determinations for P5-Asp OMTKY3",\N
5441,"5441","2003-03-20",\N,"pKa determinations for P5-Glu OMTKY3",\N
5442,"5442","2003-03-20",\N,"pKa determinations for P5-His OMTKY3",\N
5443,"5443","2003-03-20",\N,"pKa determinations for P6-Asp OMTKY3",\N
5444,"5444","2003-03-20",\N,"pKa determinations for P6-Glu OMTKY3",\N
5445,"5445","2003-03-20",\N,"pKa determinations for P6-His OMTKY3",\N
5446,"5446","2003-03-20",\N,"pKa determinations for P2-Val,P3'-Ala OMTKY3",\N
5447,"5447","2003-03-20",\N,"pKa determinations for P8-Phe,P6-Asp OMTKY3",\N
5448,"5448","2003-03-20",\N,"pKa determinations for OMTKY3 (no salt added)",\N
5449,"5449","2003-03-20",\N,"pKa determinations for P5-His OMTKY3 (no salt added)",\N
5450,"5450","2003-03-20",\N,"pKa determinations for P4-Glu OMTKY3 (no salt added)",\N
5451,"5451","2003-03-20",\N,"pKa determinations for AAPD",\N
5452,"5452","2003-03-20",\N,"pKa determinations for AAPE",\N
5453,"5453","2003-03-20",\N,"pKa determinations for AAPK",\N
5454,"5454","2002-11-06",\N,"NMR solution structure and dynamics of motilin in isotropic phospholipid bicellar solution",\N
5455,"5455","2003-06-09","2008-09-17","1H, 13C and 15N resonance assignments of the human phosphatase PRL-3",\N
5456,"5456","2002-12-23",\N,"1H, 13C, and 15N resonances assignment for the von Willebrand factor A3 domain",\N
5457,"5457","2002-11-05",\N,"Complete 1H Chemical Shift Assignment of a 24-residue Sin Interacting Domain of hMad1",\N
5458,"5458","2002-12-27",\N,"Backbone 1H, 13C, and 15N assignments of the ribosome recycling factor from Thermus thermophillus",\N
5459,"5459","2003-06-12",\N,"High precision NMR structure of RING-H2 finger domain of EL5, a rice gene in response to N-acetylchitooligosaccahride elicitor",\N
5461,"5461","2003-02-20",\N,"Chemical shift assignments Itk SH2 domain, conformation corresponding to cis and trans proline 287",\N
5462,"5462","2002-11-05",\N,"1H, 15N and 13C Backbone Assignment of MJ1267, an ATP-binding cassette",\N
5463,"5463","2004-09-14",\N,"Human catestatin 21-mer",\N
5464,"5464","2004-09-14",\N,"Solution Structure of a CCHC Zinc Finger from MOZ",\N
5465,"5465","2004-03-15",\N,"NMR solution structure of human Saposin C",\N
5466,"5466","2003-04-23",\N,"Structural model for an alkaline form of ferricytochrome c",\N
5467,"5467","2004-10-13",\N,"1H,15N and 13C resonance assignments of the SH3-like domain of the human ADAP protein",\N
5468,"5468","2002-08-22",\N,"Backbone 1H, 13C, 15N and Cb chemical shift assignments for 6-phosphogluconolactonase from Trypanosoma brucei",\N
5469,"5469","2003-03-06",\N,"Inhibitory Specificity Change of Ovomucoid Third Domain of Silver Pheasant upon Introduction of an Engineered Cys14-Cys39 Bond",\N
5470,"5470","2003-03-06",\N,"Inhibitory Specificity Change of Ovomucoid Third Domain of Silver Pheasant upon Introduction of an Engineered Cys14-Cys39 Bond",\N
5471,"5471","2002-09-05",\N,"Backbone HN,13C,15N assignments for Malate Synthase G from E.coli",\N
5472,"5472","2003-07-30",\N,"Solution Structures of the Two Stable Conformers of Turkey Ovomucoid that Coexist at Low pH",\N
5473,"5473","2003-07-30",\N,"Solution Structures of the Two Stable Conformers of Turkey Ovomucoid that Coexist at Low pH",\N
5474,"5474","2002-11-05",\N,"Backbone resonance assignment of the 298 amino acid catalytic domain of protein tyrosine phosphatase 1B (PTP1B)",\N
5475,"5475","2002-08-22",\N,"Homology predicted structure and comparison with the secondary structure from NMR data for plastocyanin from the cyanobacterium synechocystis sp. PCC 6803",\N
5476,"5476","2003-08-12",\N,"Structures of phage-display peptides that bind to the malarial surface protein, apical membrane antigen 1, and block erythrocyte invasion",\N
5477,"5477","2003-08-11",\N,"Structures of phage-display peptides that bind to the malarial surface protein, apical membrane antigen 1, and block erythrocyte invasion",\N
5478,"5478","2003-08-11",\N,"Structures of phage-display peptides that bind to the malarial surface protein, apical membrane antigen 1, and block erythrocyte invasion",\N
5479,"5479","2003-08-11",\N,"Structures of phage-display peptides that bind to the malarial surface protein, apical membrane antigen 1, and block erythrocyte invasion",\N
5480,"5480","2003-12-08",\N,"1H,15N and 13C assigned Chemical Shifts for a complex of calmodulin with a peptide of the olfactory CNGC channel",\N
5481,"5481","2003-07-30",\N,"Backbone and side chain 1H, 13C, and 15N chemical shift assignments for S. cerevisae Hub1",\N
5482,"5482","2003-01-14",\N,"Assignment of 1H, 13C and 15N resonances of the N-terminal microtubule-binding domain of human doublecortin",\N
5483,"5483","2003-04-23",\N,"NMR structure of AmpD, an N-acetylmuramyl-L-alanine amidase.",\N
5484,"5484","2002-12-23",\N,"Backbone NMR assignments of the metal-free UreE from Bacillus pasteurii",\N
5485,"5485","2003-07-30",\N,"Thermal stability and solution structure of the ribosomal protein L30e from hyperthermophile archaeon Thermococcus celer",\N
5486,"5486","2002-11-04",\N,"Backbone and 1H assignments for Tachyplesin I, wild type",\N
5487,"5487","2002-11-04",\N,"Backbone and 1H assignments for Tachyplesin I, tyrosine mutant",\N
5488,"5488","2002-11-04",\N,"Backbone and 1H assignments for Tachyplesin I, phenylalanine mutant",\N
5489,"5489","2002-11-04",\N,"Backbone and 1H assignments for Tachyplesin I, alanine mutant",\N
5490,"5490","2003-10-06",\N,"Sequence-specific 1H, 13C, 15N Resonance Assigments of the Major Cherry Allergen Pru av 1 Mutant E45W",\N
5491,"5491","2003-06-24",\N,"Structural basis for new pattern of the conserved amino acid residues related to chitin-binding in the antifungal peptide from the coconut rhinoceros beetle, Oryctes rhinoceros",\N
5492,"5492","2003-02-20",\N,"1H and 15N Chemical Shift Assignments for the charge reverse variant of Ribonuclease Sa \"5K\" (D1K, D17K, D25K, E41K, E74K)",\N
5493,"5493","2002-12-23",\N,"Letter to the Editor: Backbone 1H, 15N and 13C resonance assignments of the Staphylococcus aureus acyl carrier protein synthase (AcpS)",\N
5494,"5494","2002-08-22",\N,"NMR Structure of PW2 Bound to SDS Micelles: A Tryptophan-rich Anticocidial Peptide Selected from Phage Display Libraries",\N
5495,"5495","2003-07-30",\N,"1H chemical shift assignments for Psalmotoxin 1",\N
5496,"5496","2003-01-14",\N,"NMR structure of ubiquitin-like domain in Parkin: Gene product of familial Parkinson's disease",\N
5497,"5497","2002-12-23",\N,"1H, 15N, 13C resonance assignments of the carboxy-terminal domain of the transmembrane electron transfer protein DsbD",\N
5498,"5498","2002-08-22",\N,"Backbone and Sidechain 1H, 13C, and 15N Chemical Shift Assigments for Complex between p67SH3(C) and p47 Tail Peptide",\N
5499,"5499","2003-02-20",\N,"The PDZ7 of Glutamate Receptor Interacting Protein Binds to its Target via a Novel Hydrophobic Surface Area",\N
5500,"5500","2003-03-10",\N,"Parkin binds the Rpn10 subunit of 26S proteasomes with the ubiquitin-like domain",\N
5501,"5501","2003-02-20",\N,"The Solution Structure of Human Hepcidin, a Peptide-Hormone with Antimicrobial Activity that is Involved in Iron Uptake and Hereditary Hemochromatosis",\N
5502,"5502","2003-02-20",\N,"Solution Structure of Hepcidin-20",\N
5503,"5503","2003-03-14",\N,"1H resonance assignment of the C-terminal domain of Human Centrin2 (LC-HsCen2: M84-Y172)",\N
5504,"5504","2002-12-23",\N,"1H, 13C and 15N chemical shift assignments of the SH2 domain of the Csk homologous kinase",\N
5505,"5505","2003-08-27",\N,"Backbone Dynamics of Reduced Plastocyanin from the Cyanobacterium Anabaena variabilis: Regions Involved in Electron Transfer have Enhanched Mobility",\N
5506,"5506","2002-12-27",\N,"Resonance assignments of the central complement control protein module pair of human decay accelerating factor",\N
5507,"5507","2003-01-27",\N,"Native State Hydrogen Exchange Study of Suppressor and Pathogenic Variants of Transthyretin",\N
5508,"5508","2003-01-27",\N,"Native State Hydrogen Exchange Study of Suppressor and Pathogenic Variants of Transthyretin",\N
5509,"5509","2003-01-27",\N,"Native State Hydrogen Exchange Study of Suppressor and Pathogenic Variants of Transthyretin",\N
5510,"5510","2003-01-27",\N,"Native State Hydrogen Exchange Study of Suppressor and Pathogenic Variants of Transthyretin",\N
5511,"5511","2003-07-17","2005-11-14","Backbone 1H, 13C, and 15N resonance assignments for the 21 kDa GTPase Rac1 complexed to GDP and Mg2+",\N
5512,"5512","2003-02-18",\N,"Solution structure of chicken liver basic type fatty acid binding protein",\N
5513,"5513","2003-02-18","2006-10-11","NMR assignment and secondary structure identification of the ribosomal protein L11 from Thermotoga maritima",\N
5514,"5514","2003-02-18",\N,"Backbone HN, N, Ca and Cb assignment of the GFPuv mutant, an 54 kDa protein",\N
5515,"5515","2004-09-14",\N,"1H, 13C and 15N resonance assignment of the Dishevelled DIX domain",\N
5516,"5516","2002-12-23",\N,"Assignment of the 1H, 13C and 15N resonances of the Coxsackievirus and Adenovirus receptor domain 1",\N
5517,"5517","2003-06-12","2010-07-14","NMR studies of the DNA-binding domain of B-Myb",\N
5518,"5518","2003-07-30",\N,"Role of backbone dynamics and structure in controlling the hydrolysis constants of serine proteinase inhibitors",\N
5519,"5519","2003-07-30",\N,"Role of backbone dynamics and structure in controlling the hydrolysis constants of serine proteinase inhibitors",\N
5520,"5520","2003-07-30",\N,"Role of backbone dynamics and structure in controlling the hydrolysis constants of serine proteinase inhibitors",\N
5521,"5521","2003-07-30",\N,"Role of backbone dynamics and structure in controlling the hydrolysis constants of serine proteinase inhibitors",\N
5522,"5522","2002-12-23",\N,"Letter to Editor: 1H, 15N and 13C resonance assignments of the repeated domain of human beta ig-h3",\N
5523,"5523","2002-12-27",\N,"Conformational Features of Human Melanin-Concentrating Hormone: a NMR and Computational Analysis",\N
5524,"5524","2003-01-14",\N,"Resonance Assignment and Topology of a Clostridial Repetitive Oligopeptide (CROP) Region of Toxin A from Clostridium Difficile",\N
5525,"5525","2003-09-05",\N,"NMR structure of the first Zinc Binding domain of Nup475/TTP/TIS11",\N
5527,"5527","2003-04-23",\N,"Three-Dimensional Solution Structure of Huwentoxin-Iv by 2D 1H-NMR",\N
5528,"5528","2003-07-07",\N,"Solution structure of the complementary RNA promoter of influenza a virus",\N
5529,"5529","2003-07-07",\N,"The structure of G16A MNEI monellin supports a new model of interaction of sweet proteins with the T1R2-T1R3 receptor",\N
5530,"5530","2003-12-08","2005-11-14","Naturally occurring modifications reduces the anticodon domain conformational space of tRNA-PHE",\N
5531,"5531","2003-12-08",\N,"Naturally occurring modifications reduces the anticodon domain conformational space of tRNA-PHE",\N
5532,"5532","2003-02-21",\N,"Structure of the Tsg101 UEV Domain in Complex with a HIV-1 PTAP \"Late Domain\" Peptide",\N
5534,"5534","2003-03-14",\N,"Global structure and dynamics of human apolipoprotein CII in complex with micelles: evidence for increased mobility of the helix involved in the activation of lipoprotein lipase",\N
5535,"5535","2003-02-21",\N,"NMR structure of R3H domain",\N
5536,"5536","2003-12-08","2007-07-10","1H, 13C, and 15N Chemical Shift Assignments for G88W110 fragment of Staphylococcal Nuclease",\N
5537,"5537","2003-02-21",\N,"Structure of an FF domain Human HYPA/FBP11",\N
5538,"5538","2003-08-01",\N,"1H, 13C, and 15N Chemical Shift Assignments for a PWWP domain from Sch. pombe",\N
5539,"5539","2004-02-12","2005-10-13","Solution Structure and Stability of the Full-Length Excisionase (Xis) from Bacteriophage HK022",\N
5540,"5540","2003-04-23",\N,"1H, 13C and 15N assignment of the hydroquinone form of flavodoxin from Desulfovibrio vulgaris (Hildenborough)",\N
5541,"5541","2003-04-11","2006-01-05","1H and 15N Chemical Shift Assignments of Lm-FABP",\N
5542,"5542","2003-08-01",\N,"1H chemical shifts for Penetratin in phospolipid bicelles",\N
5543,"5543","2003-08-01",\N,"1H chemical shifts for Penetratin(W48F,W56F) in phospolipid bicelles and SDS micelles",\N
5544,"5544","2002-12-23",\N,"1H, 13C, and 15N resonance assignments for S100B(beta beta)-Ca2+-TRTK-12 peptide complex",\N
5545,"5545","2003-03-18",\N,"NMR assignment of the C-terminal domain of insulin-like growth factor binding protein-6 (IGFBP-6)",\N
5547,"5547","2003-02-18",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for Streptopain",\N
5548,"5548","2003-07-07",\N,"Bovine Pancreatic Polypeptide (bPP) undergoes significant changes in conformation and dynamics upon binding to DPC micelles",\N
5549,"5549","2003-07-07",\N,"Neuropeptide Y5-Receptor II: Solution Structure and Dynamics of [31Ala,32Pro]-NPY",\N
5550,"5550","2003-07-07",\N,"Structure and Dynamics of Micelle-bound Neuropeptide Y: Comparison with unligated NPY and Implications for Receptor Selection",\N
5551,"5551","2003-04-23",\N,"Homonuclear chemical shift assignment for LEKTI domain 6 (HF7665)",\N
5552,"5552","2003-03-14",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments of the Catalytic Domain of Pac1",\N
5553,"5553","2003-03-14",\N,"Solution structure of influenza A virus C4 promoter",\N
5554,"5554","2003-02-21",\N,"Structure of the N-WASP EVH1 Domain-WIP complex",\N
5555,"5555","2003-08-01","2009-08-05","Solution structure of the 2nd PHD domain from Mi2b",\N
5556,"5556","2003-08-01",\N,"PHD Fingers as Protein Scaffolds",\N
5557,"5557","2002-12-27",\N,"Solution NMR structure of the outer membrane enzyme PagP in DPC micelles",\N
5558,"5558","2002-12-27",\N,"Sp100b SAND domain chemical shift assignments",\N
5559,"5559","2002-12-27",\N,"Partial 1H and 13C assignments for 3'-stem-loop of human U4 small nuclear RNA",\N
5560,"5560","2003-02-18",\N,"NMR assignment of the conserved hypothetical protein TM1290 of Thermotoga maritima",\N
5561,"5561","2003-02-21",\N,"NMR solution structure of the activation domain of human procarboxipeptidase A2",\N
5562,"5562","2003-04-23","2010-07-20","NMR conformational study of proposed quadruplex hexanucleotide d(CCGCGG)2 in solution",\N
5563,"5563","2003-12-08",\N,"Assignment of backbone 1H, 13C and 15N resonances of ParG, a protein required for active partition of bacterial plasmids",\N
5564,"5564","2003-03-18",\N,"1H, 13C and 15N resonance assignment of kinase-interacting FHA domain of Arabidopsis kinase associasted protein phosphatase",\N
5565,"5565","2003-09-28",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for porcine MSP",\N
5566,"5566","2003-03-18",\N,"1H, 15N and 13C Resonance Assignments for the PTB Domain of the Signaling Protein Shc",\N
5567,"5567","2003-06-10",\N,"1H, 15N and 13C Resonance Assignments for a Histone H3 Lysine Methyltransferase from Paramecium Bursaria Chlorella Virus 1",\N
5568,"5568","2003-07-07",\N,"A new member of the split bab fold: Solution structure of the protein encoded by the YML108W open reading frame from Saccharomyces cerevisiae",\N
5569,"5569","2003-02-21",\N,"15N relaxation rates for backbone of GB1",\N
5570,"5570","2003-02-18",\N,"1H, 13C, and 15N NMR assignments of the hypothetical Nudix protein DR0079 from the extremely radiation-resistant bacterium Deinococcus radiodurans",\N
5571,"5571","2003-03-18",\N,"1H, 13C and 15N assignment of the oxidized form of flavodoxin from Desulfovibrio vulgaris (Hildenborough)",\N
5572,"5572","2002-12-27",\N,"Beta-helix structure and ice-binding properties of a hyperactive antifreeze protein from an insect",\N
5573,"5573","2003-05-14",\N,"Spruce budworm Antifreeze Protein: Changes in Structure and Dynamics at Low Temperature",\N
5574,"5574","2002-12-27",\N,"Lipid induced conformation of the tachykinin peptide Kassinin",\N
5575,"5575","2003-02-21",\N,"Solution Structure of the Tachykinin Peptide Eledoisin",\N
5576,"5576","2003-08-01","2005-11-14","Sodium/potassium-transporting ATPase alpha-1 chain in complex with ATP",\N
5577,"5577","2003-08-01",\N,"Sodium/potassium-transporting ATPase alpha-1 chain",\N
5578,"5578","2003-07-25",\N,"Two Homologous Rat Cellular Retinol-binding Proteins Differ in Local Conformational Flexibility",\N
5579,"5579","2003-07-25",\N,"Two Homologous Rat Cellular Retinol-binding Proteins Differ in Local Conformational Flexibility",\N
5580,"5580","2003-05-14",\N,"NMR solution structure of type-B lantibiotics mersacidin bound to lipid II in DPC micelles",\N
5581,"5581","2003-05-14",\N,"NMR solution structure of type-B lantibiotics mersacidin in MeOH/H2O mixture",\N
5582,"5582","2003-05-14",\N,"NMR solution structure of type-B lantibiotics mersacidin in DPC micelles",\N
5583,"5583","2003-05-14",\N,"NMR structure of P41icf, a potent inhibitor of human cathepsin L",\N
5584,"5584","2003-04-10",\N,"13C Chemical Shift Assignments of Cu(II) plastocyanin from Synechocystis sp. PCC6803",\N
5585,"5585","2003-02-21",\N,"Isolation, structure and activity of GID, a novel alpha4/7-conotoxin with an extended N-terminal sequence",\N
5586,"5586","2002-12-27",\N,"Molecular Recognition in Purine-Rich Internal Loops: Thermodynamic, Structural, and Dynamic Consequences of Purine for Adenine Substitutions in 5'(rGGCAAGCCU)2",\N
5587,"5587","2002-12-27",\N,"Molecular Recognition in Purine-Rich Internal Loops: Thermodynamic, Structural, and Dynamic Consequences of Purine for Adenine Substitutions in 5'(rGGCAAGCCU)2",\N
5588,"5588","2002-12-27",\N,"Molecular Recognition in Purine-Rich Internal Loops: Thermodynamic, Structural, and Dynamic Consequences of Purine for Adenine Substitutions in 5'(rGGCAAGCCU)2",\N
5589,"5589","2003-06-25","2009-07-15","Backbone and side chain 1H, 13C, and 15N chemical shift assignments for V. cholerae VC0424","/ftp/pub/bmrb/timedomain/bmr5589"
5590,"5590","2003-11-24",\N,"1H, 13C and 15N resonance assignments of rice telomere binding domain from Oryza sativa",\N
5591,"5591","2003-05-19",\N,"Sequence specific assignment of part of the myosin binding site of myosin binding protein C",\N
5592,"5592","2003-03-18",\N,"Backbone resonance assignments for the human GMEB-1 SAND domain",\N
5593,"5593","2003-03-18",\N,"Backbone resonance assignments for the rat GMEB-2 SAND domain",\N
5594,"5594","2003-04-22",\N,"Structural insights into the U-box, a domain associated with multi-ubiquitination",\N
5595,"5595","2004-03-15",\N,"Letter to the Editor: 1H, 13C, 15N backbone resonance assignments of apo-NosL, a novel 18.5 kDa copper(I) binding protein from the nitrous oxide reductase gene cluster of Achromobacter cycloclastes",\N
5596,"5596","2003-09-05","2009-07-15","Solution Structure of the hypothetical protein yggU from E. coli. Northeast Structural Genomics Consortium Target ER14.","/ftp/pub/bmrb/timedomain/bmr5596"
5597,"5597","2003-02-21","2009-07-15","Structure and dynamics of reduced Bacillus pasteurii cytochrome c: oxidation state dependent properties and implications for electron transfer processes","/ftp/pub/bmrb/timedomain/bmr5597"
5598,"5598","2003-04-30",\N,"1H, 13C and 15N backbone resonance assignments of domain 1 of receptor associated protein",\N
5599,"5599","2003-05-14",\N,"The Tertiary Structure and Backbone Dynamics of Human Prolactin: Evidence for Reversible Oligomerization in Solution",\N
5600,"5600","2003-05-14",\N,"Complete 1H,13C,15N assignments of zinc Clostridium pasteurianum rubredoxin",\N
5601,"5601","2003-05-14",\N,"Complete 1H,13C,15N assignments of zinc Pyrococcus furiosus rubredoxin",\N
5602,"5602","2003-08-07",\N,"Complete resonance assignments for the nudix hydrolase DR2356 of Deinococcus radiodurans",\N
5603,"5603","2003-08-01",\N,"Chemical shift assignment for human proguanylin",\N
5604,"5604","2003-03-24",\N,"Solution structure of the N-terminal domain of ZntA in the apo- and Zn(II) forms",\N
5605,"5605","2003-05-02",\N,"Sequence-specific 1H, 13C and 15N resonance assignments of SAM22, an allergenic stress-induced protein from soy bean",\N
5606,"5606","2003-06-02",\N,"1H 13C and 15N chemical shift assignments for HI0719",\N
5607,"5607","2003-05-14",\N,"NMR Structure of the Extended Second Transmembrane Domain of the Human Neuronal Glycine Receptor alpha1 Subunit in SDS Micelles",\N
5608,"5608","2004-03-15",\N,"Solution Structure of Contryphan-Vn",\N
5609,"5609","2003-08-01",\N,"NMR structure of [Ala1,15]kalata B1",\N
5610,"5610","2003-02-21","2006-06-12","The Structure of the Carboxyl Terminus of Striated alpha-Tropomyosin in Solution Reveals an Unusual Parallel Arrangement of Interacting alpha-Helices",\N
5611,"5611","2003-12-11",\N,"Solution Structure of the Tachykinin Peptide Neurokinin A",\N
5612,"5612","2003-08-08",\N,"Structure of the Plant Defensin PhD1 from Petunia Hybrida",\N
5613,"5613","2003-03-25",\N,"A minimal beta-hairpin peptide scaffold for beta-turn display",\N
5614,"5614","2002-12-27",\N,"Sheared A(anti)-A(anti) Pairs in a Destabilizing 2x2 Internal Loop: The NMR Structure of 5'(rGGCAAGCCU)2",\N
5615,"5615","2003-12-11",\N,"1H/13C/15N assignment of the C-terminal domain of the E. amylovora response regulator RcsB",\N
5616,"5616","2002-12-27",\N,"Chemical Shift Assignments of the Prp40 WW Domain Pair",\N
5617,"5617","2003-04-10",\N,"1H chemical shift assignments for the aticarcinogenic Bowman Birk inhibitor isolated from snail medic seeds (Medicago Scutellata)",\N
5618,"5618","2003-08-01",\N,"Backbone 1H, 13C, 15N and Side Chain 13C Chemical Shift Assignments for DFPase from Loligo vulgaris",\N
5619,"5619","2002-12-27",\N,"Resonance assignments for the methionine sulfoxide reductase B from Bacillus subtilis, Northeast Structural Genomics Consortium target SR10",\N
5620,"5620","2002-12-27",\N,"Assignment for ribosomal protein S28E",\N
5621,"5621","2002-12-27",\N,"Assignment for yoag_ecoli",\N
5622,"5622","2003-08-08",\N,"Structural and Functional Characterization of a Thioredoxin-like Protein from methanobacterium thermoautotrophicum (Delta H)",\N
5623,"5623","2003-03-18",\N,"Assignments of 1H, 15N and 13C resonances of the proline-rich matrix protein of Moloney Murine Leukemia Virus (MA Mo-MuLV)",\N
5624,"5624","2003-02-28","2005-02-17","A Conserved Structural Motif at the N-terminal of Bacterial Translation Initiation Factor IF2",\N
5625,"5625","2006-01-24","2007-11-05","Sequential assignment of the ferricytochrome c3 from Desulfovibrio vulgaris Hildenborough",\N
5626,"5626","2003-06-10",\N,"1H 13C and 15N backbone resonance assignments of the N-terminal domain of Drosophila GCM protein",\N
5627,"5627","2003-09-05",\N,"1H, 15N, 13C Resonance Assignments of the LpxC Deacetylase from Aquifex aeolicus in Complex with the Substrate-Analog Inhibitor TU-514",\N
5628,"5628","2003-04-30",\N,"1H, 15N and 13C resonance assignments of the highly conserved 19kDa C-terminal domain from human Elongation Factor 1Bgamma",\N
5629,"5629","2003-04-08","2007-11-05","1H, 13C, and 15N resonance assignments and topology of MTH187, a conserved protein from Methanobacterium thermoautotrophicum",\N
5630,"5630","2005-12-22",\N,"1H 13C and 15N Assigned Chemical Shifts for ER75, an NESG target",\N
5631,"5631","2003-08-07",\N,"ERBIN PDZ domain bound to a phage-derived peptide",\N
5632,"5632","2004-03-07",\N,"Solution structure of the p2b hairpin from human telomerase RNA",\N
5633,"5633","2003-08-07",\N,"The solution structure of molt-inhibiting hormone from the kuruma prawn",\N
5634,"5634","2003-01-27","2010-07-19","Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS1",\N
5635,"5635","2003-01-27","2010-07-19","Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS2",\N
5636,"5636","2003-01-27","2010-07-19","Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS3",\N
5637,"5637","2003-01-27","2010-07-19","Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS4",\N
5638,"5638","2003-01-27","2010-07-19","Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS5",\N
5639,"5639","2003-01-27","2010-07-19","Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS6",\N
5640,"5640","2003-01-27","2010-07-19","Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS7",\N
5641,"5641","2003-01-27","2010-07-19","Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS8",\N
5642,"5642","2003-01-27","2010-07-19","Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS9",\N
5643,"5643","2003-01-27","2010-07-19","Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS10",\N
5644,"5644","2003-01-27","2010-07-19","Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS11",\N
5645,"5645","2003-01-27","2010-07-19","Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS12",\N
5646,"5646","2003-01-27","2010-07-19","Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS13",\N
5647,"5647","2003-01-27","2010-07-19","Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS14",\N
5648,"5648","2003-01-27","2010-07-19","Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS15",\N
5649,"5649","2003-01-27","2010-07-19","Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS16",\N
5650,"5650","2003-04-29",\N,"NMR structure of the ribosomal protein L23 from Thermus Thermophilus",\N
5651,"5651","2003-08-07",\N,"Txk SH3 domain backbone assignments",\N
5652,"5652","2003-03-25",\N,"1H Chemical Shift Assignments for CnErg1",\N
5653,"5653","2003-02-25",\N,"The solution structure of molt-inhibiting hormone from the kuruma prawn Marsupenaeus japonicus",\N
5654,"5654","2003-08-08",\N,"A Protein Contorsionist-Core Mutations Switch Monomeric Protein GB1 into an Intertwined Tetramer",\N
5655,"5655","2003-02-25","2009-06-02","U80G U6 ISL RNA Chemical Shifts",\N
5656,"5656","2003-02-25","2009-07-13","Resonance Assignments for the Z Domain of Staphylococcal Protein A using a 2H, 13C, 15N enriched, selective methyl protonated sample","/ftp/pub/bmrb/timedomain/bmr5656"
5657,"5657","2006-04-06",\N,"NMR structure for VT212",\N
5658,"5658","2003-02-25","2011-03-16","Sequence specific backbone assignment of 13C, 2H, 15N labeled ISG15",\N
5659,"5659","2003-02-17","2007-03-26","1H, 13C and 15N Backbone Assignments for the Human Rhinovirus-14 3C Protease",\N
5660,"5660","2003-02-25",\N,"Partial proton resonance assignements for the different conformers of ferricytochrome c produced in 30% acetonitrile and 70% water solution",\N
5661,"5661","2003-06-12",\N,"Rapid backbone 1H, 13C, and 15N assignment of the V1 domain of human PKC iota using the new program IBIS",\N
5662,"5662","2004-03-15",\N,"Distinctive solution conformation of phosphatase inhibitor CPI-17 substituted with aspartate at the phosphorylation site threonine",\N
5663,"5663","2004-03-15",\N,"Distinctive solution conformation of phosphatase inhibitor CPI-17 substituted with aspartate at the phosphorylation site threonine",\N
5664,"5664","2003-08-08",\N,"Full 1H and 15N Chemical Shift Assignments for Oxytetracycline Acyl Carrier Protein",\N
5665,"5665","2004-03-15",\N,"ClpX Zinc Binding Domain",\N
5666,"5666","2003-06-10",\N,"1H, 15N and 13C backbone assignment of the Green Fluorescent Protein (GFP)",\N
5667,"5667","2003-08-07",\N,"Solution structure of the first zinc-finger domain from ZNF265",\N
5668,"5668","2003-10-08",\N,"Backbone and side chain 1H, 13C, and 15N chemical shift assignments for Zinc-containing 3-methyladenine DNA glycosylase I (TAG) from Escherichia coli",\N
5669,"5669","2003-06-10",\N,"Structure and Ubiquitin Interactions of the Conserved NZF Domain of Npl4",\N
5670,"5670","2003-04-30",\N,"Structural Characterization of Hellethionins from helleborus purpurascens",\N
5671,"5671","2003-11-11","2010-07-20","Overall structure and sugar dynamics of a DNA dodecamer from homo and heteronuclear dipolar couplings and 31P chemical shift anisotropy",\N
5672,"5672","2003-08-07",\N,"Automatic assignment of NOESY Cross peaks and determination of the protein structure of a new world scorpion neurotoxin Using NOAH/DIAMOD",\N
5673,"5673","2003-08-07",\N,"NMR Solution Structure of the Glucagon Antagonist [desHis1, desPhe6, Glu9]Glucagon Amide in the Presence of Perdeuterated Dodecylphosphocholine Micelles",\N
5674,"5674","2003-02-25",\N,"THREE DIMENSIONAL SOLUTION STRUCTURE OF HAINANTOXIN-IV BY 2D 1H-NMR",\N
5675,"5675","2003-02-25",\N,"THREE DIMENSIONAL SOLUTION STRUCTURE OF HAINANTOXIN-I BY 2D 1H-NMR",\N
5676,"5676","2003-09-05",\N,"1H chemical shifts of Pi4, a four disulfide bridged scorpion toxin active on potassium channels",\N
5677,"5677","2004-03-15",\N,"1H, 13C, and 15N assignment of the Focal Adhesion Targeting Domain of Focal Adhesion Kinase",\N
5678,"5678","2004-02-13",\N,"1H, 15N, and 13C assigned Chemical shift for HNF-6a",\N
5679,"5679","2003-07-17",\N,"1H, 13C and 15N chemical assignment of xylan-binding domain from Streptomyces olivaceoviridis E-86 beta-xylanase",\N
5680,"5680","2004-11-29",\N,"Letter to the Editor: Sequence-specific assignment and secondary structure determination of the 195-residue complex formed by the Mycobacterium tuberculosis proteins CFP-10 and ESAT-6. Towards an understanding of their role in tuberculosis pathogenesis",\N
5681,"5681","2003-08-07","2010-07-19","DIMERIC SOLUTION STRUCTURE OF THE CYCLIC OCTAMER CD(CGCTCATT)",\N
5682,"5682","2004-06-30",\N,"Solution Structure of 30S Ribosomal Protein S27E from Archaeoglobus Fulgidus: RS27_ARCFU: a novel fold",\N
5683,"5683","2004-09-14",\N,"QR6 structure",\N
5684,"5684","2003-03-25",\N,"1H and 15N Assigned Chemical Shifts for MTH1821",\N
5685,"5685","2003-12-17",\N,"1H, 15N, and 13C Assignments and CSI Analysis of a 18kDa Complex Formed by the Carboxyl-Terminal Domains of RAP74 and FCP1",\N
5686,"5686","2004-02-11","2005-09-22","Backbone 1H, 13C and 15N resonance assignments of the 50kD response regulator HP1043 from Helicobactor pylori",\N
5687,"5687","2003-02-25","2007-11-30","Stably folded de novo proteins from a designed combinatorial library",\N
5688,"5688","2003-10-08",\N,"Backbone 1H, 13C, and 15N Chemical Shifts Assignment for the all-trans conformer of the cathelin-like domain of the protegrin-3 precursor",\N
5689,"5689","2003-10-08","2005-11-21","1H, 13C, and 15N backbone assignments of the pheromone binding protein from the silk moth Antheraea polyphemus (ApolPBP)",\N
5690,"5690","2003-05-08",\N,"1H, 13C, and 15N Chemical Shift Assignments for Cobra Neurotoxin II",\N
5691,"5691","2003-02-25","2009-07-13","Solution Structure of the 30S ribosomal protein S28E from Pyrococcus horikoshii. Northeast Structural Genomics Consortium target JR19","/ftp/pub/bmrb/timedomain/bmr5691"
5692,"5692","2003-08-08",\N,"Structural and functional insights into PINCH LIM4 domain-mediated integrin signaling",\N
5693,"5693","2003-08-07",\N,"Backbone chemical shift assignments of Grb2 complexed with ligand peptides for SH3 and SH2 domains",\N
5694,"5694","2004-09-14",\N,"10-residue folded peptide designed by segment statistics",\N
5695,"5695","2003-04-30",\N,"Solution Structure of the Product of the S. Cerevisiae YHR087W Gene, Northeast Structural Genomics Consortium target YTYst425",\N
5696,"5696","2004-04-07",\N,"1H, 15N and 13C resonance assignments of the PDZ domain of ZASP",\N
5697,"5697","2004-04-07",\N,"1H and 15N resonance assignments of the PDZ domain of ZASP in complex with the EF hand domains of alpha-actinin-2",\N
5698,"5698","2003-09-12",\N,"Backbone and Side-chain 1H, and 15N Chemical Shift Assignments for TcPABC",\N
5699,"5699","2003-08-07",\N,"Structure of the N-terminal Extension of Human Aspartyl-tRNA Synthetase: Implications for its biological function",\N
5700,"5700","2003-03-21",\N,"Backbone 1H, 13C and 15N resonance assignments for the 25.8 kDa DNA binding domain of the human p63 protein",\N
5701,"5701","2003-06-12",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for the catalytic GEF domain of Salmonella SopE2",\N
5702,"5702","2003-03-21",\N,"1H, 13C, and 15N Chemical Shift Assignments for Omega-atracotoxin-Hv1a at pH 6.0",\N
5703,"5703","2003-08-07",\N,"SP phosphorothioate U6 RNA ISL",\N
5704,"5704","2003-06-09",\N,"1H, 13C, and 15N assignment of mth677 protein from Methanobacterium Thermoautotrophicum",\N
5705,"5705","2004-02-11","2010-05-10","1H, 13C and 15N resonance assignment of an RNA UUCG Tetraloop",\N
5706,"5706","2003-05-22",\N,"Antibiotic binding domain of a TipA-class multidrug resistance transcriptional regulator",\N
5707,"5707","2004-03-07",\N,"Sequence-specific 1H, 13C and 15N resonance assignments of the birch pollen allergen Bet v 4",\N
5708,"5708","2003-05-22",\N,"Solution structure of the N-terminal membrane anchor of E. coli enzyme IIA(Glucose)",\N
5709,"5709","2003-06-12",\N,"1H, 15N and 13C resonance assignments of the TPR domain of hSGT",\N
5710,"5710","2004-02-12",\N,"Structure and interactions of Mth11: A homologue of human RNase P protein Rpp29",\N
5711,"5711","2009-03-17",\N,"Solution Structure of HP0371, Biotin Carboxyl Carrier protein from Helocobacter pylori",\N
5712,"5712","2003-09-05","2006-06-26","Backbone resonance assignment for human eIF4E in complex with m7GDP and a 17-amino acid peptide derived from human eIF4G",\N
5713,"5713","2003-05-21",\N,"Influence of pH on NMR structure and stability of the human prion protein globular domain",\N
5714,"5714","2003-09-15","2010-07-16","1H Chemical shift assignments of the major conformation of a 11-mer DNA duplex containing an AG Mismatch",\N
5715,"5715","2004-03-23",\N,"Paramagnetic relaxation enhancements of the amide protons in HHP-tagged thioredoxin",\N
5716,"5716","2003-04-30","2010-07-16","CHEMICAL SHIFTS OF THE CK14 DNA DUPLEX: A PORTION OF THE KNOWN NF-kB SEQUENCE CK1",\N
5717,"5717","2003-04-30","2010-07-19","NMR STRUCTURE OF THE CK14 DNA DUPLEX: A PORTION OF THE KNOWN NF-kB SEQUENCE CK1",\N
5718,"5718","2003-04-30","2010-07-16","Chemical Shifts for the XBY2 DNA Duplex",\N
5719,"5719","2003-07-17",\N,"Resonance assignment and secondary structure of an N-terminal fragment of the human La protein",\N
5720,"5720","2003-05-01",\N,"15N Relaxation Data of Escherichia coli Adenylate Kinase in Ligand-Free Form Obtained at Magnetic Fields of 14.10 and 18.79 T",\N
5721,"5721","2004-02-11",\N,"Backbone resonance assignment of a aminoglycoside-3'-phosphotransferase from Klebsiella pneumoniae",\N
5722,"5722","2003-06-25",\N,"Chemical Shift Assignmens of Ca2+/C-terminal Domain of Caltractin (1H, 13C, and 15N) in Complex with the Cdc31p-Binding Domain from Kar1p (1H)",\N
5723,"5723","2003-09-15",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for Brazzein",\N
5724,"5724","2003-09-15",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for R43A Brazzein",\N
5725,"5725","2003-09-15",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for Ala2ins Brazzein",\N
5726,"5726","2003-09-15",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for D50A Brazzein",\N
5727,"5727","2003-09-15",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for H31A Brazzein",\N
5728,"5728","2003-09-15",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for R33A Brazzein",\N
5729,"5729","2003-08-08",\N,"Solution Structure, Dynamics and Thermodynamics of the Native State Ensemble of the Sem-5 C-terminal SH3 Domain",\N
5730,"5730","2003-04-08","2010-07-15","1H Chemical Shift Assignments for a DNA Duplex with N6-Deoxyadenosine Adduct of (9S,10R)-9,10-Epoxy-7,8,9,10-tetrahydrobenzo[a]pyrene",\N
5731,"5731","2004-09-14",\N,"1H Chemical Shift Assignments for SCR3 peptide (18-34)",\N
5732,"5732","2004-09-14",\N,"1H Chemical Shift Assignments for SCR3 peptide (18-54)",\N
5733,"5733","2004-09-14",\N,"1H Chemical Shift Assignments for SCR3 peptide (34-54)",\N
5734,"5734","2004-09-14",\N,"1H Chemical Shift Assignments for SCR3 peptide (27-33)",\N
5735,"5735","2004-10-18",\N,"The Solution Structure of Rat Ab-(1-28) and its Interaction with Zinc: Insights into the Scarity of Amyloid Deposition in Aged Rat Brain",\N
5736,"5736","2003-10-08","2011-11-30","Sequence specific resonance assignments of ICln, an ion channel cloned from epithelial cells",\N
5737,"5737","2003-09-15","2010-07-19","Structure of the parallel-stranded DNA quadruplex d(TTAGGGA)4 containing the human telomeric repeat: evidence for A-tetrad formation from NMR and molecular dynamics simulation.",\N
5738,"5738","2003-08-07",\N,"The NMR Structure of a Bifunctional Rhodamine Labeled N-domain of Troponin C in Complex with the Regulatory 'Switch' Peptide from Troponin I",\N
5739,"5739","2003-08-08","2010-07-16","Mispairing of the Deoxycytosine with Deoxyadenosine 5' to the 8, 9-Dihydro-8-(N7-guanyl)-9-Hydroxy-Aflatoxin B1 Adduct : Structural study based on NMR",\N
5740,"5740","2003-10-08",\N,"Backbone 1H, 13C and 15N Chemical shift assignments for the ternary DHFR:FOLATE:NADP+ complex",\N
5741,"5741","2003-10-08",\N,"Backbone 1NH, 13C and 15N Chemical shift assignments for the ternary DHFR:FOLATE:DHNADPH complex",\N
5742,"5742","2003-12-17",\N,"Solution structure of soluble domain of Sco1 from Bacillus Subtilis",\N
5743,"5743","2003-12-18",\N,"Backbone 1H, 13C and 15N Chemical Shift Assignments for the extracellular domain of b-dystroglycan (654-750)",\N
5744,"5744","2003-05-22",\N,"Backbone Assignments of folded alpha-synuclein",\N
5745,"5745","2003-12-19","2007-11-05","NMR Structure of bovine cytochrome b5",\N
5746,"5746","2003-05-01",\N,"15N Relaxation Data of Escherichia coli Adenylate Kinase in Complex with Inhibitor Ap5A Obtained at Magnetic Fields of 14.10 and 18.79 T",\N
5747,"5747","2003-05-22",\N,"Solution structure of a four-helix bundle model, apo-DF1",\N
5748,"5748","2003-09-05",\N,"Assignment of 1H, 13C, and 15N Resonances of the ARID Domain of P270",\N
5749,"5749","2005-09-08",\N,"Isolation, gene expression and solution structure of a novel moricin analogue, an antibacterial peptide from a lepidopteran insect, Spodoptera litura",\N
5750,"5750","2003-05-22",\N,"1H, 13C, and 15N Chemical Shift Assignments for the extracellular domain of BR3",\N
5751,"5751","2003-08-08",\N,"NMR structure of PCOLCE",\N
5752,"5752","2003-08-07",\N,"1H, 13C and 15N backbone resonance assignment of the Integrin alpha2 I-domain",\N
5753,"5753","2003-08-08",\N,"Towards an Understanding of the Poliovirus Replication Complex: The Solution Structure of the Soluble Domain of the Poliovirus 3A Protein",\N
5754,"5754","2004-04-07",\N,"1H, 13C and 15N backbone resonance assignment of the VASP EVH1 domain",\N
5755,"5755","2003-09-28",\N,"Assignment of Human Phosphatase Regenerating Liver 2 (PRL-2)",\N
5756,"5756","2003-08-07",\N,"Resonance Assignments for the 21 kDa engineered fluorescein-binding lipocalin FluA",\N
5757,"5757","2003-10-16",\N,"13C, 15N solid state NMR chemical shift assignments for the microcrystallin Crh domain swapped dimer",\N
5758,"5758","2003-10-16",\N,"1H, 13C and 15N chemical shift assignments for YqgF",\N
5759,"5759","2004-04-07",\N,"A model for effector activity in a highly specific biological electron transfer complex: The cytochrome P450cam-putidaredoxin couple",\N
5760,"5760","2003-09-05",\N,"1H, 13C, and 15N backbone assignment of the first two Ig domains Z1Z2 of the giant muscle protein titin",\N
5761,"5761","2003-12-19",\N,"1H, 13C and 15N Chemical Shift Assignments for Gamma-Adaptin Ear Domain",\N
5762,"5762","2004-02-11",\N,"The alternatively spliced PDZ2 domain of PTP-BL, PDZ2as",\N
5763,"5763","2004-06-25",\N,"1H, 15N and 13C resonance assignments of the hypothetical protein SAV1595 from Staphylococcus aureus",\N
5764,"5764","2003-08-08",\N,"1H, 13C and 15N Chemical Shift Assignments for the Nuclear Factor ALY RBD Domain",\N
5765,"5765","2003-08-08",\N,"NMR studies of the fifth transmembrane segment of sarcoplasmic reticulum Ca2+-ATPase reveals a hinge close to the Ca2+ ligating residues",\N
5766,"5766","2003-09-08",\N,"Solution Structure of the Lyase Domain of Human DNA Polymerase Lambda",\N
5767,"5767","2003-12-18",\N,"1H NMR structure determination of Viscotoxin C1",\N
5768,"5768","2003-09-08",\N,"Solution structure of Copper-CopAS46V from Bacillus subtilis",\N
5769,"5769","2003-09-08",\N,"Solution structure of apo-CopAS46V from Bacillus subtilis",\N
5770,"5770","2003-05-01",\N,"Structural basis for simultaneous binding of two carboxy-terminal peptides of plant glutamate decarboxylase to calmodulin",\N
5771,"5771","2003-05-21",\N,"Solution Structure of the disulphide-linked dimer of human intestinal trefoil factor (TFF3): the intermolecular orientation and interactions are markedly different from those of other dimeric trefoil proteins",\N
5772,"5772","2003-05-22",\N,"Backbone 1H, 13C and 15N chemical shifts of CBM13 from Streptomyces lividans",\N
5773,"5773","2003-05-01",\N,"Solution structure of HIV-1 Stem Loop SL1",\N
5774,"5774","2003-08-01",\N,"Recognition of GU-rich polyadenylation regulatory elements by human CstF-64 protein",\N
5775,"5775","2003-06-09","2010-07-16","5'(dCCUCCUU)3':3'(rAGGAGGAAA)5'",\N
5776,"5776","2003-06-09","2010-07-16","sPrODN1:RNA [5'-R(AAAGGAGGA)-3'/5'-D(CXXXXXX)-3']",\N
5777,"5777","2003-06-09",\N,"PODN:RNA [5'-R(AAAGGAGGA)-3'/5'-D(XXXXXXX)-3']",\N
5778,"5778","2004-04-07",\N,"1H, 15N and 13C chemical shift assignment of the Pleckstrin Homology domain of the Protein kinase B (PKB/Akt)",\N
5779,"5779","2004-03-07",\N,"The Solution structure of HI1450",\N
5780,"5780","2004-05-15",\N,"NMR structure of the PYRIN domain of human ASC",\N
5781,"5781","2003-05-19","2010-07-16","The Solution Structure of a DNA.RNA Duplex Containing 5-Propynyl U and C Comparison with 5-Me Modifications",\N
5782,"5782","2004-02-12",\N,"1H chemical shift assignment for the truncated form of the human beta2-microglobulin lacking of the first 3 residues",\N
5783,"5783","2004-02-12",\N,"1H chemical shift assignments for a mutant of human beta2-microglobulin where ARG 3 is replaced by Ala",\N
5784,"5784","2004-02-12",\N,"1H assignment of a human variant of beta2-microglobulin where His 31 was replaced by a Tyr",\N
5785,"5785","2004-03-15",\N,"Global Orientation of Bound MMP-3 and N-TIMP-1 in Solution via Residual Dipolar Couplings",\N
5786,"5786","2004-02-11",\N,"Solution Structure of Neural Cadherin Prodomain",\N
5787,"5787","2003-09-05",\N,"1H, 13C and 15N resonance assignments and secondary structure of the cytotoxic protein RNase 3 from oocytes of bullfrog Rana catesbeiana",\N
5788,"5788","2003-08-01",\N,"Structural basis for negative regulation of hypoxia-inducible factor-1alpha by CITED2",\N
5789,"5789","2004-06-25",\N,"1H,15N, and 13C chemical shift assignments of the Escherichia coli nitrogen regulatory phosphocarrier IIANtr",\N
5790,"5790","2004-03-15",\N,"Solution structure of the Hypothetical protein AQ_1857 from Aquifex aeolicus: Northeast Structural Genomics Consortium Target QR6",\N
5791,"5791","2004-10-18","2010-07-14","Solution structure of a dimeric lactose DNA-binding domain complexed to a nonspecific DNA sequence",\N
5792,"5792","2003-10-16",\N,"Assignment of the 1H, 15N and 13C resonances of E. coli frataxin orthologue, CyaY",\N
5793,"5793","2004-02-11",\N,"Backbone 1H, 15N, 13C and side chain 13Cb assignment of a 42 kDa RecR homodimer",\N
5794,"5794","2003-10-16",\N,"1H, 13C, 15N Chemical Shift Assignments for the SH3-SH2 domain pair of the tyrosin kinase Lck",\N
5795,"5795","2004-09-14",\N,"The Solution Structure of a Novel Type of Antifungal Peptide Distinct With a Five-disulfide Motif from Eucommia ulmoides Oliv",\N
5796,"5796","2004-10-18",\N,"Solution Structure of a Putative Ribosome Binding-Protein from Mycoplasma pneumoniae and Comparison to a Distant Homolog",\N
5797,"5797","2004-02-11",\N,"Solution structure of the hypothetical protein TA1414 from Thermoplasma acidophilum",\N
5798,"5798","2006-04-06",\N,"Solution structure of Protein yrbA from Escherichia Coli: Northeast Structural Genomics Consortium target ER115",\N
5799,"5799","2004-03-23",\N,"Protein Signal Assignments using Specific Labeling and Cell-free Synthesis",\N
5800,"5800","2004-02-11",\N,"Sequence-specific 1H, 13C, 15N resonance assignments of the carboxyterminal domain of the transcription factor NusA from E.coli",\N
5801,"5801","2003-10-13",\N,"Structural analysis of an EGF/TGF-alpha chimera with unique ErbB binding specificity",\N
5802,"5802","2007-03-22",\N,"1H, 13C and 15N Backbone Resonance assignments for the water soluble domain of ferric rat liver outer mitochondrial membrane cytochrome b5",\N
5803,"5803","2004-09-14",\N,"Three-disulfide variant of hen lysozyme: C64A/C80A",\N
5804,"5804","2004-09-14",\N,"Three-disulfide variant of hen lysozyme: C76A/C94A",\N
5805,"5805","2004-02-11","2012-12-07","NMR Structure of an Archaeal Homologue of RNase P Protein Rpp29",\N
5806,"5806","2003-09-28",\N,"Solution structure of the recombinant Penaeidin-3, a shrimp antimicrobial peptide",\N
5807,"5807","2004-02-11",\N,"Letter to the Editor: Assignments of 1H and 15N resonances of the bacteriophage lambda capsid stabilizing protein gpD",\N
5808,"5808","2004-02-12",\N,"Chemical shift assignments and relaxation parameters for the PAH2 domain of mSin3B bound to an extended SID of Mad1",\N
5809,"5809","2003-09-28",\N,"1H Chemical Shift Assignments for the cyanomet complex of the isolated alpha-chain from human hemoglobin A",\N
5810,"5810","2003-12-18",\N,"1H, 15N and 13C resonance assignment of staphostatin A, a specific Staphylococcus aureus cysteine proteinase inhibitor",\N
5811,"5811","2005-05-26",\N,"1H Chemical Shift Assignments for quasi-repetitive arginine/glycine/ tyrosine-rich domains within glycine-rich RNA binding proteins",\N
5812,"5812","2005-05-26","2005-06-09","1H Chemical Shift Assignments for quasi-repetitive arginine/glycine/ tyrosine-rich domains within glycine-rich RNA binding proteins",\N
5813,"5813","2003-12-18",\N,"The solution structure of the whole N-terminal domain of the ATPase CopA from Bacillus Subtilis. Implications for the function",\N
5814,"5814","2004-02-11",\N,"The C-terminal domain of Viral IAP associated factor (cVIAF) is a structural homolog of phosducin: Resonance assignments and secondary structure of the C-terminal domain of VIAF",\N
5815,"5815","2003-10-17",\N,"Structure of the coat protein in fd filamentous bacteriophage particles",\N
5816,"5816","2003-12-18",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignment of The Dimer Yeast Peroxiredoxin YLR109w",\N
5817,"5817","2003-09-08",\N,"NMR Structure of a Prototype LNR Module from Human Notch1",\N
5818,"5818","2003-09-12",\N,"The solution structure of YbcJ from E. coli reveals a recently discovered alfaL motif involved in RNA-binding",\N
5819,"5819","2004-04-07","2006-02-13","Complete 1H, 15N and 13C assignment of the soluble domain of the ba3 oxidase subunit II of Thermus thermophilus in the reduced state",\N
5820,"5820","2003-10-17",\N,"Tertiary structure of thiopurine methyltransferase from Pseudomonas syringae, the bacterial orthologue of a polymorphic, drug-metabolizing enzyme",\N
5821,"5821","2004-02-11",\N,"1H, 15N and 13C assignments of single-stranded DNA binding domains from the 70 kDa subunit of Human Replication Protein A",\N
5822,"5822","2004-02-11",\N,"1H, 15N and 13C assignments of single-stranded DNA binding domains from the 70 kDa subunit of Human Replication Protein A",\N
5823,"5823","2004-02-11",\N,"1H, 15N and 13C assignments of single-stranded DNA binding domains from the 70 kDa subunit of Human Replication Protein A",\N
5824,"5824","2004-02-13",\N,"Sequence-specific 1H, 13C and 15N resonance assignments of the C-terminal domain of KaiA, a circadian clock protein (oxidized form)",\N
5825,"5825","2004-02-13",\N,"Sequence-specific 1H, 13C and 15N resonance assignments of the C-terminal domain of KaiA, a circadian clock protein (reduced form)",\N
5826,"5826","2004-04-06",\N,"Nickel-binding property of Bacillus pasteurii UreE and the role of the C-terminal tail",\N
5827,"5827","2003-09-28",\N,"Backbone and sidechain heteronuclear resonance assignments and hyperfine nuclear magnetic resonance shifts in horse cytochrome c",\N
5828,"5828","2003-09-28",\N,"Backbone and sidechain heteronuclear resonance assignments and hyperfine nuclear magnetic resonance shifts in horse cytochrome c",\N
5829,"5829","2003-09-28",\N,"Backbone and sidechain heteronuclear resonance assignments and hyperfine nuclear magnetic resonance shifts in horse cytochrome c",\N
5830,"5830","2003-09-28",\N,"Backbone and sidechain heteronuclear resonance assignments and hyperfine nuclear magnetic resonance shifts in horse cytochrome c",\N
5832,"5832","2003-09-12",\N,"Function and solution structure of hainantoxin-III, a potent neuronal TTX-sensitive sodium channel antagonist from Chinese bird spider Selenocosmia hainana",\N
5833,"5833","2004-02-10",\N,"1H, 13C, and 15N Chemical Shift Assignments for Mob1",\N
5834,"5834","2003-09-12",\N,"Solution structure of the HIV-1 frameshift inducing stem-loop RNA",\N
5835,"5835","2004-03-07",\N,"The Solution Structure and Dynamics of Recombinant Onconases",\N
5836,"5836","2004-09-14",\N,"Backbone 1H, 13C, 15N chemical shifts and coupling constants of Yersinia pseudotuberculosis-derived mitogen",\N
5837,"5837","2006-01-23","2008-07-01","Structure of a peptide derived from the voltage gated Na+ channel and its selective interaction with local anesthetic as determined by NMR spectroscopy",\N
5838,"5838","2003-12-19",\N,"Structural Model for Calcium Dependent Activation of Ndr Kinase by S100B",\N
5839,"5839","2003-10-03","2007-06-11","Characterization of the overall and local dynamics of a protein with intermediate rotational anisotropy: Differentiating between conformational exchange and anisotropic diffusion in the B3 domain of protein G",\N
5840,"5840","2003-12-18",\N,"Chemical Shifts assignments for Frenatin 3 in both Triflouroethanol/water and water",\N
5841,"5841","2003-10-03","2005-08-17","15N T1 and T2 relaxation rates, 1H{15N} NOE, and Hydrogen/Deuterium exchange data of kinase-interacting FHA domain of Arabidopsis kinase associasted protein phosphatase",\N
5842,"5842","2004-10-10","2009-07-13","Backbone and side chain 1H, 13C, and 15N chemical shift assignments for Haemophilus influenza protein IR24","/ftp/pub/bmrb/timedomain/bmr5842"
5843,"5843","2003-07-17","2009-07-13","Solution Structure of At3g17210","/ftp/pub/bmrb/timedomain/bmr5843"
5844,"5844","2004-07-26","2009-07-13","ZR18 Structure determination","/ftp/pub/bmrb/timedomain/bmr5844"
5845,"5845","2004-10-10","2009-07-09","Backbone and side chain 1H, 13C, and 15N chemical shift assignments for S. aureus protein MW2441 / SACOL2532. Northeast Structural Genomics Target ZR31.","/ftp/pub/bmrb/timedomain/bmr5845"
5846,"5846","2004-06-30",\N,"1H, 13C, and 15N Chemical Shift Assignments for Hypothetical protein NMA1147: the Northeast Structural Genomics Consortium Target MR19",\N
5847,"5847","2003-09-16","2005-05-03","Backbone and sidechain 1H, 13C, and 15N chemical shifts for Sda",\N
5848,"5848","2003-10-06",\N,"Solution structure of S8-SP11",\N
5849,"5849","2004-09-14",\N,"Solution structure of the PCI domain",\N
5850,"5850","2004-05-15","2005-11-16","Kinetic and Structural Studies of the Low Moleuclar Weight Protein Tyrosine Phosphatase from Tritrichomonas foetus",\N
5851,"5851","2003-09-12",\N,"Solution Stucture of the Third Zinc Finger from BKLF",\N
5852,"5852","2003-09-12",\N,"NMR Structure of the Active Conformation of the Varkud Satellite Ribozyme Cleavage Site",\N
5853,"5853","2004-02-11",\N,"Sequential 1H, 15N and 13C NMR assignment of human Calbindin D28k",\N
5854,"5854","2004-02-10",\N,"1H, 13C, and 15N backbone assignments for the 60.8 kD dimer of the NAD+ synthetase from Bacillus subtilis",\N
5856,"5856","2004-02-11",\N,"Backbone Resonances Assignments of Human Adult Hemoglobin in the Carbonmonoxy Form",\N
5857,"5857","2006-06-26",\N,"NMR assignment of human Sip(7-50)",\N
5858,"5858","2004-02-12",\N,"Characterization of us-ms Dynamics of Proteins Using a Combined Analysis of 15N NMR Relaxation and Chemical Shift: Conformational Exchange in Plastocyanin Induced by Histidine Protonations",\N
5859,"5859","2003-10-17","2009-07-09","Structure of Antibacterial Peptide Microcin J25: A 21-Residue Lariat Protoknot","/ftp/pub/bmrb/timedomain/bmr5859"
5860,"5860","2003-12-19",\N,"Structure of Subtilosin A, an Antimicrobial Peptide from Bacillus subtilis with Unusual Post-translational Modifications Linking Cysteine Sulfurs to alpha-Carbons of Phenylalanine and Threonine",\N
5861,"5861","2004-02-11",\N,"Backbone resonance assignments of GTPase domain of E.coli MnmE",\N
5862,"5862","2004-02-13",\N,"Assignments of death domain of TRADD",\N
5863,"5863","2004-02-13",\N,"Backbone HN, N, Ca, C and Cb chemical shift assignments and Secondary Structure of FkpA, a 245-residue peptidyl- prolyl cis/trans isomerase with chaperone activity",\N
5864,"5864","2004-10-25",\N,"Neurokinin B",\N
5865,"5865","2007-08-29",\N,"Solution Structure of Bmkk 2, A Novel Potassium Channel Blocker from Scorpion Buthus martensi Karsch",\N
5866,"5866","2003-10-06",\N,"Solution Structure and NH Exchange Studies of the MutT Pyrophosphohydrolase Complexed with Mg(2+) and 8-oxo-dGMP, a Tightly-bound Product",\N
5867,"5867","2006-01-11",\N,"Solution Structure of the third SH3 domain of human intersectin 2(KIAA1256)",\N
5868,"5868","2005-05-19",\N,"Solution structure of XPC binding domain of hHR23B",\N
5869,"5869","2003-12-05",\N,"Solution Conformation of alphaA-Conotoxin EIVA",\N
5870,"5870","2004-10-25",\N,"Structural Studies of Cu(I)-Bleomycin",\N
5871,"5871","2004-04-07",\N,"Sequence-specific 1H, 13C and 15N resonance assignments of Ara h 6, an allergenic 2S albumin from peanut",\N
5872,"5872","2003-09-16",\N,"1H, 13C, and 15N resonance assignments of human RGSZ1",\N
5873,"5873","2004-07-07",\N,"Backbone and side chains 1H, 13C, and 15N Chemical Shift Assignments for BlaI-NTD",\N
5874,"5874","2003-12-05",\N,"Complete backbone resonance assignments of p47: the 41kDa adaptor protein of the AAA ATPase p97",\N
5875,"5875","2003-12-05",\N,"1H, 13C, and 15N Chemical Shift Assignments of the dimeric mutant of GB1",\N
5876,"5876","2003-12-05",\N,"Complete backbone resonance assignments of p47: the 41kDa adaptor protein of the AAA ATPase p97",\N
5877,"5877","2004-10-25","2007-02-23","Solid State NMR Structure of the Major Coat Protein in Bacteriophage Pf1",\N
5878,"5878","2004-02-11",\N,"1H, 13C and 15N NMR assignment of the region 1463-1617 of mouse p53 Binding Protein 1 (53BP1)",\N
5879,"5879","2004-07-23",\N,"Structure of a Type IVb pilin from Salmonella typhi and its assembly into pilus",\N
5880,"5880","2006-01-11",\N,"Solution structure of the retroviral Gag MA-like domain of RIKEN cDNA 3110009E22",\N
5881,"5881","2003-09-16","2005-02-18","Structural basis for tetrodotoxin-resistant sodium channel binding by mu-conotoxin SmIIIA",\N
5882,"5882","2004-04-07","2010-04-19","Backbone chemical shift assignments for the C-terminal globular domain of EMILIN-1",\N
5883,"5883","2004-06-25",\N,"How C-Terminal Carboxyamidation Alters the Biological Activity of Peptides from the Venom of the Eumenine Solitary WasP",\N
5884,"5884","2004-02-13","2005-02-28","Assignment of 1H, 13C and 15N resonances of the AXH domain of the transcription factor HBP1",\N
5885,"5885","2003-10-06",\N,"CHEMICAL SHIFTS OF A FUSED DOCKING DOMAIN FROM THE ERYTHROMYCIN POLYKETIDE SYNTHASE (DEBS), A MODEL FOR THE INTERACTION BETWEEN DEBS 2 AND DEBS 3",\N
5886,"5886","2005-05-03",\N,"Backbone 1H, 13C and 15N Chemical Shift Assignments for TF1 bata subunit",\N
5887,"5887","2003-12-19","2005-09-16","1H, 15N and 13C assignments for nuclear transport factor 2 (NTF2)",\N
5888,"5888","2003-12-19",\N,"Backbone 1H, 15N, CA and CB assignments for the W7A mutant of rat nuclear transport factor 2 (NTF2)",\N
5889,"5889","2003-12-19",\N,"1H assignments for yeast nucleoporin Nsp1 residues 528-557",\N
5890,"5890","2004-02-12",\N,"The NMR-derived Solution Structure of a New Cationic Antimicrobial Peptide from the Skin Secretion of the Anuran Hyla punctata",\N
5891,"5891","2004-07-30",\N,"1H, 15N and 13C NMR Assignments and Secondary Structure of a Hyperthermophile DNA-binding Protein Predicted to contain an Extended Coiled Coil Domain",\N
5892,"5892","2004-07-30","2007-11-05","1H, 13C and 15N NMR Assignments of the Hyperthermophile Sulfolobus Protein Sso10b2 and its Predicted Secondary Structure",\N
5893,"5893","2004-03-05",\N,"Unusual Ca2+-calmodulin binding interactions of the microtubule-associated protein F-STOP",\N
5894,"5894","2004-10-25",\N,"1H, 13C, and 15N resonance assignments for the N-terminal domain of Drosophila Stem-Loop Binding Protein",\N
5895,"5895","2003-12-19",\N,"1H, 13C, and 15N resonance assignments for Zn2+ and Ca2+ bound S100B",\N
5896,"5896","2004-02-11",\N,"Unusual Ca2+-calmodulin binding interactions of the microtubule-associated protein F-STOP",\N
5897,"5897","2003-12-05",\N,"Solution Structure of the BHRF1 Protein From Epstein-Barr Virus, a Homolog of Human Bcl-2",\N
5898,"5898","2004-10-25",\N,"Backbone 1H, 13C and 15N resonance assignments for the 24.4 kDa human gankyrin protein",\N
5899,"5899","2003-10-06",\N,"NMR Solution Structure of BeF3-Activated Spo0F, 20 conformers",\N
5900,"5900","2004-07-23",\N,"NMR structure of 16th module of Immune Adherence Receptor, Cr1 (Cd35)",\N
5901,"5901","2004-03-07",\N,"Solution Strucure of a CCHHC Domain of Neural Zinc Finger Factor-1",\N
5902,"5902","2004-03-07",\N,"1H, 13C, and 15N Resonance Assignments of the Hath-Domain of Hepatoma-derived Growth Factor",\N
5903,"5903","2004-04-07",\N,"1H,13C and 15N backbone resonance assignment of the Hyaluronan-binding domain of CD44",\N
5904,"5904","2005-05-25",\N,"NMR study of inhibitor-1a - a protein inhibitor of protein phosphatase-1",\N
5905,"5905","2003-10-06","2007-07-11","Backbone 15N and 1HN Chemical Shift Assignments for Sac7d",\N
5906,"5906","2004-02-13",\N,"1H, 15N, and 13C resonance Assignments of DARPP-32 (dopamine and cAMP-regulated phosphoprotein, Mr. 32,000) -A Protein Inhibitor of Protein Phosphatase-1",\N
5907,"5907","2004-08-30",\N,"Assignment of 1H, 13C and 15N Resonances of the Human Ku80 C-terminal Domain",\N
5908,"5908","2003-10-06",\N,"Backbone 1HN and 15N Chemical Shift Assignments for Sac7d V30I",\N
5909,"5909","2003-10-06","2009-01-22","Backbone 1HN and 15N Chemical Shift Assignments for Sso7d",\N
5910,"5910","2003-10-06","2005-05-03","Backbone 1HN and 15N Chemical Shift Assignments for Sso7d I30V",\N
5911,"5911","2004-03-07",\N,"NMR Solution Structure of a Peptide from the mdm-2 Binding Domain of the p53 Protein that is Selectively Cytotoxic to Cancer Cells",\N
5912,"5912","2004-05-15",\N,"The 3D solution structure of the C-terminal region of Ku86",\N
5913,"5913","2004-08-30",\N,"NMR SOLUTION STRUCTURE OF CN12, A NOVEL ALPHA-SCORPION TOXIN FROM CENTRUROIDES NOXIUS, SHOWING THE IMPORTANCE OF SURFACE CHARGE DISTRIBUTION FOR NA+-CHANNEL AFINITY.",\N
5914,"5914","2004-03-07",\N,"NMR structure of Methionine-Enkephalin in fast tumbling Bicelles/DMPG",\N
5915,"5915","2004-03-07",\N,"NMR structure of Methionine-Enkephalin in fast tumbling DMPC/DHPC bicelles",\N
5916,"5916","2004-06-25",\N,"How C-Terminal Carboxyamidation Alters the Biological Activity of Peptides from the Venom of the Eumenine Solitary WasP",\N
5917,"5917","2004-02-13",\N,"Backbone 1HN, 13C, 15N Chemical Shift Assignments for human eIF2alpha",\N
5918,"5918","2004-07-23",\N,"Multiple time-scale dynamics of homologous thermophilic and mesophilic ribonuclease HI enzymes",\N
5919,"5919","2003-10-16",\N,"The solution structure of the loop E region of the 5S rRNA from spinach chloroplasts",\N
5920,"5920","2003-12-19",\N,"1H, 13C and 15N backbone and side-chain chemical shift assignments of PrrA effector domain from R. sphaeroides",\N
5921,"5921","2004-02-11",\N,"NMR assignment of TM1442, a putative anti-sigma-factor antagonist from Thrmotoga maritima",\N
5922,"5922","2003-12-19",\N,"Solution Structure of the HERG K+ channel S5-P extracellular linker",\N
5923,"5923","2006-01-12",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for T22G mutant of N-terminal SH3 domain of the Drosophila protein drk",\N
5924,"5924","2004-03-02",\N,"NMR Solution Structure of the Focal Adhesion Targeting Domain (FAT) of Focal Adhesion Kinase (FAK) in Complex with a Paxillin LD Peptide: Evidence for a Two Site Binding Model",\N
5925,"5925","2006-01-12",\N,"Solution structure of the N-terminal SH3 domain of Drk (drkN SH3 domain)",\N
5926,"5926","2003-10-06",\N,"Residual Dipolar Couplings of rubredoxin",\N
5927,"5927","2004-07-23","2010-07-16","NMR Structure of a Cyclic Polyamide-DNA Complex",\N
5928,"5928","2004-04-07",\N,"NMR assignment of the hypothetical ENTH-VHS domain At3g16270 from Arabidopsis thaliana",\N
5929,"5929","2004-04-07",\N,"NMR assignment of the hypothetical rhodanase domain At4g01050 from Arabidopsis thaliana",\N
5930,"5930","2004-04-07",\N,"Backbone 1H, 15N, 13C Resonance Assignment of a-ADT",\N
5931,"5931","2004-04-07",\N,"Dynamics of the RNase H Domain of HIV-1 Reverse Transcriptase in the Presence of Magnesium and AMP",\N
5932,"5932","2003-12-19",\N,"YNMG tetraloop formation by a dyskeratosis congenita mutation in human telomerase RNA",\N
5933,"5933","2005-03-01",\N,"Sequence-specific backbone and sidechain resonance assignments of the Ste50 binding domain of the MAPKKK Ste11",\N
5934,"5934","2003-10-16",\N,"13C and 15N Chemical Shift Assignments for f-MLF-OH",\N
5935,"5935","2003-10-06",\N,"Sequence-specific 1H, 13C and 15N resonance assignments of rat liver fructose-2,6-bisphosphatase domain",\N
5936,"5936","2004-04-07",\N,"Backbone 1H, 15N, 13C Resonance Assignment of b-ADT",\N
5937,"5937","2003-12-19",\N,"1H, 13C and 15N Chemical Sift Assignments for PDZ2b domain of PTP-Bas (hPTP1E)",\N
5938,"5938","2003-10-16",\N,"Proton chemical shift assignments for CP-11",\N
5939,"5939","2005-03-01","2007-04-20","Backbone and sidechain assignment of murine Spred2 EVH1 domain",\N
5940,"5940","2004-02-13",\N,"1H, 15N and 13C backbone assignment of the carboxyl terminal domain of the cytokine binding module of the interleukin-6 receptor (IL-6R)",\N
5941,"5941","2003-10-06","2005-05-03","Proton chemical shift assignments for cycloCP-11",\N
5942,"5942","2004-04-07",\N,"1H, 13C, 15N chemical shift assignment of hypothetical protein hi0004 from Haemophilus Influenzae",\N
5943,"5943","2004-09-30",\N,"Letter to the Editor: 1H, 15N and 13C Resonance Assignments and Secondary Structure Determination of the D2 Domain of the Human Acidic Fibroblast Growth Factor Receptor",\N
5944,"5944","2003-12-19",\N,"A Zinc Clasp Structure Tethers Lck to T Cell Coreceptors CD4 and CD8",\N
5945,"5945","2003-12-19",\N,"A Zinc Clasp Structure Tethers Lck to T Cell Coreceptors CD4 and CD8",\N
5946,"5946","2004-07-06",\N,"Complete Resonance assignments of a donor-strand complemented AfaD: the afimbrial invasin from Diffusely Adherent E. coli",\N
5947,"5947","2004-07-06",\N,"Complete resonance assignments of a 'donor strand complemented' AfaE-III: the afimbrial adhesin from Diffusely Adherent E. coli",\N
5948,"5948","2006-01-12",\N,"Structure Analysis of Integrin alpha IIb beta 3 - Specific Disintegrin with the AKGDWN Motif",\N
5949,"5949","2006-01-12",\N,"Structure Analysis of Integrin alpha IIb beta 3 - Specific Disintegrin with the AKGDWN Motif",\N
5950,"5950","2005-05-23",\N,"1H, 15N and 13C resonance assignment for the Escherichia coli cell division activator CedA",\N
5951,"5951","2005-10-24",\N,"1H and 15N chemical shift assignment and secondary structure of human saposin C",\N
5952,"5952","2004-11-29",\N,"1H, 13C and 15N Chemical Shift Assignments for HPV-16 E2C",\N
5953,"5953","2003-12-05","2005-07-27","Sequential Resonance Assignments of the Extracellular Domain of the Human TGFB type II Receptor in Complex with Monomeric TGFB3",\N
5954,"5954","2003-12-05","2005-07-27","Sequential Resonance Assignments of the Extracellular Domain of the Human TGFB type II Receptor in Complex woth Monomeric TGFB3",\N
5955,"5955","2003-12-19",\N,"Backbone and sidechain assignment of human VASP EVH2 domain",\N
5956,"5956","2003-10-16","2005-05-03","NMR solution structure of Max in absence of DNA: Insight into the mechanism of DNA recognition by B-HLH-LZ transcription factors",\N
5958,"5958","2004-07-06",\N,"1H, 13C and 15N resonance assignments of human microtubule-associated protein light chain-3",\N
5959,"5959","2004-09-30",\N,"Structure of human Ki67 FHA domain and its binding to a phosphoprotein fragment from hNIFK reveal unique recognition sites and new views to the structural basis of FHA domain functions",\N
5960,"5960","2004-02-13","2007-03-23","1H, 13C, 15N- Chemical Shift Assignments for Myristoylated HIV-1 Matrix Protein",\N
5961,"5961","2007-03-22",\N,"Binding site structure of one LRP/RAP complex - implications for a common ligand/receptor binding motif",\N
5962,"5962","2004-03-07",\N,"Chemical shifts assignments of domain 5 of the ai5gamma group II intron",\N
5963,"5963","2004-04-07",\N,"1H, 13C, 15N resonance assignment of hypothetical protein hi1723 from Haemophilus Influenzae",\N
5964,"5964","2004-07-30",\N,"Solution structures of the C-terminal headpiece subdomains of human villin and advillin, evaluation of headpiece F-actin binding requirements",\N
5965,"5965","2004-07-30",\N,"Solution structures of the C-terminal headpiece subdomains of human villin and advillin, evaluation of headpiece F-actin binding requirements",\N
5966,"5966","2004-07-30",\N,"Solution structures of the C-terminal headpiece subdomains of human villin and advillin, evaluation of headpiece F-actin binding requirements",\N
5967,"5967","2004-05-15",\N,"Solution structure of the mature HIV-1 protease monomer",\N
5968,"5968","2004-02-12",\N,"NMR structure of the human dematin headpiece domain",\N
5969,"5969","2004-10-10","2005-05-03","Solution Structure of holo-Neocarzinostatin",\N
5970,"5970","2004-02-13",\N,"Solution Structure of Ribosomal Protein L18 from Bacillus stearothermophilus",\N
5971,"5971","2004-07-28",\N,"Letter to the Editor: Backbone and side chain resonance assignments of domain III of tick-borne Langat flavivirus Envelope protein",\N
5972,"5972","2003-12-19",\N,"Proton Chemical Shifts for E coli ProP 468-497 peptide",\N
5973,"5973","2004-04-07",\N,"Solution Structure of Dengue Virus Capsid Protein Reveals a New Fold",\N
5974,"5974","2004-04-07",\N,"Assignment of the 1H, 13C and 15N resonances of the catalytic domain of guanine nucleotide exchange factor BopE from Burkholderia pseudomallei",\N
5975,"5975","2003-12-08",\N,"1H and 15N chemical shift assignments for the N-domain of trout cardiac troponin C at 30 and 7 C",\N
5976,"5976","2004-07-06",\N,"1H-, 13C- and 15N-NMR assignment of the conserved hypothetical protein TM0487 from Thermotoga maritima",\N
5977,"5977","2004-07-30",\N,"NMR for Structural Proteomics of Thermotoga maritima: Screening and Sructure Determination",\N
5978,"5978","2004-07-30","2005-02-18","Structure and function of the membrane domain of hepatitis C virus nonstructural protein 5A",\N
5979,"5979","2005-01-20","2010-07-16","A parallel stranded DNA duplex with an A-G mismatch base-pair",\N
5980,"5980","2004-11-08",\N,"Structure Function Analysis of the Stemp Loop IIIc of HCV and GBV-B IRES",\N
5981,"5981","2006-01-19",\N,"1H, 15N and 13C resonance assignments of human dihydrofolate reductase in its complex with trimethoprim and NADPH",\N
5982,"5982","2004-07-06",\N,"Complete 1H, 13C and 15N assignments of a monomeric, biologically active apolipoprotein E carboxyl-terminal domain",\N
5983,"5983","2004-07-28",\N,"1H, 13C and 15N resonance assignments of human 5-10-methenyltetrahydrofolate synthetase",\N
5984,"5984","2004-05-15",\N,"1H and 15N chemical shift assignments for FtsN 243-319",\N
5985,"5985","2004-06-29",\N,"Solution Conformation of alpha-Conotoxin GIC, a Novel Potent Antagonist of alpha3beta2 Nicotinic Acetylcholine Receptors",\N
5986,"5986","2004-09-30",\N,"Solution structure of paralytic peptide of the wild Silkmoth, Antheraea yamamai",\N
5987,"5987","2004-02-13",\N,"Interaction of the TAZ1 domain of CREB-binding protein with the activation domain of CITED2: Regulation by competition between intrinsically unstructured ligands for non-identical binding sites",\N
5988,"5988","2003-12-19","2005-11-07","1H Chemical Shift Assignments of alpha-bungarotoxin/nicotinic acetilcholine receptor mimotope complex",\N
5989,"5989","2005-05-20",\N,"Cytotoxin I from the venom of the Central Asian cobra Naja Oxiana, in aqueous solution",\N
5991,"5991","2005-04-26",\N,"Backbone and Sidechain 1H, 13C, and 15N Chemical Shift Assignments and Backbone 15N Relaxation Parameters for Murine Ets-1 deltaN301",\N
5992,"5992","2004-05-15",\N,"1H, 13C and 15N resonance assignment and secondary structure of the C-terminal domain of the human centrin 2 in complex with a 17 residue peptide from Xeroderma Pigmentosum group C protein",\N
5993,"5993","2005-03-01",\N,"1H shifts for the DNA duplex containing 5-hydroxy Uracil lesion",\N
5994,"5994","2004-10-29",\N,"Solution structure of Human Orexin-A:Regulator of Appetite and Wakefulness",\N
5995,"5995","2004-04-07",\N,"Temperature Dependent Spectral Density Analysis Applied to Monitoring Backbone Dynamics of Major Urinary Protein-I Complexed with the Pheromone 2-sec-Butyl-4,5-dihyrothiazole",\N
5996,"5996","2004-04-07",\N,"Temperature Dependent Spectral Density Analysis Applied to Monitoring Backbone Dynamics of Major Urinary Protein-I Complexed with the Pheromone 2-sec-Butyl-4,5-dihyrothiazole",\N
5997,"5997","2004-02-10",\N,"Improving the Accuracy of NMR Structures of Large Proteins Using Pseudocontact Shifts as Long-range Restraints",\N
5998,"5998","2004-07-06",\N,"1H, 15N and 13C resonance assignments of the ApaG/CorD protein of the phytopathogen Xanthomonas axonopodis pv. citri",\N
5999,"5999","2004-06-30",\N,"NMR Assignments of the Drosophila Argonaute 2 Paz domain",\N
6000,"6000","2005-01-20",\N,"1H, 13C and 15N Resonance Assignments of the Drosophila Argonaute1 PAZ Domain",\N
6001,"6001","2004-04-07",\N,"1H, 15N and 13C resonance assignments of the C345C domain of the complement component C5",\N
6002,"6002","2007-03-22",\N,"Structure of the C-terminal domain of p63",\N
6003,"6003","2004-07-06",\N,"Complete Resonance Assignments of Bundlin (BfpA) from the Bundle- forming Pilus of Enteropathogenic Escherichia coli",\N
6004,"6004","2004-11-15",\N,"1H, 13C, 15N assignments of human Cofilin",\N
6005,"6005","2004-05-15","2005-11-14","Structural Basis for Recognition of the mRNA Class II AU-Rich Element by the Tandem Zinc Finger Domain of TIS11d",\N
6006,"6006","2004-11-15","2011-06-16","1H Chemical Shift Assignments for CCAP from the fruit fly Drosophila melanogaster",\N
6007,"6007","2004-07-08",\N,"1H, 13C and 15N resonance assignment of the Plasminogen Kringle 4 Binding Calcium Free Form of the C-type Lectin-like Domain of Tetranectin",\N
6008,"6008","2004-07-08",\N,"1H, 13C and 15N resonance assignment of the Calcium Bound Form of the C-type Lectin-like Domain of Tetranectin",\N
6009,"6009","2004-08-30",\N,"NMR structure of the thrombin-binding DNA aptamer stabilized by Sr2+",\N
6010,"6010","2005-03-01","2005-04-12","High-Resolution NMR Structure of the Conserved Hypothetical Protein TM0979 from Thermotoga maritima",\N
6011,"6011","2003-12-19","2009-07-09","Solution structure of a homodimeric hypothetical protein, At5g22580, a structural genomics target from Arabidopsis Thaliana","/ftp/pub/bmrb/timedomain/bmr6011"
6012,"6012","2004-05-15",\N,"Human Sgt1 binds to HSP90 through the CS domain and not the TPR domain",\N
6013,"6013","2004-07-29",\N,"1H, 13C and 15N resonance assignments of the third spectrin repeat of alpha-actinin-4",\N
6014,"6014","2004-07-29","2005-11-21","1H, 13C and 15N backbone resonance assignments of matrilysin (mmp7) complexed with a hydroxamic acid inhibitor",\N
6015,"6015","2004-07-06",\N,"Sequence specific assignment of C1 domain of human cardiac myosin binding protein C",\N
6016,"6016","2004-07-08",\N,"Backbone resonance assignments of the 45.3 kDa catalytic domain of human BACE1",\N
6017,"6017","2004-06-25",\N,"Study on structure-activity relationship of S100C/A11 protein",\N
6018,"6018","2004-06-25",\N,"Study on structure-activity relationship of S100C/A11 protein",\N
6019,"6019","2004-06-25","2010-11-17","Solution structure of Archaeon DNA-binding protein ssh10b P62A mutant",\N
6020,"6020","2003-12-19","2005-04-12","Structure-activity relationships for the beta-hairpin cationic antimicrobial peptide polyphemusin I",\N
6021,"6021","2004-07-06",\N,"Backbone 1H, 15N and 13C assignments for the subunit a of the E.coli ATP Synthase",\N
6022,"6022","2004-02-13",\N,"Second Metal Binding Domain of the Menkes ATPase",\N
6023,"6023","2004-12-01",\N,"1H, 15N, and 13C Resonance Assignments of Calmodulin Complexed with the Calmodulin-Binding Domain of Protein Phosphatase 2B",\N
6024,"6024","2004-07-06","2009-07-02","1H, 13C and 15N backbone resonance assignment for TEM-1, a 28.9 kDa beta-lactamase from E. coli",\N
6025,"6025","2004-03-07",\N,"1H, 13C, 15N resonance assignments of the cytokine LECT2",\N
6026,"6026","2004-07-30",\N,"Chemical Shift Assignments for Oxidized Human Ferredoxin",\N
6027,"6027","2004-02-11",\N,"NMR Solution Structure of PIIIA toxin, NMR, 20 structures",\N
6028,"6028","2004-05-15",\N,"Northeast Structural Genomics Consortium Target TT802 Ontario Center for Structural Proteomics Target Mth0803 assignment of ribosomal protein S17E",\N
6029,"6029","2004-07-06",\N,"1H, 13C and 15N resonance assignment of the nucleotide binding domain of KdpB from Escherichia coli",\N
6030,"6030","2004-07-06",\N,"1H, 13C and 15N resonance assignment of the nucleotide binding domain of KdpB from Escherichia coli",\N
6031,"6031","2004-07-06",\N,"1H, 13C, and 15N resonance assignments of human Notch-1 calcium binding EGF domains 11-13",\N
6032,"6032","2004-10-10","2005-04-12","Complete 1H, 13C and 15N resonance assignments of coactosin, a cytoskeletal regulatory protein",\N
6033,"6033","2004-02-12",\N,"NMR characterisation shows that a b-type variant of Hydrogenobacter thermophilus cytochrome c552 retains its native fold",\N
6034,"6034","2004-06-25",\N,"1H, 15N, 13C resonance assignments and 15N-1H residual dipolar couplings in 27 kDa alpha-adaptin ear-domain",\N
6035,"6035","2004-10-29",\N,"1H, 13C and 15N assignments for human DNA ligase III 1-117",\N
6037,"6037","2005-02-21",\N,"Solution Structure of BmKX, a novel potassium channel blocker from the Chinese Scorpion Buthus martensi Karsch",\N
6038,"6038","2004-04-06",\N,"NMR Structure of CXC Chemokine CXCL11/ITAC",\N
6039,"6039","2004-04-07","2005-11-21","NMR Structure of a D,L-Alternating Dodecamer of Norleucine",\N
6040,"6040","2005-01-14",\N,"SP-B C-terminal peptide in SDS micelles",\N
6041,"6041","2005-09-09",\N,"Structure of the antimicrobial hexapeptide cyc-(RRWWRF) bound to DPC and SDS micelles",\N
6042,"6042","2004-11-30",\N,"NMR structure of the 30mer stemloop-D of coxsackieviral RNA",\N
6043,"6043","2004-07-29",\N,"1H, 13C and 15N resonance assignment of Cu(I)-Pseudoazurin from Alcaligenes faecalis S-6",\N
6044,"6044","2004-06-30",\N,"Resonance assignment and secondary structure of the La motif",\N
6045,"6045","2006-04-06",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for Hypothetical protein PF0455",\N
6046,"6046","2004-07-06",\N,"1H, 13C and 15N resonance assignments for domain III of the West Nile Virus envelope protein",\N
6047,"6047","2004-07-23",\N,"1H, 15N, and 13C resonance assignment of the 23 kDa organomercurial lyase MerB in the free form",\N
6048,"6048","2005-06-02",\N,"NEW STRUCTURAL FAMILY OF AN ANTIMICROBIAL PEPTIDE DERIVED FROM BOVINE HEMOGLOBIN",\N
6049,"6049","2004-07-30",\N,"Solution Structure of Human alpha-Parvalbumin (Minimized Average Structure)",\N
6050,"6050","2007-03-22","2007-11-05","Solution structure of Sso7d mutant (K12L), NMR, 4 structures",\N
6051,"6051","2004-11-29",\N,"1H, 13C and 15N resonance assignments for methionine sulfoxide reductase B from Neisseria gonorroeae",\N
6052,"6052","2004-09-30","2009-07-09","Backbone and side chain 1H, 13C, and 15N chemical shift assignments for Haemophilus human protein HR969","/ftp/pub/bmrb/timedomain/bmr6052"
6053,"6053","2004-07-06",\N,"1H, 13C and 15N resonance assignments of the N-terminal 16kDa domain of Escherichia coli Ada Protein",\N
6054,"6054","2004-07-06",\N,"1H, 13C and 15N resonance assignments of the methylated N-terminal 16kDa domain of Escherichia coli Ada Protein",\N
6055,"6055","2004-07-06",\N,"1H, 13C, and 15N resonance assignment of the 23 kDa organomercurial lyase in its free and mercury-bound forms",\N
6056,"6056","2004-05-15",\N,"Yeast oligosaccharyltransferase subunit Ost4p",\N
6057,"6057","2004-06-29",\N,"Sequence-specific resonance assignments of the tandem SH3 domains in autoinhibitory form of p47phox",\N
6058,"6058","2004-10-01",\N,"1H, 13C and 15N Assignments for the Hypothetical Archaeglobus fulgidis protein AF2095. Northeast Structural Genomics Consortium target GR4",\N
6059,"6059","2006-01-23","2008-07-01","Ras-induced losing of interaction between C1 and RBD domains of Nore1",\N
6060,"6060","2005-05-20",\N,"1H, 13C, and 15N Chemical Shift Assignments for a complex of PDZ2 from PTP-BL with the C-terminus of APC (adenomatous polyposis coli)",\N
6061,"6061","2004-10-29",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for the N-terminal 69 Amino Acid Residues of the ColE9 T1-61-DNase Fusion Protein",\N
6062,"6062","2004-10-29","2015-03-18","Assignments for the Negative Regulator of Splicing from Rous Sarcoma Virus residues 907 to 929",\N
6063,"6063","2004-08-30","2005-11-10","E6-binding zinc finger (E6apc2)",\N
6064,"6064","2004-08-30",\N,"E6-binding zinc finger (E6apc1)",\N
6066,"6066","2004-08-31",\N,"Structure-Activity Relationships in a Sodium Channels Inhibitor Hainantoxin-Iv",\N
6067,"6067","2004-08-31",\N,"Structure-Activity Relationships in a Sodium Channels Inhibitor Hainantoxin-Iv",\N
6068,"6068","2004-08-31",\N,"Solution structure of porcine peptide YY (pPYY) in solution and bound to DPC micelles",\N
6069,"6069","2004-06-30",\N,"Chemical Shift Assignments for Precarnobacteriocin B2",\N
6070,"6070","2004-04-09",\N,"Solution Structure of Endothelin-1 with its C-terminal Folding",\N
6071,"6071","2004-07-06",\N,"1H, 13C and 15N Resonance Assignments and Secondary Structure of Human Coactosin Like Protein D123N",\N
6072,"6072","2004-08-05",\N,"Solution structure of human p53 binding domain of PIAS-1",\N
6073,"6073","2005-08-18",\N,"A functional SOD-like protein in Bacillus subtilis",\N
6074,"6074","2004-07-06",\N,"Backbone 1H, 13C and 15N resonance assignments for the 29kD Pseudomonas aeruginosa dimethylarginine dimethylaminohydrolase involved in nitric oxide synthase regulation",\N
6075,"6075","2004-07-06",\N,"Backbone and side chain assignment of arsenate reductase from Bacillus Subtilis",\N
6076,"6076","2004-06-30",\N,"Loop B RNAs from the Stem-Loop IV domain of the Enterovirus Internal Ribosome Entry Site with a Six-nucleotide Bulge AUCCCU",\N
6077,"6077","2004-06-30",\N,"Loop B RNAs from the Stem-Loop IV domain of the Enterovirus Internal Ribosome Entry Site with a Six-nucleotide Bulge AUUCCU",\N
6078,"6078","2004-04-09",\N,"IA3, an Aspartic Proteinase Inhibitor for Saccharomyces cerevisiae, Is Intrinsically Unstructured in Solution",\N
6079,"6079","2004-11-29","2005-05-17","1H, 13C and 15N resonance assignment of the reduced form of thioredoxin h1 from Poplar, a plant CPPC active site variant",\N
6080,"6080","2004-07-06","2008-09-17","1H, 15N, 13C resonance assignments of the human protein tyrosine phosphatase PRL-1",\N
6081,"6081","2004-06-25",\N,"1H, 13C and 15N chemical shift assignment of fly troponin C",\N
6082,"6082","2004-06-25",\N,"Structure in solution of SFA8, a Albumin 2S from Sunflower seeds",\N
6083,"6083","2004-03-07",\N,"Specific recognition between surface loop 2 (132-143) and helix 1 (144-154) within sheep prion protein from in vitro studies of synthetic peptides",\N
6084,"6084","2004-07-06",\N,"NMR structure of a variant 434 repressor DNA-binding domain devoid of hydroxyl groups",\N
6085,"6085","2005-02-15","2005-04-12","Solution Structure of hybrid white striped bass hepcidin",\N
6086,"6086","2004-07-29",\N,"1H, 13C and 15N assignments of the tandem WW domains of human MAGI-1/BAP-1",\N
6087,"6087","2005-01-20","2010-08-12","Conformation and Ion-Channeling activity of the hepatitis C virus p7 polypeptide",\N
6088,"6088","2004-08-30",\N,"E6-bind Trp-cage (E6apn1)",\N
6089,"6089","2005-05-26",\N,"1H Chemical Shift Assignments of non-specific Lipid Transfer Protein 1 Isolated from Seeds of Mung Bean",\N
6090,"6090","2004-12-16","2005-05-03","1H, 13C and 15N resonance assignement of the reduced form of methionine sulfoxide reductase A from Escherichia coli",\N
6091,"6091","2005-05-20",\N,"1H, 13C, and 15N Chemical Shift Assignments for a complex of PDZ2 from PTP-BL with the C-terminus of p75 (NTR)",\N
6092,"6092","2005-05-20",\N,"1H, 13C, and 15N Chemical Shift Assignments for a complex of PDZ2 from PTP-BL with the C-terminus of RIL (reversion induced LIM)",\N
6093,"6093","2004-03-15",\N,"SOLUTION STRUCTURE OF THE HYALURONAN BINDING DOMAIN OF HUMAN CD44",\N
6094,"6094","2004-05-15",\N,"NMR structure of the 101 nucleotide core encapsidation signal of the moloney murine leukemia virus",\N
6095,"6095","2004-05-15",\N,"Solution structure of the KIX domain of CBP bound to the transactivation domain of c-Myb",\N
6096,"6096","2004-05-15",\N,"The solution structure of the pH-induced monomer of dynein light chain LC8 from Drosophila",\N
6097,"6097","2004-09-28",\N,"Proton chemical shift assignments for human spliceosomal protein U1C zinc finger domain",\N
6098,"6098","2004-06-25",\N,"Backbone 1H, 13C, and 15N chemical shift assignments for the amino terminal domain of the transcriptional cofactor PC4",\N
6099,"6099","2004-09-28",\N,"Backbone 1H, 13C, and 15N chemical shift assignments for the activation domain of the transcriptional activator VP16",\N
6100,"6100","2004-07-29","2007-10-19","Backbone 1H, 13C and 15N chemical shift assignents of the 18.5kDa isoform of murine myelin basic protein (MBP)",\N
6101,"6101","2004-05-15",\N,"Solution Structure of a D,L-Alternating Oligonorleucine as a Model of Double-Stranded Antiparallel beta-helix",\N
6102,"6102","2005-01-20",\N,"Solution structure of conserved protein YbeD from E. coli",\N
6103,"6103","2005-03-01",\N,"Unexpected structure of the Ca2+-regulatory region from soybean calcium-dependent protein kinase-alpha",\N
6104,"6104","2005-03-01",\N,"Unexpected structure of the Ca2+-regulatory region from soybean calcium-dependent protein kinase-alpha",\N
6105,"6105","2004-05-15",\N,"Conformational and structural analysis of the equilibrium between single and double-strand beta-helix of a D,L-alternating oligonorleucine",\N
6106,"6106","2004-04-06",\N,"NMR structure of cross-reactive peptides from Homo sapiens",\N
6107,"6107","2004-04-06",\N,"NMR structure of cross-reactive peptides from L. braziliensis",\N
6108,"6108","2004-06-30",\N,"Solution structure of GlgS protein from E. coli",\N
6109,"6109","2005-02-23",\N,"Chemical shifts of assigned proton resonances of BmKK4 at 303K and pH=3.66",\N
6110,"6110","2004-09-28",\N,"solution structure of a chimeric LEKTI-domain",\N
6111,"6111","2004-09-30","2005-09-01","1H, 13C and 15N resonance assignments of the antifreeze protein cfAFP-501 from spruce budworm at different temperatures",\N
6112,"6112","2004-05-15",\N,"Backbone 1H, 13C and 15N Chemical Shift Assignments for p27-KID in Solution",\N
6113,"6113","2005-08-29","2005-09-01","1H, 13C and 15N assignment of the second PDZ domain of the neuronal adaptor protein X11alpha",\N
6114,"6114","2005-02-28",\N,"1H, 13C and 15N resonance assignment of the C-terminal BRCT domain from human BRCA1",\N
6115,"6115","2004-09-28",\N,"Structural and Functional Analysis of a picornaviral Internal cis-acting replication element",\N
6116,"6116","2004-10-01",\N,"Backbone 1H, 13C and 15N resonance assignment of the N-terminal domain of human eRF1",\N
6117,"6117","2004-09-28",\N,"1H,13C,15N assignments for ChaB",\N
6118,"6118","2004-05-15",\N,"1H, 13C and 15N assignments of poplar phloem glutaredoxin",\N
6120,"6120","2004-07-23",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for NESG target CcR19",\N
6121,"6121","2004-12-16","2006-05-15","1H, 15N, and 13C chemical shift assignments of CUG binding protein-CUGBP",\N
6122,"6122","2004-09-01",\N,"1H/13C/15N assignment of the S1 domain of RNase E of E. coli",\N
6123,"6123","2004-10-13",\N,"1H chemical shift assignments for truncated hevein of 32 aa bound to N,N',N''-triacetylchitotriose",\N
6125,"6125","2004-12-16",\N,"Letter to the Editor: 1H, 13C, 15N chemical shift assignments of an enolase-phosphatase E1 from Klebsiella oxytoca",\N
6126,"6126","2004-05-15",\N,"NMR Structure of the CRIB-PDZ module of Par-6",\N
6127,"6127","2005-02-15",\N,"Solution structure of the E. coli bacteriophage P1 encoded HOT protein: a homologue of the theta subunit of E. coli DNA polymerase III",\N
6128,"6128","2004-05-15","2009-07-09","Structure of At3g01050.1, a ubiquitin-fold protein from Arabidopsis thaliana","/ftp/pub/bmrb/timedomain/bmr6128"
6129,"6129","2004-05-15",\N,"Solution structure and backbone dynamics of the Cu(I) and apo-forms of the second metal-binding domain of the Menkes protein ATP7A",\N
6130,"6130","2004-05-15",\N,"Solution structure and backbone dynamics of the Cu(I) and apo-forms of the second metal-binding domain of the Menkes protein ATP7A",\N
6131,"6131","2005-03-03",\N,"Solution structure of oxidized bovine microsomal cytochrome B5 Mutant V45H",\N
6132,"6132","2004-09-30",\N,"Letter to the Editor: 1H, 13C and 15N NMR assignment of the homodimeric poplar phloem peroxiredoxin",\N
6133,"6133","2004-09-30",\N,"1H, 13C, and 15N Chemical Shift Assignments for YojN-HPt",\N
6134,"6134","2004-05-15",\N,"THE NMR STRUCTURE OF A STABLE AND COMPACT ALL-beta-SHEET VARIANT OF INTESTINAL FATTY ACID-BINDING PROTEIN",\N
6135,"6135","2004-06-29",\N,"Solution structure of conotoxin MrVIB",\N
6136,"6136","2004-06-25",\N,"Backbone Resonance Assignment of the L-Arabinose Binding Protein in Complex with D-Galactose",\N
6137,"6137","2005-01-24",\N,"NMR solution structure of proBnIb of 2S albumin stortage proton from Brassica napus",\N
6138,"6138","2004-07-26",\N,"Hypothetical protein At2g24940.1 from Arabidopsis thaliana has a cytochrome b5 like fold","/ftp/pub/bmrb/timedomain/bmr6138"
6139,"6139","2004-08-05",\N,"Solution Structure of Ole e 6, an allergen from olive tree pollen",\N
6140,"6140","2004-12-16",\N,"1H, 13C and 15N backbone assignment of a 32 kDa hypothetical protein from Arabidopsis thaliana, At3g16450.1",\N
6141,"6141","2007-08-28",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for Cyclophilin D",\N
6142,"6142","2006-01-12","2008-07-01","1H 13C and 15N resonance assignments for peptide deformylase-actinonin complex",\N
6143,"6143","2005-03-14",\N,"1H and 15N assignments for human apolipoprotein C-II in DPC micelles",\N
6144,"6144","2004-10-13",\N,"The pyrophosphate cage: the structure of the nisin/lipid II complex provides a blueprint for novel antibiotics",\N
6145,"6145","2004-10-15",\N,"The pyrophosphate cage: the structure of the nisin/lipid II complex provides a blueprint for novel antibiotics",\N
6146,"6146","2004-10-15",\N,"The pyrophosphate cage: the structure of the nisin/lipid II complex provides a blueprint for novel antibiotics",\N
6147,"6147","2004-06-25",\N,"1H, 15N, and 13C chemical shift assignments of the Vibrio Harveyi histidine phosphotransferase protein LuxU",\N
6148,"6148","2005-04-08","2006-08-12","Resonance Assignments and Secondary Structure of hPrxVI, a 25 kDa 1-Cys Human Peroxiredoxin Enzyme",\N
6149,"6149","2005-03-15",\N,"1H, 15N and 13C resonance assignments of complement control protein module pair 2-3 from the C4b-binding site of complement receptor type 1",\N
6150,"6150","2004-07-29",\N,"1H, 15N and 13C resonance assignments of the Apo Sm14-M20(C62V) protein from Schistosoma mansoni",\N
6151,"6151","2004-08-31",\N,"Structure of Transportan in phospholipid bicellar solution",\N
6152,"6152","2004-05-15",\N,"Solution structure of TIP-B1",\N
6154,"6154","2004-06-30",\N,"1H Assigned Chemical Shifts for FMBP-1 tandem repeat 3",\N
6155,"6155","2004-06-30",\N,"1H Assigned Chemical Shifts for FMBP-1 tandem repeat 4",\N
6156,"6156","2004-06-30",\N,"1H Assigned Chemical Shifts for FMBP-1 tandem repeat 1 in 30% (v/v) TFE and water solution",\N
6157,"6157","2004-06-30",\N,"1H Assigned Chemical Shifts for FMBP-1 tandem repeat 2",\N
6158,"6158","2005-02-21",\N,"NMR solution structure of human Saposin C in the presence of detergent micelles",\N
6159,"6159","2004-12-16",\N,"1H, 13C and 15N resonance assignments of Ca2+-free DdCAD-1, a cell-cell adhesion molecule",\N
6160,"6160","2004-06-29",\N,"Structural and biochemical evidence for disulfide bond heterogeneity in active forms of the somatomedin B domain of human vitronectin",\N
6161,"6161","2004-06-30","2005-02-15","Full 1H, 13C and 15N Chemical Shift Assignments for the GI Domain of the yeast Linker Histone, Hho1p",\N
6162,"6162","2004-06-30","2005-02-15","Full 1H, 13C and 15N Chemical Shift Assignments for the GII Domain of the yeast Linker Histone, Hho1p",\N
6163,"6163","2004-12-16",\N,"Backbone 1H, 13C, 15N assignment of the bHLHZip domain of the oncogenic transcription factor v-myc in complex with its authentic binding partner max",\N
6165,"6165","2004-11-08",\N,"Solution structure of the PSI domain from the Met receptor",\N
6166,"6166","2004-09-07","2005-02-18","Solution structure of the second complement control protein (CCP) module of the GABA(B)R1a receptor, Pro-119 cis conformer",\N
6167,"6167","2004-06-25",\N,"Structural studies on the Ca-binding domain of human nucleobindin (CALNUC)",\N
6168,"6168","2005-09-09",\N,"Structures of antimicrobial hexapeptides bound to DPC micelles",\N
6169,"6169","2005-09-09",\N,"Structures of antimicrobial hexapeptides bound to DPC micelles",\N
6170,"6170","2005-09-09",\N,"Structures of antimicrobial hexapeptides bound to DPC micelles",\N
6171,"6171","2004-09-07","2005-02-18","Solution structure of the second complement control protein (CCP) module of the GABA(B)R1a receptor, Pro-119 trans conformer",\N
6172,"6172","2004-06-29",\N,"Solution structure of a cyanobacterial copper metallochaperone, ScAtx1",\N
6173,"6173","2006-02-26","2009-07-09","PfR48 final project","/ftp/pub/bmrb/timedomain/bmr6173"
6174,"6174","2004-09-07",\N,"Backbone and sidechain 1H, 13C and 15N chemical shift assignments of the ThKaiA180C-CIIABD complex",\N
6175,"6175","2006-01-18","2007-11-05","1H, 13C, and 15N assignments for the first TSR domain of F-spondin",\N
6176,"6176","2004-06-25","2009-07-08","Solution structure of a ubiquitin-like domain of tubulin-folding cofactor B","/ftp/pub/bmrb/timedomain/bmr6176"
6177,"6177","2004-11-08",\N,"N-terminal Domain of the Polypyrimidine Tract Binding Protein Contains a New RRM Variant That Contributes to High-Affinity RNA Binding",\N
6178,"6178","2004-11-08",\N,"N-terminal Domain of the Polypyrimidine Tract Binding Protein Contains a New RRM Variant That Contributes to High-Affinity RNA Binding",\N
6179,"6179","2005-05-17",\N,"Solution Structure of the structured part of the 15th domain of LEKTI",\N
6180,"6180","2005-05-17",\N,"Solution structure of the 15th domain of LEKTI",\N
6181,"6181","2005-02-18",\N,"Resonance Assignments for the Endosomal Adaptor Protein P14",\N
6182,"6182","2007-08-27",\N,"Backbone assignments and 15N spin-relaxation rates of Holo-FluA(R95K)",\N
6183,"6183","2005-04-20",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for cAMP-dependent protein kinase",\N
6184,"6184","2004-06-25",\N,"Model for the Catalytic Domain of the Proofreading Epsilon Subunit of E.coli DNA Polymerase III Based on NMR Structural Data",\N
6185,"6185","2004-06-30","2012-11-08","Solution structure of P22 Cro",\N
6186,"6186","2004-11-08","2010-07-20","Structure of DNA sequence d-TGATCA by two-dimensional nuclear magnetic resonance spec and restrained molecular dynamics",\N
6187,"6187","2004-06-25","2011-10-12","BACKBONE SOLUTION STRUCTURE OF MIXED ALPHA/BETA PROTEIN PF1061",\N
6188,"6188","2005-02-21","2005-03-15","Solution structure of Acyl Coenzyme A Binding Protein from yeast",\N
6189,"6189","2004-11-08",\N,"Solution structure of SEP domain from human p47",\N
6190,"6190","2004-06-30",\N,"Solution Structure of apoCox11",\N
6191,"6191","2004-09-07",\N,"Structure of the C-Terminal Domain of the SecA ATPase",\N
6192,"6192","2004-06-30",\N,"1H, 13C, and 15N Chemical Shift Assignments for Omega-atracotoxin-Hv1a at pH 3.6",\N
6193,"6193","2004-10-01",\N,"1H, 13C, 15N PSD-95 PDZ3 NMR Assignments, pH 7, 20C",\N
6194,"6194","2004-06-25",\N,"1H, 13C, and 15N Chemical Shift Assignments for Omega-atracotoxin-Hv1a at pH 6.0",\N
6195,"6195","2004-09-07",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for Arath;CDC25; a dual-specificity tyrosine phosphatase from Arabidopsis thaliana",\N
6196,"6196","2004-09-07",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for Arath;CDC25; a dual-specificity tyrosine phosphatase from Arabidopsis thaliana",\N
6197,"6197","2004-11-08",\N,"1H, 15N and 13C assigned chemical shifts for the Myosin type I SH3 domain (Myo3) from saccharomyces cerevisiae",\N
6198,"6198",\N,\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for TM1816",\N
6199,"6199","2007-08-24",\N,"Backbone and side chain 1H, 13C, and 15N chemical shift assignments for 5,10-methenyltetrahydrofolate synthetase",\N
6200,"6200","2004-09-07",\N,"Assignment of the minicollagen 1 cysteine rich domain",\N
6201,"6201","2005-02-16","2005-03-15","Sequence specific 1H and 15N resonance assignment of domain 1 of rat CD2 with the designed calcium binding site",\N
6202,"6202","2004-09-07",\N,"Assignment of the 1H, 15N and 13C resonances of the Class II E2 Conjugating Enzyme, Ubc1",\N
6203,"6203","2004-08-06",\N,"1H chemical shift assignments for ThrB12-DKP-insulin",\N
6204,"6204","2004-08-06",\N,"1H chemical shift assignments for AlaB12-DKP-insulin",\N
6205,"6205","2004-08-06",\N,"1H chemical shift assignments for AbaB12-DKP-insulin",\N
6207,"6207","2008-08-29",\N,"The NMR Solution structure of the NESGC taget protein EC0510",\N
6208,"6208","2006-01-11",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for Diacylglycerol kinase alpha",\N
6209,"6209","2004-06-30","2005-01-07","Solution Structure of a Calmodulin-Like Calcium-Binding Domain from Arabidopsis thaliana","/ftp/pub/bmrb/timedomain/bmr6209"
6210,"6210","2007-08-29",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for NESGC target hr2106",\N
6211,"6211","2004-11-12",\N,"Chemical Shift Assignments for Carnobacteriocin B2 immunity protein",\N
6212,"6212","2004-09-07",\N,"Solution structure of subunit F6 from the peripheral stalk region of ATP synthase from bovine heart mitochondria",\N
6214,"6214","2004-06-25",\N,"Signal assignments and chemical-shift structural analysis of uniformly 13C, 15N-labeled peptide, mastoparan-X, by multidimensional solid-state NMR under magic-angle spinning",\N
6216,"6216","2005-02-08",\N,"Solution structure of the third zinc finger domain of FOG-1",\N
6217,"6217","2005-02-08",\N,"Antibiotic Activity and Structural Analysis of a Scorpion-derived Antimicrobial peptide IsCT and Its Analogs",\N
6218,"6218","2005-02-08",\N,"Antibiotic Activity and Structural Analysis of a Scorpion-derived Antimicrobial peptide IsCT and Its Analogs",\N
6219,"6219","2005-02-08",\N,"Antibiotic Activity and Structural Analysis of a Scorpion-derived Antimicrobial peptide IsCT and Its Analogs",\N
6220,"6220","2005-02-08",\N,"Antibiotic Activity and Structural Analysis of a Scorpion-derived Antimicrobial peptide IsCT and Its Analogs",\N
6221,"6221","2005-02-18",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments of the Resuscitation Promoting Factor (Rpf) domain of M. tuberculosis",\N
6222,"6222","2006-01-18",\N,"Solution Structure of Kurtoxin",\N
6223,"6223","2007-03-22",\N,"Sequential resonance assignment of yeast cytosine deaminase in complex with a transition state analogue",\N
6224,"6224","2004-12-16",\N,"Assignment of the 1H, 15N and 13C resonances of SufA from E. coli",\N
6225,"6225","2005-03-18",\N,"1H, 15N, and 13C Resonance Assignment of the Amino-terminal Domain of Tfb1 subunit of yeast TFIIH",\N
6226,"6226","2004-12-16","2011-06-16","1H, 13C, and 15N Chemical Shift Assignments for the C-terminal domain of EW29",\N
6227,"6227","2004-12-15",\N,"Native and non-native conformational preferences in the urea-unfolded state of barstar",\N
6228,"6228","2005-03-17","2009-11-30","The Solution Structure of the FATC Domain of the Protein Kinase TOR Suggest a Redox Regulatory Mechanism",\N
6229,"6229","2004-10-01","2005-11-14","Backbone 1H, 13C, and 15N Chemical Shift assignments for the Nucleotide-binding domain of Thermus Thermophilus DnaK",\N
6230,"6230","2004-09-01",\N,"1H Chemical Shift Assignments for the cyanomet complex of the isolated, tetrameric beta-chain from human adult hemoglobin",\N
6231,"6231","2004-12-16",\N,"1H, 13C and 15N resonance assignments and secondary structure of human pancreatitis-associated protein (hPAP)",\N
6232,"6232","2007-03-22",\N,"TM1442-PO4",\N
6233,"6233","2004-11-29","2005-04-04","(poly)ubiquitin-binding region of S5a",\N
6234,"6234","2004-07-23",\N,"Chemical shifts of PagP in CYFOS-7 detergent",\N
6235,"6235","2005-03-07",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for the SNARE complex",\N
6236,"6236","2004-09-01",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for CAPPD*, an Independently Folded Extracellular Domain of Human Amyloid-beta Precursor Protein",\N
6237,"6237","2007-08-24",\N,"Solution Structure of alpha-Conotoxin OmIA",\N
6238,"6238","2004-11-12",\N,"Complete 1H, 15N amd 13C Chemical Shift Assignments of the murine CBP ZZ domain (a.a. 1700-1751)",\N
6239,"6239","2004-09-20",\N,"Chemical shifts assignments for stem-loop VI of the VS ribozyme.",\N
6240,"6240","2004-07-23","2009-07-08","Solution structure of At5g66040, a putative protein from Arabidopsis Thaliana","/ftp/pub/bmrb/timedomain/bmr6240"
6241,"6241","2005-01-07",\N,"Assignment of the 1H, 13C, and 15N resonances of the josephin domain of ataxin-3",\N
6242,"6242","2004-12-16",\N,"1H, 13C and 15N sequence-specific resonance assignments of the two-domain Thrombin inhibitor Dipetalin",\N
6243,"6243","2004-09-20",\N,"NMR Relaxation data for Protein Azurin from Pseudomonas aeruginosa",\N
6244,"6244","2004-08-04",\N,"Novel all alpha-helical fold for gene target gi3844938 from Mycoplasma genitalium",\N
6245,"6245","2005-03-15",\N,"Solution Structure of GIP(1-30)amide in TFE/Water",\N
6246,"6246","2004-09-20",\N,"Structural transitions as determinants of the action of the calcium-dependent antibiotic daptomycin",\N
6247,"6247","2005-10-20",\N,"Solution structure of C-terminal domain of NifU-like protein from Oryza sativa",\N
6248,"6248","2004-11-29",\N,"NMR Structure of a Complex Between MDM2 and a Small Molecule Inhibitor",\N
6249,"6249","2005-02-08",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for BD37",\N
6250,"6250","2004-08-03",\N,"Backbone Chemical Shift Assignments for G88W121 fragment of Staphylococcal Nuclease",\N
6251,"6251","2004-08-03",\N,"Backbone Chemical Shift Assignments for V66W121 fragment of Staphylococcal Nuclease",\N
6252,"6252","2004-08-03",\N,"1H, 13C, 15N Resonance Assignments of the EscJ Protein, a Structural Component of the Type III Secretion System of Enteropathogenic E. coli (EPEC)",\N
6253,"6253","2004-12-16",\N,"1H, 13C and 15N resonance assignment of human gamma S-crystallin, a 21-kDa eye-lens protein",\N
6254,"6254","2005-01-14",\N,"1H, 13C, and 15N Chemical Shift Assignments for I14A mutant of histidine-containing phosphocarrier protein from Staphylococcus carnosus",\N
6255,"6255","2004-12-06",\N,"Chemical Shift Assignments of Ribosomal Protein L16 from Thermus thermophilus HB8",\N
6256,"6256","2005-01-03","2005-08-22","Chemical Shift Assignments of TM1509",\N
6257,"6257","2005-02-08","2005-02-10","Alzheimer's Abeta40 Studied by NMR at Low pH Reveals That DSS Binds and Promotes beta-ball Oligomerization",\N
6258,"6258","2005-02-21",\N,"Backbone 1H, 13C, 15N and Cb chemical shift assignments for TolAIII in complex with g3pN1",\N
6259,"6259","2006-10-02",\N,"1H, 13C, and 15N chemical shift assignments for GatB (backbone + side chains)",\N
6260,"6260","2004-07-26",\N,"NMR solution Structure of a Highly Stable de novo Heterodimeric Coiled-Coil",\N
6261,"6261","2005-10-17",\N,"NMR STRUCTURE OF THE SH3 DOMAIN OF HUMAN LYN TYROSINE KINASE",\N
6262,"6262","2004-09-20",\N,"NMR structure of WW domains (WW3-4) from Suppressor of Deltex",\N
6263,"6263","2005-03-15",\N,"Solution Structure of a Loop Truncated Mutant from D. gigas Rubredoxin, NMR",\N
6264,"6264","2005-02-08",\N,"Solution structure of cryptdin-4, the most potent alpha-defensin from mouse Paneth cells",\N
6265,"6265","2005-02-08",\N,"Structure and Biochemical Function of a Prototypical Arabidopsis U-box Domain",\N
6266,"6266","2005-02-08",\N,"Solution structure of Cu(I) HAH1",\N
6267,"6267","2005-01-07",\N,"1H, 13C and 15N resonance assignments of the phosphorylated enzyme IIB (C31S) of the mannitol-specific phosphoenolpyruvate-dependent phosphotransferase system of Escherichia coli",\N
6268,"6268","2005-02-21",\N,"CBP TAZ1 Domain",\N
6269,"6269","2004-10-18",\N,"1H, 13C, and 15N Chemical Shift Assignments for chPrP(128-242)",\N
6270,"6270","2004-10-18",\N,"1H, 13C, and 15N Chemical Shift Assignments for chPrP(25-242)",\N
6271,"6271","2007-08-24",\N,"1H, 13C and 15N assignments of the ligand binding domain of LasR",\N
6272,"6272","2005-01-07","2005-10-28","NMR ASSIGNMENT OF MTH0776 FROM METHANOBACTERIUM THERMOAUTOTROPHICUM STRAIN H",\N
6273,"6273","2004-12-14","2010-07-19","1H and 31P chemical shift assignments for the triloop DNA hairpin 5'- GTTCACAGAAC - 3'",\N
6274,"6274","2004-12-14","2010-07-19","1H chemical shift assignments for the triloop DNA hairpin 5'- GTACACAGTAC - 3'",\N
6275,"6275","2005-06-03","2005-07-25","1H, 13C and 15N resonance assignments for the six-zinc finger domain of the MTF-1 metalloregulatory protein in the free state",\N
6276,"6276","2005-07-25","2010-07-16","1H, 13C and 15N resonance assignments for the six-zinc finger domain of the MTF-1 metalloregulatory protein in the DNA bound state",\N
6277,"6277","2005-02-21",\N,"NMR solution structure of the ubiquitin conjugating enzyme UbcH5B",\N
6278,"6278","2004-09-28",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for yeast Sed5p",\N
6279,"6279","2004-11-08","2005-03-18","1H, 13C and 15N resonance assignments and secondary structure of the murine angiogenin 4",\N
6280,"6280","2005-02-08",\N,"Resonance assignment of the double-stranded RNA-binding domains of adenosine deaminase acting on RNA",\N
6281,"6281","2004-11-29",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for the Complexin/SNARE complex",\N
6282,"6282","2004-10-18",\N,"NMR assignment of the turtle prion protein fragments tPrP(121-225)",\N
6283,"6283","2004-12-15",\N,"1H and 15N Chemical Shift Assignments for CLP",\N
6284,"6284","2005-03-16","2006-08-12","1H, 13C, and 15N Chemical Shift Assignments for DnaG-C",\N
6285,"6285","2007-03-22",\N,"15N, 13C, 1H NMR assignment of a 14kDa construct of the focal adhesion protein Talin",\N
6286,"6286","2005-06-02",\N,"1H and 15N assignment of SMRT DAD",\N
6287,"6287","2004-09-01",\N,"Diversity in structure and function of the Ets family pointed domains",\N
6288,"6288","2005-01-03","2005-03-16","SOLUTION NMR STRUCTURE OF NTX-1, A LONG NEUROTOXIN FROM THE VENOM OF THE ASIAN COBRA, 20 STRUCTURES",\N
6289,"6289","2004-09-01","2011-06-16","NMR Structure of the Free Zinc Binding C-terminal Domain of SecA",\N
6290,"6290","2004-11-29",\N,"Solution Structure of Cu6Metallothionein from the fungus Neurospora crassa",\N
6291,"6291","2005-05-26",\N,"Assignment of hypothetical membrane protein ta0354_69_121",\N
6292,"6292","2005-10-19","2008-07-01","1H, 15N and 13C sidechain and backbone assignments of the alkaline proteinase inhibitor APRin from Pseudomonas aeruginosa",\N
6293,"6293","2005-05-26",\N,"1H Assigned Chemical Shifts for FMBP-1 tandem repeat 2 in 30% (v/v) TFE solution",\N
6294,"6294","2005-05-26",\N,"1H Assigned Chemical Shifts for FMBP-1 tandem repeat 4 in 30% (v/v) TFE solution",\N
6295,"6295","2004-09-10","2005-03-16","NMR Structure of the Flavin Domain from Soluble Methane Monooxygenase Reductase from Methylococcus capsulatus (Bath)",\N
6296,"6296","2005-05-26",\N,"1H Assigned Chemical Shifts for FMBP-1 tandem repeat 3 in 30% (v/v) TFE solution",\N
6297,"6297","2005-01-24",\N,"Solution structure of the RWD domain of the mouse GCN2 protein",\N
6298,"6298","2005-05-25","2005-11-07","NMR STRUCTURE OF HUMAN HISTONE CHAPERONE, ASF1A",\N
6299,"6299","2004-12-06","2005-02-18","Structure of a Chordin-like Cysteine-rich Repeat (VWC module) from Collagen IIA",\N
6300,"6300","2007-03-22",\N,"Solution structure of rat Kalirin N-terminal SH3 domain",\N
6301,"6301","2004-12-06",\N,"NMR solution structure of a designed heterodimeric leucine zipper",\N
6302,"6302","2005-05-19",\N,"Solution structure of a diiron protein model: Due DF2-TURN_MUTANTturn mutant",\N
6303,"6303","2005-05-19",\N,"Solution structure of a diiron protein model",\N
6304,"6304","2004-11-29",\N,"Amide chemical shifts of mature human SUMO-1",\N
6305,"6305","2004-11-29",\N,"Mainchain proton, carbon and nitrogen chemical shifts for the C-domain of human RanGAP1",\N
6306,"6306","2004-11-29",\N,"Mainchain proton and nitrogen chemical shifts for the C-domain of human RanGAP1 linked via an isopeptide at Lys524 to Gly97 of human Sumo-1",\N
6307,"6307","2004-12-06","2010-07-16","The Solution Structure of d(G3T4G4)2",\N
6308,"6308","2005-02-21",\N,"Structure of the domain a of the glycoprotein chaperone ERp57",\N
6309,"6309","2006-01-18","2008-07-01","1H, 13C, and 15N Chemical Shift Assignments for domain III of the omsk hemorrhagic fever envelope protein",\N
6310,"6310","2005-03-18",\N,"1H,13C ans 15N assigned chemical shifts and secondary structures for hPPIL1 (peptidylprolyl isomerase -like 1)",\N
6311,"6311","2005-02-08",\N,"Sequence-specific backbone 1H, 13C and 15N assignments of the 25 kDa SPRY domain-containing SOCS box protein 2 (SSB-2)",\N
6312,"6312","2006-10-19","2009-09-08","Solution Structure of Fasciclin-Like Protein From Rhodobacter sphaeroides",\N
6313,"6313","2005-02-08",\N,"1H,13C,and 15N NMR assignments of the Bombyx mori Pheromone-binding Protein fragment BmPBP(1-128) at pH 6.5.",\N
6314,"6314","2005-02-08",\N,"NMR assignment for cold-shock protein ribosome-binding factor A (RbfA) from Thermotoga maritima",\N
6315,"6315","2005-01-19","2005-05-03","1H, 13C and 15N chemical shift assignments for TcUBP1 (GQ) (backbone + side chains)",\N
6317,"6317","2004-12-22",\N,"1H, 15N and 13C resonance assigment of the transcription factor CylR2 from Enterococcus faecalis",\N
6318,"6318","2004-10-10","2009-07-08","Solution structure of thioredoxin h1 from Arabidopsis thaliana","/ftp/pub/bmrb/timedomain/bmr6318"
6319,"6319","2004-10-10","2010-07-15","Backbone 1H, 13C, and 15N Chemical Shift Assignments for Nkx2.5 Homeodomain plus NK2 Specific Domain in the DNA Bound State",\N
6320,"6320","2004-11-16","2005-03-16","1H, 13C, 15N chemical shift assignments for extended 3' internal stem-loop RNA from S. cerevisiae U6 snRNA",\N
6321,"6321","2005-07-25",\N,"Chemical Shift assignment of the Ground-State of Delta25-PYP",\N
6322,"6322","2005-07-25",\N,"Chemical Shift assignment of the blue shifted inetrmediate state of Delta25-PYP",\N
6324,"6324","2004-12-22",\N,"Solution structure of the hypothetical protein Tm0979 from Thermotoga maritima",\N
6325,"6325","2005-03-16",\N,"Assessment of the robustness of a serendipitous zinc-binding fold: mutagenesis and protein grafting",\N
6326,"6326","2005-03-16",\N,"Assessment of the robustness of a serendipitous zinc-binding fold: mutagenesis and protein grafting",\N
6327,"6327","2005-03-16",\N,"Assessment of the robustness of a serendipitous zinc-binding fold: mutagenesis and protein grafting",\N
6328,"6328","2005-03-16",\N,"Assessment of the robustness of a serendipitous zinc-binding fold: mutagenesis and protein grafting",\N
6329,"6329","2005-03-16",\N,"Assessment of the robustness of a serendipitous zinc-binding fold: mutagenesis and protein grafting",\N
6330,"6330","2004-12-22","2005-03-18","Solution structure of human AP4A hydrolase",\N
6331,"6331","2005-01-07",\N,"NMR assignment of the SH2 domain from the human feline sarcoma oncogene FES",\N
6332,"6332","2005-07-26","2008-05-13","1H, 13C and 15N resonance assignments of MLC (myosin light chain)from Saccharomyces cerevisiae",\N
6333,"6333","2005-07-26",\N,"1H, 13C, and 15N chenical shift assignments for ABA-1A with oleic acid bound",\N
6334,"6334","2004-11-11","2005-02-10","1H, 13C, 15N backbone and sidechain resonance assignment of Mip(77-213) the PPIase domain of the Legionella pneumophila Mip protein",\N
6335,"6335","2004-10-12",\N,"Near complete chemical shift assignments for the zinc-bound redox switch domain of the E. coli Hsp33",\N
6336,"6336","2004-12-22","2005-11-14","Assignment of human AP4A hydrolase in complex with ATP",\N
6337,"6337","2004-10-12",\N,"Solution Structure of Ubiquitin like protein from Mus musculus","/ftp/pub/bmrb/timedomain/bmr6337"
6338,"6338","2004-11-01","2007-11-09","NMR solution structure of At1g77540","/ftp/pub/bmrb/timedomain/bmr6338"
6339,"6339","2004-10-13","2009-07-08","Solution structure of AT1g01470 from Arabidopsis Thaliana","/ftp/pub/bmrb/timedomain/bmr6339"
6340,"6340","2004-10-13","2009-07-23","Solution structure of AT3g03773 from Arabidopsis Thaliana","/ftp/pub/bmrb/timedomain/bmr6340"
6341,"6341","2004-11-01",\N,"Solution structure of At3g04780.1, an Arabidopsis ortholog of the C-terminal domain of human thioredoxin-like protein","/ftp/pub/bmrb/timedomain/bmr6341"
6342,"6342","2005-03-16",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for human survivin",\N
6343,"6343","2004-11-29",\N,"Backbone and side chain 1H, 13C, and 15N chemical shift assignments of PA1324 (21-170): Northeast Structural Genomics Consortium Target PaP1",\N
6344,"6344","2004-11-08","2010-08-25","1H, 13C, and 15N Chemical Shift Assignments for human protein HSPCO34","/ftp/pub/bmrb/timedomain/bmr6344"
6345,"6345","2007-03-22",\N,"Solution Structure of YKR049C",\N
6346,"6346","2005-07-25",\N,"1H, 15N and 13C Resonance Assignments and Secondary Structure Determination Reveal that the Minimal Rac1 GTPase Binding Domain of Plexin-B1 Has a Ubiquitin Fold",\N
6347,"6347","2004-10-29","2005-03-17","Evidence for domain-specific recognition of SK and Kv channels by MTX and HsTx1 scorpion toxins",\N
6348,"6348","2005-06-02",\N,"13C, 15N solid state NMR chemical shift assignments for the intrinsic transmembrane light-harvesting 2 protein complex",\N
6349,"6349","2005-03-17",\N,"1H, 13C and 15N Chemical Shift Assignments for the LH1 Alfa Polypeptide of Rhodospirillum rubrum",\N
6350,"6350","2005-03-17",\N,"1H, 13C and 15N Chemical Shift Assignments for the LH1 Beta Polypeptide of Rhodospirillum rubrum",\N
6351,"6351","2005-03-29",\N,"13C, 15N solid-state NMR chemical shift assignments for Kaliotoxin",\N
6352,"6352","2005-04-11",\N,"Isolation and characterization of epilancin 15X, a novel lantibiotic from a clinical strain of Staphylococcus epidermidis",\N
6353,"6353","2005-03-18","2010-07-14","1H, 15N and 13C resonance assignments of the BRCT Region of the large subunit of human Replication Factor C",\N
6354,"6354","2006-01-18","2008-07-01","1H, 13C and 15N resonance assignments and 15N-1H residual dipolar couplings for NECAP1 protein",\N
6355,"6355","2006-04-06",\N,"Solution Structure Of The Staphylococcus Epidermis Protein SE0936. Northest Strucutral Genomics Consortium Target SeR8.",\N
6356,"6356","2004-10-29","2010-07-26","Yeast frataxin solution structure",\N
6357,"6357","2004-11-01","2006-08-12","Backbone Resonance Assignments of Wild-Type TEM-1 Beta-lactamase from E. coli",\N
6358,"6358","2005-03-18","2005-04-04","1H, 13C, and 15N Chemical Shift Assignments for a bacterial BolA-like protein XC975",\N
6359,"6359","2005-10-24","2007-01-29","Assigned chemical shift for YGGX",\N
6360,"6360","2005-10-20",\N,"IDENTIFICATION OF MINIMAL PEPTIDE SEQUENCE IN THE AMIDATED FRAGMENT 33-61 OF BOVINE a-HEMOGLBIN",\N
6361,"6361","2005-02-10",\N,"Resonance Assignments for the SAP domain of the human protein DEK",\N
6362,"6362","2004-11-29","2005-11-07","Solution structure of Iron-Sulfur cluster assembly protein IscU from Bacillus subtilis, with Zinc bound at the active site. Northeast Structural Genomics Consortium Target SR17",\N
6363,"6363","2005-10-31","2010-08-25","1H, 13C, 15N Chemical Shift Assignment of Protein XCC2852, Northeast Structural Genomics Target Protein XcR50",\N
6364,"6364","2005-10-31","2008-08-29","1H, 13C 15N chemical shift assignment of Pyrococcus furiosus Protein PF0470: The Northeast Structural Genomics Consortium Target PfR14",\N
6365,"6365","2005-10-31","2008-08-29","1H, 13C 15N chemical shift assignment of B. cereus protein BC4709, Northeast Structural Genomics Target Protein BcR68",\N
6366,"6366","2005-10-31","2007-11-09","1H, 13C, and 15N Chemical Shift Assignments of Bacillus subtilis Protein yqbG: The Northeast Structural Genomics Consortium Target SR215",\N
6367,"6367","2005-10-31","2008-08-29","1H, 13C, and 15N Chemical Shift Assignments of E.Coli Protein yhgG: The Northeast Structural Genomics Consortium Target ET95",\N
6368,"6368","2005-10-31","2008-08-29","1H, 13C, and 15N Chemical Shift Assignments of Methanosarcina mazei Protein RPS24E: The Northeast Structural Genomics Consortium Target MaR11",\N
6369,"6369","2005-10-31","2008-08-29","1H, 13C 15N chemical shift assignment Bacillus halodurans Protein BH1534: The Northeast Structural Genomics Consortium Target BhR29",\N
6370,"6370","2005-03-07","2005-11-14","1H assignment of APETx1",\N
6371,"6371","2005-04-08",\N,"1H, 13C, and 15N resonance assignments of Sin3a associated polypeptide 18 (SAP-18)",\N
6372,"6372","2005-02-10",\N,"1H and 15N Assigned Chemical Shifts for SARS N-Protein N-Terminate",\N
6373,"6373","2005-06-03",\N,"1H, 13C and 15N backbone resonance assignments of LexA catalytic domain with the L89P/Q92W/D150H/E152A/K156A mutations",\N
6374,"6374","2005-02-10",\N,"NMR STRUCTURE OF THE FIRST PHD FINGER OF AUTOIMMUNE REGULATOR PROTEIN (AIRE1): INSIGHTS INTO APECED",\N
6375,"6375","2005-03-07",\N,"Full 1H, 13C, and 15N Chemical Shift Assignments for Escherichia coli TonB 151-239",\N
6376,"6376","2005-03-18",\N,"Complete resonance assignment of the C-terminal domain from TgMIC1",\N
6377,"6377","2004-12-23","2005-04-12","Backbone 1H, 13C, and 15N Chemical Shift Assignments for feline prion protein",\N
6378,"6378","2004-12-23","2005-04-12","canine prion protein",\N
6379,"6379","2005-06-03","2005-07-26","Backbone HN, N, C', CA, CB assignments of Escherichia coli SdiA1-171",\N
6380,"6380","2004-12-23","2005-04-12","1H, 13C, and 15N Chemical Shift Assignments for pig prion protein",\N
6381,"6381","2004-12-23","2005-04-12","NMR solution structures of mammalian prion proteins",\N
6382,"6382","2005-04-08",\N,"1H, 13C, and 15N Chemical Shift Assignments for Xenopus prion protein.",\N
6383,"6383","2005-01-14",\N,"NMR solution structure of the recombinant elk and mouse/elk variant prion proteins",\N
6384,"6384","2005-01-14","2005-04-12","Solution Structure of TACI_D2",\N
6385,"6385","2005-01-14",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for pleckstrin human DEP domain",\N
6386,"6386","2005-08-17","2005-09-08","Structural and Functional Study of Anemonia Elastase Inhibitor, a \"Non-classical\" Kazal-type Inhibitor from Anemonia sulcata",\N
6387,"6387","2005-08-17","2005-09-08","Structural and Functional Study of Anemonia Elastase Inhibitor, a \"Non-classical\" Kazal-type Inhibitor from Anemonia sulcata",\N
6388,"6388","2005-03-07","2005-05-03","NMR structure of the synthetic penaeidin 4",\N
6389,"6389","2004-12-14","2005-08-22","Acting on the Number of Molecular Contacts between Maurotoxin and Kv1.2 Channel Impacts Ligand Affinity",\N
6390,"6390","2005-04-08",\N,"NMR assignment of the R-module from the Azotobacter vinelandii mannuronan C5-epimerase AlgE4",\N
6391,"6391","2005-04-08",\N,"1H, 13C, and 15N chemical shift assignments for the catalytic domain of MMP-12",\N
6392,"6392","2005-04-11","2005-11-14","Refined solution structure of the human TSG-6 Link module",\N
6393,"6393","2005-04-12",\N,"Refined solution structure of the human TSG-6 Link module",\N
6395,"6395","2004-12-14","2005-08-17","1H, 13C, and 15N Chemical Shift Assignments for the Cis and Trans Isomer of the Beta Domain of Bacillus stearothermophilus DivIB",\N
6396,"6396","2005-01-14","2007-01-29","Chemical shift Assignment for mouse Roadblock/LC7 domain BC029172","/ftp/pub/bmrb/timedomain/bmr6396"
6398,"6398","2005-12-05","2006-06-12","Sulfolobus Solfataricus Acylphosphatase 1H chemical shift assignment",\N
6399,"6399","2005-07-26",\N,"1H, 13C and 15N resonance assignments for the 24 kDa TPR domain in p67phox",\N
6400,"6400","2005-07-26",\N,"1H, 13C, and 15N Chemical Shift Assignments for the Wild-Type Matrix Protein of Mason-Pfizer Monkey Virus (M-PMV)",\N
6401,"6401","2005-07-26",\N,"NMR assignment of R55F mutant of Mason-Pfizer monkey virus matrix protein",\N
6402,"6402","2005-05-23",\N,"Solution structure of the carbon storage regulator CsrA from E. coli",\N
6403,"6403","2004-12-23",\N,"Ovine Prion Protein Variant R168",\N
6404,"6404","2005-07-26",\N,"HN, N, CA, CB Chemical Shift Assignments for the CID domain of Pcf11",\N
6405,"6405","2005-12-15",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for the first cadherin domain of Cadherin-related neuronal receptor(CNR)/ Protocadherin alpha",\N
6406,"6406","2005-01-14","2005-04-08","Backbone and side chain chemical shift assignments of a TRAV14-3 mouse T cell receptor domain",\N
6407,"6407","2005-03-18",\N,"1H, 15N resonance assignment of the C-terminal domain of Human Papillomavirus Oncoprotein E6",\N
6408,"6408","2005-06-03","2005-11-14","Backbone 1H, 13C, and 15N Chemical Shift Assignments for Two C-terminal C2H2 Zinc Fingers (F5-6) of MTF-1",\N
6409,"6409","2005-06-03","2005-11-14","Backbone 1H, 13C, and 15N and 13CB Chemical Shift Assignments for Four N-terminal C2H2 Zinc Fingers (F1-4) of MTF-1",\N
6410,"6410","2005-12-15",\N,"1H, 15N, and 13C resonance assignments of reduced form of poplar glutaredoxin CxxC1 from Populus tremula tremuloides",\N
6411,"6411","2005-10-20",\N,"FRAGMENT 33-61 OF BOVINE alpha-HEMOGLBIN: THE EFFECT OF C-TERMINAL AMIDATION AND IDENTIFICATION OF THE MINIMAL PORTION WITH ANTIFUNGAL ACTIVITY",\N
6412,"6412","2005-10-20",\N,"FRAGMENT 33-61 OF BOVINE alpha-HEMOGLBIN: THE EFFECT OF C-TERMINAL AMIDATION AND IDENTIFICATION OF THE MINIMAL PORTION WITH ANTIFUNGAL ACTIVITY",\N
6413,"6413","2005-10-20",\N,"FRAGMENT 33-61 OF BOVINE alpha-HEMOGLBIN: THE EFFECT OF C-TERMINAL AMIDATION AND IDENTIFICATION OF THE MINIMAL PORTION WITH ANTIFUNGAL ACTIVITY",\N
6414,"6414","2005-10-20",\N,"FRAGMENT 33-61 OF BOVINE alpha-HEMOGLBIN: THE EFFECT OF C-TERMINAL AMIDATION AND IDENTIFICATION OF THE MINIMAL PORTION WITH ANTIFUNGAL ACTIVITY",\N
6415,"6415","2005-04-04",\N,"Three-disulfide variant of hen lysozyme: C30A/C115A",\N
6416,"6416","2005-08-16",\N,"Backbone 1H, 13C, and 15N assignments of a 56 kDa E. coli nickel binding protein NikA",\N
6417,"6417","2005-01-14","2005-11-14","Hormaomycin",\N
6418,"6418","2005-07-26",\N,"Backbone 1H, 13C and 15N resonance assignments for the Mg2+-bound form of the Ca2+-binding photoprotein aequorin",\N
6419,"6419","2005-04-26",\N,"Structure of the C-terminal Domain from Trypanosoma brucei Variant Surface Glycoprotein MITat1.2",\N
6420,"6420","2005-08-18",\N,"Daptomycin NMR Structure",\N
6421,"6421","2005-06-03",\N,"Solution structure of sst1-selective somatostatin (SRIF) (analog 5)",\N
6422,"6422","2005-06-03",\N,"NMR strcutre of sst1-selective somatostatin (SRIF) analog 1",\N
6423,"6423","2005-06-03",\N,"NMR strcutre of sst1-selective somatostatin (SRIF) analog 1",\N
6424,"6424","2005-06-03",\N,"NMR strcutre of sst1-selective somatostatin (SRIF) analog 1",\N
6425,"6425","2005-06-03",\N,"NMR strcutre of sst1-selective somatostatin (SRIF) analog 1",\N
6426,"6426","2005-06-03",\N,"NMR strcutre of sst1-selective somatostatin (SRIF) analog 1",\N
6427,"6427","2005-06-02",\N,"Solution structure of a recombinant type I sculpin antifreeze protein",\N
6428,"6428","2006-08-11",\N,"Probing the pH-dependent structural features of a-KTx12.1, a potassium channel blocker from the scorpion Tityus serrulatus",\N
6429,"6429","2006-04-17","2007-05-01","Backbone 1H, 15N and 13C chemical shift assignments for human retinoid X receptor ligand-binding domain with and without 9-cis retinoic acid",\N
6430,"6430","2005-01-14","2010-07-16","1H and 31P chemical shift assignments for HIV-1 integrase inhibitor 93del",\N
6431,"6431","2005-08-16",\N,"1H, 13C and 15N assignments for the II-III loop region of the skeletal dyhydropyridine receptor",\N
6432,"6432","2005-01-21",\N,"NMR solution Structure of a partially diordered protein from Arabdopsis Thaliana At2g23090","/ftp/pub/bmrb/timedomain/bmr6432"
6433,"6433","2005-07-26",\N,"Sequence specific 1HN, 13C and 15N resonance assignments of a novel calcium binding protein from Entamoeba histolytica",\N
6434,"6434","2005-01-14","2005-07-26","Backbone and Sidechain Assignments of the Lambda Bacteriophage Tail Assembly Protein gpU",\N
6436,"6436","2009-05-27",\N,"1H, 15N, and 13C resonance assignments of a natively unfolded protein XC4149 from the plant pathogen Xanthomonas campestris pv. campestris 17",\N
6437,"6437","2005-04-26","2005-11-14","Structural origin of endotoxin neutralization and antimicrobial activity of a lactoferrin-based peptide",\N
6438,"6438","2005-08-29",\N,"Sequence-specific resonance assignments of the C-terminal, 137-residue pseudo-receiver domain of circadian input kinase (CikA) that resets the circadian clock in Synechococcus elongatus",\N
6439,"6439","2005-04-08",\N,"Backbone 1H, 15N and 13C and side-chain 1H and 13C assignments of the rice phytochrome B PAS1 domain",\N
6440,"6440","2005-04-08",\N,"1H, 15N and 13C backbone assignments of 28kD phytochrome B PAS1-PAS2 domain",\N
6441,"6441","2006-04-17","2007-11-09","Chemical shift assignments for human Orexin-A",\N
6442,"6442","2007-03-23",\N,"1H, 13C, and 15N sequence-specific resonance assignment and secondary structure of Plasmodium falciparum thioredoxin",\N
6443,"6443","2005-04-15",\N,"Assignments of At5g01610, an Arabidopsis thaliana protein containign DUF583 domain","/ftp/pub/bmrb/timedomain/bmr6443"
6444,"6444","2005-04-12",\N,"1H, 13C, and 15N Chemical Shift Assignments for MMP12",\N
6445,"6445","2005-07-25","2010-07-16","Backbone 1H, 13C, and 15N and 13CB Chemical Shift Assignments for Six C2H2 Zinc Fingers (F1-6) of MTF-1 in the DNA Bound State (22 bp)",\N
6446,"6446","2005-06-02",\N,"Structural and Functional Characterization of Transmembrane Segment IV of the NHE1 Isoform of the Na+/H+ Exchanger",\N
6447,"6447","2006-02-22","2007-01-29","Solution structure of a two-repeat fragment of major vault protein",\N
6448,"6448","2005-06-12","2009-07-06","Solution structure of the hypothetical protein ytfP from Escherichia coli. Northeast Structural Genomics target ER111.","/ftp/pub/bmrb/timedomain/bmr6448"
6449,"6449","2006-04-17",\N,"Backbone 1H, 15N and 13C chemical shift assignments for human retinoid X receptor ligand-binding domain with and without 9-cis retinoic acid",\N
6451,"6451","2005-03-03","2005-07-26","1H, 15N and 13C resonance assigment of the chaperone CesT from enteropathogenic Escherichia coli",\N
6452,"6452","2008-09-29",\N,"1H, 13C and 15N resonance assignments of the PDZ domain of CLP-36",\N
6453,"6453","2005-12-14",\N,"The solution structure of YggX from Escherichia coli",\N
6454,"6454","2005-06-06","2005-07-26","SdiA",\N
6455,"6455","2006-06-26",\N,"1H, 13C, and 15N Chemical shift Assignments for crambin in acetone-water (3:1) mixed solvent",\N
6456,"6456","2005-10-17",\N,"NMR STRUCTURE OF THE SH3 DOMAIN OF HUMAN LYN TYROSINE KINASE",\N
6457,"6457","2007-03-22",\N,"Validation of Protein Structure from Anisotropic Carbonyl Chemical Shifts in a Dilute Liquid Crystalline Phase",\N
6458,"6458","2006-12-13",\N,"Two-Dimensional 1H NMR Study of Human Ubiquitin",\N
6459,"6459","2005-09-08","2005-09-22","Chemical Shift Assignment for Itch E3 WW3 domain",\N
6460,"6460","2005-06-03",\N,"NMR assignments of a low molecular weight phosphotyrosine phosphatase from Bacillus subtilis",\N
6462,"6462","2005-05-27","2005-09-08","The structure of a lactoferricinB derivative bound to micelles (LfcinB4-14)",\N
6463,"6463","2005-05-27","2005-09-08","The structure of a lactoferricinB derivative bound to micelles",\N
6464,"6464","2005-10-07","2009-07-02","Structure of the hypothetical Arabidopsis thaliana protein At1g16640.1","/ftp/pub/bmrb/timedomain/bmr6464"
6465,"6465","2005-07-25",\N,"1H, 13C, and 15N chemical shift assignments for PAL",\N
6466,"6466","2007-11-13",\N,"Internal Dynamics of Human Ubiquitin Revealed by 13C-Relaxation Studies of Randomly Fractionally Labeled Protein",\N
6467,"6467","2005-09-08","2005-09-22","Solution structure of APETx2, a specific peptide inhibitor of ASIC3 proton-gated channels",\N
6468,"6468","2006-01-06",\N,"1H, 13C and 15N backbone resonance assignment of p38 mitogen-activated protein kinase",\N
6469,"6469","2005-07-25",\N,"1H, 13C, and 15N Chemical Shift Assignments for the HMG-box domain in the SSRP1 subunit of FACT",\N
6470,"6470","2005-06-12",\N,"Rotational Diffusion Anisotropy of Human Ubiquitin from 15N NMR Relaxation",\N
6473,"6473","2005-02-10","2005-11-07","Structural and dynamic characteristics of the acid-unfolded state of hUBF HMG Box 1 provide clues for the early events in protien folding",\N
6474,"6474","2005-09-08","2011-03-28","The 15N relaxation data and backbone dynamics results of CLV1 pT868 bound KI-FHA from KAPP",\N
6475,"6475","2005-05-27","2006-11-13","1H, 13C and 15N Chemical Shift assignments for Man5C-CBM35 from C. japonicus",\N
6476,"6476","2005-06-02","2005-09-22","Full 1H, 13C and 15N Chemical Shift Assignments for the GII loop mutant domain (GII-L) of the yeast linker histone, Hho1p",\N
6477,"6477","2006-02-17",\N,"Solution structure of the P2b-P3 pseudoknot from human telomerase RNA",\N
6478,"6478","2005-06-12",\N,"The N-domain of the transcription factor AbrB",\N
6479,"6479","2005-04-04",\N,"The Structure of the Excisionase (Xis) Protein from Conjugative Transposon Tn916 Provides Insights into the Regulation of Heterobivalent Tyrosine Recombinases",\N
6480,"6480","2005-11-01","2005-11-14","The loss of stability of a naturally occurring ATP7A mutant is the cause of Menkes disease",\N
6481,"6481","2005-11-01","2005-11-14","The loss of stability of a naturally occurring ATP7A mutant is the cause of Menkes disease",\N
6482,"6482","2005-11-01","2005-11-14","The loss of stability of a naturally occurring ATP7A mutant is the cause of Menkes disease",\N
6483,"6483","2005-11-01","2005-11-14","The loss of stability of a naturally occurring ATP7A mutant is the cause of Menkes disease",\N
6484,"6484","2006-02-17",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for S100A13",\N
6485,"6485","2005-05-26","2011-05-05","A novel RNA pentaloop fold involved in targeting ADAR2",\N
6488,"6488","2006-05-02",\N,"Reparametrization of the Karplus Relation for 3J(HA-N) and 3J(HN-C') in Peptides from Uniformly 13C/15N-Enriched Human Ubiquitin",\N
6489,"6489","2006-04-24",\N,"Chemical shift assignments for subunit c of the F1Fo ATP Synthase from Bacillus PS3",\N
6493,"6493","2005-11-03",\N,"Assignment of the 1H, 13C, and 15N resonances of URNdesign, a computationally redisgned RRM protein",\N
6494,"6494","2005-05-24",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for Chorismate Mutase",\N
6495,"6495","2005-05-23",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments and relaxation data for Chorismate Mutase from Bacillus subtilis in complex with inhibitor",\N
6496,"6496","2005-05-24",\N,"Backbone 1H and 15N Chemical Shift Assignments for Chorismate Mutase from Bacillus subtilis in complex with prephenate",\N
6498,"6498","2005-08-16",\N,"Backbone and side-chain 1H, 13C, and 15N Chemical Shift Assignments for SIP (1-77)",\N
6499,"6499","2005-05-26",\N,"NMR structure of antimicrobial peptide distinctin in water",\N
6500,"6500","2005-08-16",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for SIP (74-178)",\N
6501,"6501","2005-03-17",\N,"Backbone 1H, 15N, 13Ca and sidechain 13Cb chemical shift assignments of SARS-CoV Nsp9",\N
6502,"6502","2006-02-17",\N,"DNA binding domain in XPF/ERCC-1 complex",\N
6503,"6503","2005-10-24",\N,"1H, 13C, and 15N complete chemical shift assignments for the apo v-Src SH2 domain",\N
6504,"6504","2006-06-26",\N,"1H, 13C, and 15N Chemical shift Assignments for crambin in DPC micelles",\N
6505,"6505","2005-12-09","2009-07-02","Solution Structure of the Conserved Protein from the Gene Locus Mm1357 of Methanosarcina Mazei. Northeast Structural Genomics Target Mar30","/ftp/pub/bmrb/timedomain/bmr6505"
6506,"6506","2005-06-02","2005-08-22","Conkunitzin-S1 is the first member of a new Kunitz-type neurotoxin family - Structural and functional characterization",\N
6507,"6507","2005-08-19",\N,"Complex structure of PCAF bromodomain with small chemical ligand NP2",\N
6508,"6508","2005-08-19",\N,"complex structure of PCAF bromodomain with small chemical ligand NP1",\N
6509,"6509","2005-09-08",\N,"Solution Structure of the ScYLV P1-P2 Frameshifting Pseudoknot",\N
6510,"6510","2005-08-22",\N,"Structure and inter-domain interactions of domain II from the blood stage malarial protein, apical membrane antigen 1",\N
6511,"6511","2005-09-22",\N,"NMR structure of peptide SD",\N
6512,"6512","2005-03-03","2005-07-26","1H, 15N, and 13C resonance assignments of Vaccinia Virus Envelope protein, A27L",\N
6513,"6513","2007-03-19",\N,"NMR Structure of the nonstructural Protein 7 (nsP7) from the SARS Corona Virus",\N
6514,"6514","2005-04-19",\N,"1H, 13C, and 15N Chemical Shift Assignments for Psuedomonas Aeruginosa protein PA4608","/ftp/pub/bmrb/timedomain/bmr6514"
6515,"6515","2005-04-26","2009-07-02","Chemical Shift Assignments for At2g46140.1","/ftp/pub/bmrb/timedomain/bmr6515"
6516,"6516","2005-09-01","2006-03-31","NMR assignment of the holo-acyl carrier protein (PfACP) from malaria parasite Plasmodium falciparum",\N
6517,"6517","2005-04-26",\N,"NMR structure of P. aeruginosa protein PA4738: Northeast Structural Genomics Consortium target PaP2",\N
6518,"6518","2005-04-26",\N,"H,C,N chemical shift assignments for Allochromatium DsrC: Northeast Structural Genomics Consortium target OP4",\N
6519,"6519","2005-04-26","2005-07-25","Chemical shift assignments of Calsensin",\N
6520,"6520","2009-05-27",\N,"1H, 15N Chemical shift assignments for recombinant elicitor protein PcF from the oomycete pathogen P. cactorum",\N
6521,"6521","2005-05-27","2007-01-29","Characterization of an amyloid fibril intermediate",\N
6522,"6522","2005-04-26","2007-01-29","Characterization of an amyloid fibril intermediate",\N
6524,"6524","2005-07-26",\N,"ApoE N-terminal domain",\N
6525,"6525","2006-04-24","2007-11-09","Backbone 1H Chemical Shift Assignments for Mungbean Defensin, VrD1",\N
6526,"6526","2005-05-05",\N,"Solution structure of the KH-QUA2 region of the Xenopus STAR/GSG Quaking protein.",\N
6527,"6527","2005-08-30","2005-11-01","1H, 13C and 15N Chemical Shift Assignments for km23 dimer",\N
6528,"6528","2005-08-22",\N,"1H, 15N and 13C Assignments for the R2 Domain of Choline Binding Protein A (CbpA)",\N
6529,"6529","2006-04-06",\N,"Assignment of 1H, 13C and 15N resonances of the 2S albumin Ber e 1 from Brazilian nut",\N
6530,"6530","2005-10-26",\N,"CC45, An Artificial WW Domain Designed Using Statistical Coupling Analysis",\N
6531,"6531","2006-02-22",\N,"Solution structure of Calcium-S100A13 (minimized mean structure)",\N
6532,"6532","2006-02-22",\N,"Solution structure of apo-S100A13",\N
6533,"6533","2006-02-23",\N,"1H, 13C, and 15N Chemical Shift Assignments for the DNA binding domain of STPA from E. coli",\N
6535,"6535","2005-09-28",\N,"Backbone 1H and 15N Chemical Shift Assignments for T antigen origin binding domain in the presence of RPA32C",\N
6536,"6536","2005-07-26",\N,"1H,15N,13C backbone and sidechain assignment for human ADAP hSH3-1 domain in reduced form",\N
6537,"6537","2006-04-17","2010-07-16","Small Molecule Ligand Induces Nucleotide Flipping in (CAG)n Trinucleotide Repeats",\N
6538,"6538","2005-05-27",\N,"1H, 13C, and 15N Chemical Shift Assignments for 2B4",\N
6539,"6539","2005-07-26",\N,"1H,15N,13C backbone and sidechain assignment for human ADAP hSH3-1 domain in oxidized form",\N
6540,"6540","2005-08-29",\N,"Sequence-specific 1H, 13C and 15N resonance assignments of the winged-helix domain of the human Werner syndrome protein",\N
6541,"6541","2006-04-25",\N,"1H, 13C and 15N chemical shift assignments for stereo array isotope labeled (SAIL) calmodulin",\N
6542,"6542","2005-07-26",\N,"Main Chain 1H, 13C, and 15N chemical shift assignments for arginine kinase",\N
6543,"6543","2006-11-06",\N,"HIV-1 frameshift inducing element RNA",\N
6546,"6546","2005-09-01","2010-08-25","1H, 13C, and 15N Chemical Shift Assignments for Human Protein CGI-126(HSPC155): the Northeast Structural Genomics Consortium Target HR41","/ftp/pub/bmrb/timedomain/bmr6546"
6547,"6547","2009-11-03",\N,"structure-function relationships of the polyhistidine-rich peptide LAH4 in micellar environments; pH dependent mode of antibiotic action & DNA transfection",\N
6549,"6549","2006-02-17",\N,"Sequential Backbone Assignment and Secondary Structure of Peroxisome Proliferator-Activated Receptor g Ligand Binding Domain",\N
6551,"6551","2005-12-14",\N,"Solution structure of the C-terminal domain of ERCC1 complexed with the C-terminal domain of XPF",\N
6552,"6552","2005-08-30",\N,"A Protein Folding Pathway with Multiple Folding Intermediates at Atomic Resolution",\N
6553,"6553","2005-08-30",\N,"Specific non-native hydrophobic interactions in a hidden folding intermediate: implication for protein folding",\N
6554,"6554","2006-04-17",\N,"Experimental evidence for a reversible alfa to beta transition of Abeta-(1-42) in aqueous media: a step by step conformational analysis pinpoints the location of the beta conformation seeding",\N
6555,"6555","2006-04-06","2008-07-01","Solution structure of YBL071w-A from Saccharomyces cerevisiae",\N
6556,"6556","2006-08-11",\N,"Solution structure of 1-26 fragment of human programmed cell death 5 protein",\N
6557,"6557","2006-08-11","2007-11-14","Solution Conformation of adr subtype HBV Pre-S2 Epitope",\N
6558,"6558","2005-08-22",\N,"Structure of the FBP11WW1 domain",\N
6559,"6559","2005-08-22",\N,"Structure of the FBP11WW1 domain complexed to the peptide APPTPPPLPP",\N
6560,"6560","2005-08-30",\N,"The NMR solution structure of a redesigned apocytochrome b562:Rd-apocyt b562",\N
6561,"6561","2005-08-22",\N,"NMR structure of plantaricin a in dpc micelles, 20 structures",\N
6562,"6562","2005-04-19",\N,"A novel cGUUAg tetraloop structure with a conserved yYNMGg-type backbone conformation from cloverleaf 1 of bovine enterovirus 1 RNA",\N
6563,"6563","2006-04-05","2007-01-31","Backbone 1H, 13C, and 15N Chemical Shift Assignments for oxidized ArsC",\N
6564,"6564","2005-09-08","2005-09-22","Chemical Shift Assignment for OSCP-NT (1-120)",\N
6565,"6565","2005-09-01",\N,"Assignment of 1H, 13C and 15N resonances of barnacle cement protein Mrcp-20k",\N
6566,"6566","2005-06-03",\N,"Measles virus N protein (amino acids 477-505)",\N
6567,"6567","2005-06-03",\N,"Measles virus N protein (amino acids 477-505) bound to the Measles virus P protein (amino acids 457-507).",\N
6568,"6568","2005-06-03",\N,"Measles virus P protein (amino acids 457-407)",\N
6569,"6569","2005-06-03",\N,"Measles virus P protein (amino acids 457-507) bound to the Measles virus N protein (amino acids 477-505)",\N
6570,"6570","2005-10-24",\N,"NMR Assignments of the F-actin binding domain of human Bcr-Abl/c-Abl",\N
6571,"6571","2005-10-17",\N,"Chemical Shift Assignments for the theta subunit of DNA polymerase III from E. coli",\N
6572,"6572","2006-02-13","2007-01-29","Backbone Amide Assignments of the Cytochrome c3 in Fully Oxidized State from D. vulgaris Miyazaki F",\N
6573,"6573","2005-09-08","2005-10-17","NMR Structure of VPS4A MIT Domain",\N
6574,"6574","2005-12-09",\N,"MrR5",\N
6575,"6575","2005-05-27","2005-06-02","Backbone and side-chain chemical shift assignments for Human Nck2 SH2 domain",\N
6576,"6576","2005-10-28",\N,"Backbone and sidechain 1H assignments of Crotamine",\N
6577,"6577","2005-11-07","2011-03-28","Solution structure of the C1-subdomain of Bacillus stearothermophilus translation initiation factor IF2",\N
6578,"6578","2005-09-01",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for Bcl-xl/Bad BH3 peptide complex",\N
6579,"6579","2005-06-03","2005-08-22","A structural Model for the Membrane-Bound Form of the Juxtamembrane Domain of the Epidermal Growth Factor Receptor",\N
6580,"6580","2005-12-16",\N,"Assignment of mouse socs3 by NMR",\N
6581,"6581","2007-02-07",\N,"Sequence-specific 1H, 13C and 15N resonance assignments of hemopoietic cell kinase SH3 domains in complex with a synthetic peptide",\N
6582,"6582","2005-10-26",\N,"Sequential resonance assignment of the human BMP type II receptor extracellular domain",\N
6583,"6583","2005-11-01",\N,"1H, 13C, and 15N NMR Sequence-specific Resonance Assignments for Rat Ca2+-S100A1",\N
6584,"6584","2005-10-25",\N,"Backbone assignment of the E2 ubiquitin conjugating enzyme UbcH5alpha",\N
6585,"6585","2005-04-26","2009-07-02","Resonance assignment of the At1g24000.1 protein from Arabidopsis Thaliana","/ftp/pub/bmrb/timedomain/bmr6585"
6586,"6586","2006-04-06",\N,"1H, 13C and 15N backbone resonance assignment of the Hsp90 binding domain of human Cdc37",\N
6587,"6587","2005-04-26",\N,"1H, 13C and 15N backbone resonance assignments of apolipoprotein A-I in lipid-mimetic solution",\N
6588,"6588","2005-05-26",\N,"1H, 13C and 15N backbone resonance assignments of apolipoprotein A-I(1-186) in lipid-mimetic solution",\N
6589,"6589","2006-04-14","2007-02-05","Backbone 1H, 13C, and 15N Chemical Shift Assignments for Chromo Domain of cpSRP43",\N
6590,"6590","2005-05-27","2005-10-26","1H, 13C, and 15N Chemical Shifts Assignments for Human Sulfiredoxin (srx)",\N
6591,"6591","2005-05-26","2007-01-26","On the Importance of Carbohydrate-Aromatic Interactions for the Molecular Recognition of Chitooligosaccharides by Hevein Domains. NMR Studies of the Structure and Binding Affinity of AcAMP2-Like Peptides with non Natural Napthyl and Fluoroaromatic Residue",\N
6592,"6592","2006-04-14","2007-02-05","Chromo 2 domain of cpSRP43",\N
6593,"6593","2006-04-14","2007-02-05","Chromo 3 domain of cpSRP43",\N
6594,"6594","2007-03-27","2007-11-14","Elucidation of the high-resolution solution structure of a trypanosomatid FYVE domain",\N
6596,"6596","2005-08-22",\N,"NMR solution structure of a leaf-specific-expressed cyclotide vhl-1",\N
6597,"6597","2005-10-31","2006-01-11","Human ARNT C-terminal PAS domain",\N
6598,"6598","2006-02-23",\N,"Mouse Doppel 1-30 peptide",\N
6599,"6599","2006-06-26","2007-01-26","Solution Structure of Bacillus subtilis s-BCCP holo-form",\N
6600,"6600","2006-06-26","2007-01-26","Solution Structure of Bacillus subtilis s-BCCP apo-form",\N
6601,"6601","2006-04-25","2015-04-29","1H, 13C, and 15N chemical shift assignments for B. subtilis PrsA PPIase",\N
6602,"6602","2005-10-27",\N,"1H, 13C, and 15N Chemical Shift Assignments for the GAF A Domain of Phosphodiesterase 5",\N
6603,"6603","2005-08-29",\N,"NMR assignments of a thioredoxin-like protein ykuV from Bacillus subtilis",\N
6604,"6604","2005-10-26",\N,"1H, 13C, and 15N complete chemical shift assignments for v-Src SH2 domain complexed with PQpYEEIPI ligand.",\N
6605,"6605","2005-10-28","2010-07-14","E. Coli Ada in a complex with DNA",\N
6606,"6606","2005-10-27","2012-11-08","backbone and side chain assignment for RPA70A from S.cerevisiae",\N
6607,"6607","2005-10-26","2009-03-31","1H, 13C and 15N resonance assignments of AT-Rich Interaction Domain (ARID) of Jumonji",\N
6608,"6608","2005-12-22",\N,"Proton assignments for PV5",\N
6609,"6609","2005-09-08","2005-09-22","Solution structure of the ubiquitin-like domain of human DC-UBP from dendritic cells",\N
6610,"6610","2005-10-26",\N,"apg8a.title",\N
6611,"6611","2005-05-26",\N,"1H, 13C, and 15N chemical shift assignments for the receiver domain (residues 1-121) of NtrC4 from Aquifex aeolicus",\N
6612,"6612","2005-10-27",\N,"NMR structure of unliagnded MDM2",\N
6613,"6613","2006-04-10",\N,"Structure and dynamics of coxsackievirus B4 2A proteinase, an enzyme involved in the aetiology of heart disease",\N
6615,"6615","2005-12-29","2009-09-08","Backbone 1H, 13C, and 15N Chemical Shift Assignments for SSD domain of Bacillus subtilis Lon protease",\N
6616,"6616","2006-08-07",\N,"1H chemical shift assignments for peptide P5",\N
6617,"6617","2005-10-26",\N,"Backbone 1H,15N assignment of the C-terminal haemopexin-like domain of matrix metalloproteinase MMP-13 (collagenase-3)",\N
6618,"6618","2006-08-07",\N,"1H chemical shift assignments for peptide P6",\N
6619,"6619","2006-08-07",\N,"1H chemical shift assignments for peptide P7",\N
6620,"6620","2005-10-10","2007-01-09","1H, 13C, and 15N Chemical Shift Assignments for murine p22HBP",\N
6621,"6621","2005-09-01",\N,"1H, 15N, and 13C Resonance Assignments of Human Interleukin-2",\N
6622,"6622","2005-11-03",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for HEWL-SMe",\N
6623,"6623","2005-11-01",\N,"Chemical Shift Assignments for Proinsulin C-Peptide",\N
6624,"6624","2005-11-07",\N,"Backbone 1H, 13C, and 15N Resonance Assignments for the 13kD Ras Association Domain 1 (RA1) from Phospholipase C (epsilon)",\N
6625,"6625","2008-01-28","2009-09-08","1H, 13C and 15N assignments of a New Phosphohistidine Phosphatase Protein PHPT1 from Homo sapiens",\N
6626,"6626","2005-12-14",\N,"Complete 1H, 13C, and 15N Chemical Shift Assignments for plant Tom20 mitochondrial import receptor cytosolic domain (isoform 3) from Arabidopsis thaliana",\N
6627,"6627","2006-08-07",\N,"Structure of cyclotide Kalata B1 in DPC micelles solution",\N
6628,"6628","2005-11-22",\N,"Specificity and Mechanism of the Histone Methyltransferase Pr-Set7",\N
6629,"6629","2005-10-18",\N,"Solution Structure of the type 1 pilus assembly platform FimD(25-139)",\N
6631,"6631","2007-11-13",\N,"Solution structure of a human ubiquitin-like domain in SF3A1",\N
6633,"6633","2005-08-18",\N,"Structure of the RNA signal essential for translational frameshifting in HIV-1",\N
6634,"6634","2006-04-25","2007-01-26","Chemical shift assignments for the K45Q-mutated ferricytochrome c3 from Desulfovibrio vulgaris Hildenborough",\N
6635,"6635","2005-11-07",\N,"Backbone 1H, 13C, and 15N Resonance Assignments for the 13kD Ras Association Domain 2 (RA2) from Phospholipase C (epsilon)",\N
6636,"6636","2006-04-20",\N,"NMR Structure of PcFK1",\N
6637,"6637","2005-10-27","2007-01-26","On the Importance of Carbohydrate-Aromatic Interactions for the Molecular Recognition of Chitooligosaccharides by Hevein Domains. NMR Studies of the Structure and Binding Affinity of AcAMP2-Like Peptides with non Natural Napthyl and Fluoroaromatic Residue",\N
6638,"6638","2006-08-11",\N,"1H, 15N, and 13C assignments of N-terminal domain of Epstein-Barr Virus Latent Membrane Protein 2A",\N
6639,"6639","2005-10-27","2007-01-26","On the Importance of Carbohydrate-Aromatic Interactions for the Molecular Recognition of Chitooligosaccharides by Hevein Domains. NMR Studies of the Structure and Binding Affinity of AcAMP2-Like Peptides with non Natural Napthyl and Fluoroaromatic Residue",\N
6640,"6640","2005-08-22","2005-09-01","1H, 13C, and 15N Chemical Shift Assignments for JHP1348",\N
6642,"6642","2006-11-06",\N,"Backbone 1H, 13C and 15N Chemical Shift Assignments for apo chicken liver bile acid binding protein",\N
6643,"6643","2005-08-16",\N,"Solution structure of human prolactin",\N
6644,"6644","2005-10-26","2015-04-13","1H, 13C, and 15N NMR assignments for AlgH, a putative transcriptional regulator from Pseudomonas aeruginosa",\N
6645,"6645","2005-12-14",\N,"1H, 13C and 15N backbone and side chain resonance assignments of Haloferax volcanii DHFR1",\N
6646,"6646","2005-10-26",\N,"1H, 15N and 13C backbone assignment of the firefly luciferase C-terminal 14.3 kDa domain",\N
6647,"6647","2005-10-27","2007-01-26","On the Importance of Carbohydrate-Aromatic Interactions for the Molecular Recognition of Chitooligosaccharides by Hevein Domains. NMR Studies of the Structure and Binding Affinity of AcAMP2-Like Peptides with non Natural Napthyl and Fluoroaromatic Residue",\N
6648,"6648","2006-04-27",\N,"Solution Structure of a Zap1 Zinc-Responsive Domain Provides Insights into Metalloregulatory Transcriptional Repression in Saccharomyces cerevisiae",\N
6649,"6649","2005-11-21","2005-12-05","Solution structure of the peptidoglycan binding domain of B. subtilis cell wall lytic enzyme CwlC: Characterization of the sporulation-related repeats by NMR",\N
6650,"6650","2007-09-26","2008-07-01","1H Chemical Shift Assignments for fragments of Sticholysin protein",\N
6651,"6651","2007-09-26","2008-07-01","1H Chemical Shift Assignments for fragments of Sticholysin protein",\N
6652,"6652","2005-08-18","2005-09-08","RNA helical packing in solution: NMR structure of a 30 kDa GAAA tetraloop receptor complex",\N
6653,"6653","2006-04-24",\N,"Solution Structure of a Zap1 Zinc-Responsive Domain Provides Insights into Metalloregulatory Transcriptional Repression in Saccharomyces cerevisiae",\N
6654,"6654","2006-02-23",\N,"Solution structure of Jingzhaotoxin-VII",\N
6655,"6655","2005-11-01",\N,"Solution Structure of the N-terminal Zinc Fingers of the Xenopus laevis double stranded RNA binding protein ZFa",\N
6656,"6656","2005-12-22",\N,"On the Importance of Carbohydrate-Aromatic Interactions for the Molecular Recognition of Chitooligosaccharides by Hevein Domains. NMR Studies of the Structure and Binding Affinity of AcAMP2-Like Peptides with non Natural Napthyl and Fluoroaromatic Residue",\N
6657,"6657","2005-12-22",\N,"On the Importance of Carbohydrate-Aromatic Interactions for the Molecular Recognition of Chitooligosaccharides by Hevein Domains. NMR Studies of the Structure and Binding Affinity of AcAMP2-Like Peptides with non Natural Napthyl and Fluoroaromatic Residue",\N
6658,"6658","2005-12-14","2011-06-16","NMR Solution Structure of a ldb1-LID:Lhx3-LIM complex",\N
6659,"6659","2005-12-14",\N,"15N hyperfine shifts assignment for wild-type rubredoxin from Clostridium pasteurianum in the oxidized state",\N
6660,"6660","2005-12-14",\N,"15N hyperfine shifts assignment for rubredoxin (V8A) from Clostridium pasteurianum in the oxidized state",\N
6661,"6661","2005-12-15",\N,"15N hyperfine shifts assignment for rubredoxin (V8A) from Clostridium pasteurianum in the reduced state",\N
6662,"6662","2005-12-16",\N,"15N hyperfine shifts assignment for wild-type rubredoxin from Clostridium pasteurianum in the reduced state",\N
6663,"6663","2005-12-16",\N,"15N hyperfine shifts assignment for rubredoxin (V8G)from Clostridium pasteurianum in the oxidized state",\N
6664,"6664","2005-12-16",\N,"15N hyperfine shifts assignment for rubredoxin (V8G) from Clostridium pasteurianum in the reduced state",\N
6665,"6665","2005-12-16",\N,"15N hyperfine shifts assignment for rubredoxin (V8G/V44G) from Clostridium pasteurianum in the oxidized state",\N
6666,"6666","2005-12-16",\N,"15N hyperfine shifts assignment for rubredoxin (V8G/V44G) from Clostridium pasteurianum in the reduced state",\N
6667,"6667","2005-12-20",\N,"15N hyperfine shifts assignment for rubredoxin (V8I) from Clostridium pasteurianum in the oxidized state",\N
6668,"6668","2005-12-21",\N,"15N hyperfine shifts assignment for rubredoxin (V8I) from Clostridium pasteurianum in the oxidized state",\N
6669,"6669","2005-12-21",\N,"15N hyperfine shifts assignment for rubredoxin (V8L) from Clostridium pasteurianum in the oxidized state",\N
6670,"6670","2005-12-22",\N,"15N hyperfine shifts assignment for rubredoxin (V8L) from Clostridium pasteurianum in the reduced state",\N
6671,"6671","2005-12-22",\N,"15N hyperfine shifts assignment for rubredoxin (V44A) from Clostridium pasteurianum in the oxidized state",\N
6672,"6672","2005-12-22",\N,"15N hyperfine shifts assignment for rubredoxin (V44A) from Clostridium pasteurianum in the reduced state",\N
6673,"6673","2005-12-22",\N,"15N hyperfine shifts assignment for rubredoxin (V44G)from Clostridium pasteurianum in the oxidized state",\N
6674,"6674","2005-12-22",\N,"15N hyperfine shifts assignment for rubredoxin (V44G)from Clostridium pasteurianum in the reduced state",\N
6675,"6675","2005-12-22",\N,"15N hyperfine shifts assignment for rubredoxin (V44I)from Clostridium pasteurianum in the oxidized state",\N
6676,"6676","2005-12-22",\N,"15N hyperfine shifts assignment for rubredoxin (V44I)from Clostridium pasteurianum in the reduced state",\N
6677,"6677","2005-12-22",\N,"15N hyperfine shifts assignment for rubredoxin (V44L) from Clostridium pasteurianum in the oxidized state",\N
6678,"6678","2005-12-22",\N,"15N hyperfine shifts assignment for rubredoxin (V44L) from Clostridium pasteurianum in the reduced state",\N
6679,"6679","2005-11-03",\N,"G311",\N
6680,"6680","2005-11-03",\N,"Backbone and sidechain 1H, 13C, and 15N Chemical Shift Assignments for A219",\N
6681,"6681","2005-12-28",\N,"Solution Structure Of GIP In TFE/Water",\N
6682,"6682","2005-07-27","2008-07-01","Solution Structure of a Human C2H2-type Zinc Finger Protein","/ftp/pub/bmrb/timedomain/bmr6682"
6683,"6683","2007-06-05",\N,"Backbone Resonance Assignments of Human Normal Adult Hemoglobin in the Deoxy Form",\N
6685,"6685","2005-11-07",\N,"NMR Structure of AlkB",\N
6686,"6686","2013-02-15",\N,"1H NMR assignments of the Ce2-TR1C complex at 298 K",\N
6687,"6687","2006-04-17",\N,"Solution structure of the N-terminal domain (M1-S98) of human centrin 2",\N
6688,"6688","2005-11-07",\N,"NMR chemical shift entry for protein Rv1980c (MPT64) from M. tuberculosis",\N
6689,"6689","2006-04-20",\N,"1H and 15N Chemical Shift Assignments for N-terminal domain of human centrin 1",\N
6690,"6690","2005-09-08","2007-01-26","Partial 1H, 13C, and 15N Chemical Shift Assignments for PSI AB box region in complex with U1-70k protein proline-rich peptide",\N
6691,"6691","2005-09-08","2007-01-26","Partial 1H, 13C, and 15N Chemical Shift Assignments for PSI AB box region in complex with U1-70k protein proline-rich peptide",\N
6692,"6692","2006-02-13","2007-02-05","1H, 13C, and 15N Chemical Shift Assignments for AppA 5-125",\N
6693,"6693","2006-04-06",\N,"Structure Determination of the Northeast Structural Genomics Consortium Target BoR11",\N
6695,"6695","2005-08-18","2005-11-10","Backbone 1H, 13C and 15N Chemical Shift Assignments for Ferredoxin-NADP+ Reductase",\N
6696,"6696","2006-04-05",\N,"G83N TPR domain of Ppp5",\N
6697,"6697","2006-04-27","2006-05-03","Backbone 1H, 13C, 15N and heavy atoms Chemical Shift Assignments for Tm3+ monosubstituted calbindin D9k",\N
6698,"6698","2008-10-27",\N,"The structured core of a largely unstructured protein, malarial merozoite surface protein 2 (MSP2), is amyloidogenic",\N
6699,"6699","2006-04-27","2006-05-03","Backbone 1H, 13C, 15N and heavy atoms Chemical Shift Assignments for La3+ monosubstituted calbindin D9k",\N
6700,"6700","2005-10-28",\N,"Resonance Assignments of 30 kDa complexes of TFIID subunit TAF1 with TATA-binding protein",\N
6702,"6702","2006-11-06",\N,"Resonance assignments of 30 kDa complexes of TFIID subunit TAF1 with TATA-binding protein",\N
6705,"6705","2005-11-07",\N,"Human beta-parvalbumin",\N
6707,"6707","2013-02-15",\N,"NMR assignments for apo- and Ca2+ saturated paramecium calmodulin",\N
6709,"6709","2006-03-10","2007-06-11","1H, 15N, 13C resonance assignment of the N-terminal domain of PilB from Neisseria meningitidis",\N
6710,"6710","2007-04-11",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for PB1 domain of P67phox",\N
6711,"6711","2005-09-08","2005-10-26","NMR assignment of Human Ubiquitin Conjugating Enzyme (Ubc7)",\N
6712,"6712","2006-02-13","2007-02-05","Solution structure of the two N-terminal CCP modules of C4b-binding protein (C4BP) alpha-chain",\N
6713,"6713","2007-04-11",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for PB1 domain of P40phox",\N
6714,"6714","2006-04-24",\N,"Solution structure of CSP1",\N
6715,"6715","2005-10-31","2007-01-29","Solution NMR Structure of the Membrane Protein Stannin",\N
6716,"6716","2006-04-25",\N,"Solution structure of the helicase-interaction domain of the primase DnaG: a model for helicase activation",\N
6717,"6717","2006-04-06",\N,"Solution NMR structure of the UPF0213 protein BH0048 from Bacillus halodurans. Northeast Structural Genomics target BhR2.",\N
6718,"6718","2006-04-24",\N,"NMR structure of the human dematin headpiece S74E mutant",\N
6719,"6719","2006-04-17","2007-01-29","Complex structure of the first WW domain of FBP11/HYPA and a -Pro-Pro-Leu-Pro- ligand reveals mechanism of Pro-rich ligand recognition by Group-II/III WW domains",\N
6720,"6720","2005-12-20",\N,"Solution Conformation of alpha-conotoxin PIA",\N
6721,"6721","2006-04-24",\N,"Solution structure of the first WW domain of FBP11",\N
6722,"6722","2005-11-07",\N,"Backbone NMR Assignment of low-molecular-weight Protein Tryosin Phosphatase (MPtpA) from Mycobacterium tuberculosis",\N
6723,"6723","2005-10-14",\N,"NMR structure of the heme chaperone CcmE reveals a novel functional motif",\N
6724,"6724","2006-04-05",\N,"Nuclear Magnetic Resonance Structure-Based Epitope Mapping and Modulation of Dust Mite Group 13 Allergen as a Hypoallergen",\N
6725,"6725","2005-10-27","2009-03-16","1H, 13C and 15N resonance assignments for domain III of the Dengue Virus envelope protein",\N
6726,"6726","2006-09-06",\N,"Solution structure of self-sacrificing resistance protein CalC from Micromonospora echinospora",\N
6727,"6727","2006-02-13",\N,"1H, 13C and 15N resonance assignments of telomeric repeat-binding domain of Arabidopsis thaliana",\N
6728,"6728","2006-08-15",\N,"NMR STRUCTURAL STUDIES OF A POTASSIUM CHANNEL/CHARYBDOTOXIN COMPLEX",\N
6729,"6729","2006-04-20",\N,"1H Chemical Shift Assignments for Diapause-Specific Peptide from the Leaf Beetle",\N
6730,"6730","2005-12-22","2007-02-05","Chemical shift assignments for Filamin a domain 17",\N
6731,"6731","2007-01-29",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for BOFC",\N
6732,"6732","2005-10-18","2012-12-07","The structure of human CD23 and its interactions with IgE and CD21",\N
6733,"6733","2005-10-18",\N,"The structure of human CD23 and its interactions with IgE and CD21",\N
6734,"6734","2005-10-18",\N,"The structure of human CD23 and its interactions with IgE and CD21",\N
6735,"6735","2005-10-18",\N,"The structure of human CD23 and its interactions with IgE and CD21",\N
6736,"6736","2005-10-20","2007-11-14","Backbone 1H, 13C, and 15N Chemical Shift Assignments for Pseudomonas Aeruginosa Protein Pa2021. The Northeast Structural Genomics Consortium Target Pat85.",\N
6737,"6737","2005-12-28",\N,"Curvacin A",\N
6738,"6738","2005-12-28",\N,"Solution structure of Sep15 from Drosophila melanogaster",\N
6739,"6739","2005-12-28",\N,"Solution structure of SelM from Mus musculus",\N
6740,"6740","2005-12-28","2007-02-06","NMR solution structure of the Crisp domain of Tpx-1",\N
6741,"6741","2007-03-27","2007-11-14","NMR Structure of Mini-B, an N-terminal - C-terminal construct from Surfactant Protein B (SP-B), in Sodium Dodecyl Sulfate (SDS) and Hexafluoroisopropanol (HFIP)",\N
6742,"6742","2005-09-08",\N,"De-ubiquitinating function of ataxin-3: insights from the solution structure of the Josephin domain",\N
6743,"6743","2006-10-19",\N,"1H, 13C, 15N Chemical Shift Assignments for CcdA Conformer a, b, and c",\N
6744,"6744","2006-03-10","2007-02-14","1H, 13C and 15N resonance assignments of the C-terminal domain of RP2",\N
6745,"6745","2005-12-20",\N,"Backbone 1H, 13C, and 15N chemical shift assignments of human HnRNP F",\N
6746,"6746","2006-02-23",\N,"Assignment of phnA-like protein rp4479",\N
6747,"6747","2006-02-23",\N,"Assignment of 50S ribosomal protein L40e",\N
6748,"6748","2005-12-05","2007-01-29","NMR assignments of the Ki67FHA/hNIFK(226-269)3P complex",\N
6749,"6749","2005-12-13",\N,"Solution structure of the NRSF/REST-mSin3B PAH1 complex",\N
6750,"6750","2006-04-27",\N,"Structural basis for cooperative transcription factor binding to the CBP coactivator",\N
6751,"6751","2005-08-22","2006-10-11","Solution Structure of Asl1650, an Acyl Carrier Protein from Anabaena sp. PCC 7120 with a Variant Phosphopantetheinylation-Site Sequence",\N
6752,"6752","2005-11-07","2007-01-29","Backbone and sidechain 1H, 13C, and 15N Chemical Shift Assignments for the PH-PDZ tandem of alpha syntrophin",\N
6753,"6753","2005-11-07","2007-01-29","Backbone 1H,13C, and 15N chemical shift assignments for the PH1 domain of alpha-syntrophin",\N
6754,"6754","2005-11-07","2007-01-29","Backbone and sidechain 1H, 13C, and 15N Chemical Shift Assignments for the PDZ domain of alpha syntrophin",\N
6755,"6755","2006-04-24",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for TA0743",\N
6756,"6756","2007-03-29",\N,"Solution structure of domain 6 from the ai5(gamma) group II intron",\N
6757,"6757","2006-04-24",\N,"1H and 13C Chemical Shift assignments for BVDV NS5A membrane anchor sequence [1-28]",\N
6758,"6758","2006-03-10","2007-02-14","NMR assignment of the E.coli cytolethal distending toxin CdtB-II subunit",\N
6759,"6759","2005-11-07",\N,"NEAT NMR Resonance Assignments",\N
6760,"6760","2006-03-10","2007-02-13","NMR assignment of the mTOR domain responsible for rapamycin binding",\N
6761,"6761","2006-04-27",\N,"SOLUTION STRUCTURE AND BACKBONE DYNAMICS OF AN N-TERMINAL UBIQUITIN-LIKE DOMAIN IN THE GLUT4-TETHERING PROTEIN, TUG",\N
6762,"6762","2006-03-31","2007-02-06","The response regulator TorI belongs to a new family of atypical excisionase",\N
6763,"6763","2006-03-10","2007-02-14","1H, 15N and 13C resonance assignments of the middle domain of human release factor eRF1",\N
6766,"6766","2006-04-24","2007-02-14","Complete assignment of a hypothetical protein pa0128 form Pseudomonas aeruginosa. Northeast Structural Genomics Consortium Target PaT1.",\N
6769,"6769","2006-04-24","2007-02-06","Complete assignments of a hypothetical protein NE2066, from Nitrosomonas_europaea. Northeast Structural Genomics Consortium Target NeT1.",\N
6771,"6771","2006-06-26",\N,"Solution structure of a \"retroevolved\" lambda Cro monomer reveals the basis for increased monomer stability and reduced dimerization",\N
6774,"6774","2007-03-27","2008-09-24","1H and Calpha assignments for bombinin H2",\N
6775,"6775","2007-03-27","2008-09-24","1H and Calpha assignments for bombinin H4",\N
6776,"6776","2006-06-27",\N,"Assignment of 1H, 15N and 13C resonances of the bacterial protein YFHJ",\N
6777,"6777","2005-08-29",\N,"Beta PIX-SH3 complexed with an atypical peptide from alpha-PAK",\N
6778,"6778","2013-02-15",\N,"NMR and molecular dynamics studies of the interaction of melatonin with calodulin",\N
6779,"6779","2005-10-18",\N,"Solution Structure of the type 1 pilus assembly platform FimD(25-125)",\N
6780,"6780","2005-12-20",\N,"NMR Assignment of HI1506, a novel two-domain protein from Haemophilus influenzae",\N
6781,"6781","2006-09-11",\N,"Resonance Assignments for the ADA2-like Swirm domain",\N
6782,"6782","2005-09-28",\N,"1H, 13C, and 15N Chemical Shift Assignments for E. coli protein YbiA","/ftp/pub/bmrb/timedomain/bmr6782"
6783,"6783","2006-03-10","2007-02-13","Backbone/Sidechain assignments for RKIP.",\N
6784,"6784","2005-10-19",\N,"KID domain",\N
6785,"6785","2005-12-20",\N,"Backbone resonance assignments for the Fv fragment of the catalytic antibody 6D9 complexed with a transition state analogue",\N
6786,"6786","2006-03-10","2007-02-14","1H, 13C and 15N resonance assignment of an oxidized form (Cys51-Cys198) of methionine sulfoxide reductase A from Escherichia coli",\N
6787,"6787","2006-04-14","2007-02-14","Backbone 1H, 13C, and 15N Chemical Shift Assignments for rabphilin C2A domain",\N
6788,"6788","2005-10-20",\N,"Ser133-phosphorylated KID domain",\N
6789,"6789","2013-02-15",\N,"Backbone 1H- and 15N-amide chemical shifts of apo-, (Ca2+)1- and (Ca2+)2-Eq04Q TR2C of bovine calmodulin, at 301K and pH 6.0.",\N
6790,"6790","2006-04-11","2007-01-29","Solution Structure of Stearoyl-ACP from Spinach",\N
6791,"6791","2008-06-24",\N,"Conformation of two oppositely functioning Allatostatin peptides for 2D NMR",\N
6792,"6792","2008-06-24",\N,"Conformation of two oppositely functioning Allatostatin peptides for 2D NMR",\N
6793,"6793","2006-09-06",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for Bacillus Subtilis Protein Ysne: The Northeast Structural Genomics Consortium Target SR220",\N
6794,"6794","2006-04-11","2007-02-14","L.mexicana ICP",\N
6796,"6796","2006-03-10","2007-02-15","NMR assignments of the dimeric S. aureus small multidrug-resistance pump in LPPG micelles",\N
6797,"6797","2006-04-11","2007-02-15","NMR assignment of the outer membrane lipoprotein (OmlA) from Xanthomonas axonopodis pv citri",\N
6798,"6798","2013-02-15",\N,"chemical shift values of the methyl groups of Met residues in the Ca2+-CaM-CaMKI-peptide complex",\N
6799,"6799","2006-09-05",\N,"Resonance Assignments for Methanococcus Maripaludis Protein Mmp0443: The Northeast Structural Genomics Consortium Target Mrr16",\N
6800,"6800","2006-11-06",\N,"NMR solution structure and backbone dynamics of tick-borne E-protein domain III Langat flavivirus",\N
6801,"6801","2007-04-11",\N,"1H, 13C, and 15N Chemical Shift Assignments for Human Small Ubiquitin-like Modifier Protein Isoform 2 (SUMO-2)",\N
6802,"6802","2013-02-15",\N,"Chemical shifts of the selected resonances in calmodulin alone and in complex with various sk-MLCK target peptides",\N
6803,"6803","2005-12-22",\N,"1H, 13C, and 15N Chemical Shift Assignments for the periplasmic signaling domain of FecA from Escherichia coli",\N
6804,"6804","2006-03-10","2007-02-15","Letter to the Editor:NMR assignments of the free and bound-state components of an anti-idiotypic affibody complex",\N
6805,"6805","2006-03-10","2007-02-15","Letter to the Editor: NMR assignments of the free and bound-state components of an anti-idiotypic affibody complex",\N
6806,"6806","2006-03-10","2007-02-15","Letter to the Editor: NMR assignments of the free and bound-state components of an anti-idiotypic affibody complex",\N
6807,"6807","2006-04-25",\N,"1H, 13C, and 15N chemical shift assignments for stereo-array isotope labelled (SAIL) maltodextrin-binding protein (MBP)",\N
6808,"6808","2006-04-24",\N,"1H, 13C, and 15N Chemical Shift Assignments for the N-terminal Peptide of Equinatoxin II",\N
6809,"6809","2006-04-27","2007-02-15","Backbone 1H,13C, and 15N chemical shift assignments for rabbitpox encoded viral chemokine inhibitor (vCCI)",\N
6810,"6810","2006-10-19","2007-11-14","Letter to the Editor: Assignment of 1H, 13C and 15N resonances of the last 250 residues in Escherichia coli RcsC, including the phosphoreceiver domain.",\N
6811,"6811","2006-02-23","2007-01-26","Solution structure of apoCadA",\N
6812,"6812","2006-06-28","2007-02-15","ta0938",\N
6814,"6814","2006-04-25","2007-01-29","Class I GTP aptamer",\N
6815,"6815","2008-06-24",\N,"NMR structure of Retrocyclin-2 in SDS",\N
6816,"6816","2005-12-23","2007-01-29","Solution structure of the C-terminal RpoN domain of aquifex aeolicus SIGMA-54 shows similarity to SIGMA-70",\N
6817,"6817","2005-11-21",\N,"Structure of cyclic conotoxin MII-7",\N
6818,"6818","2005-11-21",\N,"Structure of the cyclic conotoxin MII-6",\N
6820,"6820","2006-11-06","2007-01-03","Solution Structure Of The Calcium-loaded N-Terminal Sensor Domain Of Centrin",\N
6821,"6821","2005-12-23","2007-01-29","Human SOD before harboring the catalytic metal: Solution structure of copper depleted, disulfide reduced form",\N
6822,"6822","2006-10-19",\N,"The Structure of the Hamp Domain Implies a Rotational Mechanism in Transmembrane Signalling",\N
6823,"6823","2006-10-26","2007-11-14","Backbone and Sidechain chemical shift assignments of the Human Rhinovirus 3C Protease covalently complexed with a peptidyl inhibitor",\N
6824,"6824","2006-04-20","2007-01-29","1H, 13C, and 15N Chemical Shift Assignments for ORF 7a coded X4 protein of SARS Coronavirus",\N
6825,"6825","2013-02-15",\N,"1H Chemical Shifts of CaD Peptide in CaM/Peptide Mixture (1/30) at pH 6.5, 288 K.",\N
6826,"6826","2006-06-28","2006-11-03","Backbone 1H, 13C, and 15N Chemical Shift Assignments for N-terminal DNA recognition domain of the Bacillus subtilis of the transcription-state regulator Abh",\N
6827,"6827","2009-11-03",\N,"Structure function relationships of the polyhistidine rich peptide LAH4 in micellar environment;pH dependent mode of antibiotic action and DNA transfection",\N
6828,"6828","2006-04-20",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for MazF(E24A)",\N
6829,"6829","2006-10-17","2007-02-15","Chemical shift assignments for Chitin-binding Domain of Hyperthermophilic Chitinase from Pyrococcus furiosus",\N
6830,"6830","2013-02-15",\N,"1H, 13C Chemical shifts and pKa values in Ca2+-CaM and the CaM-cNOS peptide comlex.",\N
6831,"6831","2013-02-15",\N,"1H, 13C Chemical shifts and pKa values in Ca2+-CaM and the CaM-cNOS peptide comlex.",\N
6832,"6832","2006-08-07","2007-11-14","Comparative NMR study on the impact of point mutations on protein stability of Pseudomonas mendocina lipase",\N
6833,"6833","2006-04-20","2007-01-29","Backbone 1H, 13C, and 15N Chemical Shift Assignments for holo-MazF(E24A) with MazEp(54-77)",\N
6834,"6834","2005-12-23","2007-02-13","Solution Structure of the hSet2/HYPB SRI domain",\N
6835,"6835","2006-06-27",\N,"Structures of antimicrobial peptide Fowlicidin 1",\N
6836,"6836","2006-06-28",\N,"Solution Structure of HndAc : A Thioredoxin-like Domain Involved in the NADP-reducing Hydrogenase Complex.",\N
6837,"6837","2006-10-02","2007-02-15","NMR Assignments of L27 Heterodimer From C. Elegans Lin-7 and H. Sapiens Lin-2 Scaffold Proteins",\N
6838,"6838","2006-05-02","2011-04-01","1H, 13C and 15N backbone resonance assignment for PSE-4, a 29.5 kDa class A beta-lactamase from Pseudomonas aeruginosa",\N
6839,"6839","2005-10-19","2007-01-29","1H Chemical shift assignments for PV5 in DPC micelles",\N
6840,"6840","2006-04-24",\N,"15N 13C and 1H chemical shift assignments for the WIF domain of human WIF-1",\N
6841,"6841","2006-06-27",\N,"Solution structure of Calmodulin-like Skin Protein C terminal domain",\N
6843,"6843","2006-11-06","2007-11-14","Solution structure of the NOD1 Caspase Activating and Recruitment Domain",\N
6844,"6844","2009-10-20",\N,"Solution Structure of Drosophila melanogaster SNF RBD2",\N
6845,"6845","2005-12-28",\N,"NMR Structural analysis of archaeal Nop10",\N
6846,"6846","2005-12-28",\N,"NMR structural analysis of Nop10p from Saccharomyces cerevisiae",\N
6847,"6847","2006-04-20","2007-02-06","NMR assignments of a thioredoxin-like protein in the oxidized state",\N
6849,"6849","2005-11-03","2007-01-29","Crassostrea gigas defensin",\N
6850,"6850","2005-12-05","2007-01-29","First FF domain of the PRP40 yeast protein",\N
6851,"6851","2008-06-24","2008-06-24","Solution Structure of the human homodimeric DNA repair protein XPF.",\N
6853,"6853","2006-04-11","2007-02-15","Backbone Chemical Shift Assignment for TAP-N",\N
6854,"6854","2006-05-02","2006-05-03","1H, 13C, and 15N Chemical Shift Assignments for the first SH3 domain of Nck2",\N
6855,"6855","2005-10-20",\N,"Sequence specific assignment of SH3 domain B from human CIN85 protein",\N
6856,"6856","2006-04-24",\N,"1H, 13C, and 15N assignments for UDP-N-acetylmuramyl-pentapeptide (PG-P) bound to Peptidoglycan associated lipoprotein (pal) from Haemophilus influenzae or free",\N
6857,"6857","2006-04-20",\N,"Solution structure of an immunodominant epitope of myelin basic protein (MBP) - Conformational dependence on environment of an intrinsically unstructured protein",\N
6858,"6858","2006-04-24",\N,"1H, 13C, and 15N assignments for UDP-N-acetylmuramyl-pentapeptide (PG-P) bound to Peptidoglycan associated lipoprotein (pal) from Haemophilus influenzae or free",\N
6859,"6859","2006-04-24",\N,"1H chemical shift assignments for peptide P2",\N
6860,"6860","2005-10-20","2009-07-02","Chemical shift assignments of the human ortholog of tRNA endonuclease subunt SEN15","/ftp/pub/bmrb/timedomain/bmr6860"
6861,"6861","2008-11-12",\N,"Selected chemical shifts in apo N-CamY",\N
6862,"6862","2008-11-12",\N,"Selected chemical shifts in Ca2+ bound N-CamY",\N
6863,"6863","2005-12-16",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for Mengovirus Leader polypeptide",\N
6864,"6864","2006-04-14","2007-02-15","1H, 13C and 15N resonance assignments of a repeat domain of the egg case silk from Nephila antipodiana",\N
6865,"6865","2006-08-07",\N,"1H, 13C, and 15N chemical shift assignments for P. falciparum TRAP-TSR domain",\N
6866,"6866","2005-10-24","2009-07-02","chemical shift assignments of the human sorting nexin 22","/ftp/pub/bmrb/timedomain/bmr6866"
6867,"6867","2005-12-28",\N,"Solution structure of micelle-bound fusion domain of HIV-1 gp41",\N
6868,"6868","2006-04-17",\N,"Solution Structure of ydhR protein from Escherichia coli",\N
6869,"6869","2007-03-28","2007-11-15","Solution Structure of C-Terminal 14 kDa Domain of the tau subunit from Escherichia coli DNA Polymerase III",\N
6870,"6870","2008-09-19","2013-05-21","Probing the conformation and dynamics of allatostatin neuropeptides: a structural model for functional differences.",\N
6872,"6872","2005-12-23","2008-09-24","Solution structure of kalata B8",\N
6873,"6873","2006-05-02","2007-02-15","1H, 15N and 13C chemical shift assignments of pleckstrin's C-terminal PH domain",\N
6874,"6874","2006-06-26",\N,"Structural diversity in CBP/p160 complexes",\N
6875,"6875","2006-11-06","2012-10-16","Solution structure of a biologically active human FGF-1 monomer, complexed to a hexasaccharide heparin-analogue",\N
6876,"6876","2006-10-02","2007-01-29","1H, 15N and 13C chemical shifts of T. cruzi Chagasin",\N
6877,"6877","2006-03-10","2010-07-15","NMR assignments of the Human Papillomavirus type 16 E2C DNA-bound form",\N
6878,"6878","2007-03-28",\N,"Backbone 1H and 13C Chemical Shifts Assignemts for putative TM7 from V-ATPase subunit a",\N
6879,"6879","2006-02-17",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignment for aKv1.1N",\N
6880,"6880","2005-12-14","2007-11-15","1H, 13C and 15N chemical shift assignments of Schistocerca gregaria chymotrypsin inhibitor at pH=6.0",\N
6881,"6881","2005-12-14","2007-11-15","1H, 13C and 15N chemical shift assignments of Schistocerca gregaria chymotrypsin inhibitor complexed with bovine chymotrypsin",\N
6882,"6882","2006-04-24",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for the extracellular sushi domain of the Interleukin-15 receptor",\N
6883,"6883","2007-11-29",\N,"Ufd1",\N
6884,"6884","2007-04-11",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for Bacillus subtilis Acylphosphatase",\N
6885,"6885","2006-11-06","2007-02-15","Assignment of 1H and 15N chemical shifts for the Ig1 module of FGFR1",\N
6886,"6886","2009-11-03","2009-12-11","Structure-function relationships of the polyhistidine-rich peptide LAH4 in micellar environments; pH dependent mode of antibiotic action and DNA transfection",\N
6887,"6887","2005-12-22","2007-01-29","assignment of hormaomycin in dmso",\N
6888,"6888","2006-04-05","2007-02-06","1H, 15N Assignment of Neocarzinostatin Apo-Protein complexed with Flavone",\N
6890,"6890","2006-04-27",\N,"Structural Determinants for High Affinity Binding in a Nedd4 WW3* Domain - Comm PY Motif Complex",\N
6891,"6891","2006-02-23",\N,"Solution structure of MrIA",\N
6892,"6892","2006-04-20",\N,"Structure and influence on stability and activity of the N-terminal propetide part of lung surfactant protein C",\N
6893,"6893","2006-04-20",\N,"Bovine Fibrinogen alpha-C Domain",\N
6894,"6894","2009-10-13",\N,"New insights into binding of the possible cancer target RalGDS",\N
6895,"6895","2006-02-23",\N,"NMR Structure of the RNA Binding Domain of Human Fox-1 in Complex with UGCAUGU",\N
6896,"6896","2006-04-26","2007-02-06","Solution structure of [Sec2,3,8,12]-ImI",\N
6897,"6897","2006-04-26","2007-02-06","Solution structure of [Sec2,8]-ImI",\N
6898,"6898","2006-04-26","2007-02-06","NMR structure of the peptide linked to the genome (VPg) of poliovirus",\N
6899,"6899","2006-04-27",\N,"Native PAH2 domain of Mm. mSin3B",\N
6900,"6900","2006-03-10","2007-02-15","15N, 13C and 1H resonance assignments for the C-terminal MA-3 domain of the tumour suppressor protein Pdcd4",\N
6901,"6901","2006-02-23","2007-01-29","1H, 13C, and 15N Chemical Shift Assignments for DUSP domain of HUSP15",\N
6902,"6902","2006-04-24","2007-06-19","Complete 1H and 15N assignment of the FK506-binding domain of human FKBP38",\N
6903,"6903","2005-12-15","2007-01-09","1H, 13C and 15N resonance assignment of M-crystallin: a novel Ca2+ binding protein of the bg-crystallin superfamily from Methanosarcina acetivorans",\N
6904,"6904","2005-12-15","2008-09-02","1H, 13C and 15N resonance assignment of M-crystallin: a novel Ca2+ binding protein of the bg-crystallin superfamily from Methanosarcina acetivorans",\N
6905,"6905","2006-04-27",\N,"Solution Structure of a Zap1 Zinc-Responsive Domain Provides Insights into Metalloregulatory Transcriptional Repression in Saccharomyces cerevisiae",\N
6906,"6906","2006-04-27","2010-07-14","1H, 13C, and 15N Chemical Shift Assignments for the Bicoid Homedomain",\N
6907,"6907","2007-07-10",\N,"Chemical Shift Assignments for V66W110 fragment of Staphylococcal Nuclease",\N
6908,"6908","2007-07-10",\N,"1H, 13C, and 15N Chemical Shift Assignments for SNase110 fragment of Staphylococcal Nuclease in 2M TMAO",\N
6909,"6909","2006-04-20","2007-02-06","1H and 15N Chemical Shift Assignments for the Alpha-domain of Human Metallothionein-3",\N
6910,"6910","2006-04-14","2007-02-15","1H,13C,15N chemical shift assignment for SMP-1 (Small Myrisoylated Protein-1) from Leishmania",\N
6911,"6911","2006-05-02","2007-02-16","13C, 15N and 1H assignment of the PDZ1 domain of hMAGI-1 using QUASI\"",\N
6912,"6912","2006-04-14","2007-02-16","1H, 13C, and 15N Resonance Assignments for the reduced form of Thioredoxin 1 from Sacharomyces cerevisae",\N
6913,"6913","2006-04-14","2011-06-16","'1H, 13C and 15N Resonance Assignments for the Reduced Form of Thioredoxin 2 from Saccharomyces cerevisiae'",\N
6914,"6914","2006-04-26","2007-02-16","Solution structure of the Wilson ATPase N-domain in the presence of ATP",\N
6915,"6915","2009-05-27",\N,"1H and 15N Chemical Shift Assignments of Recombinant Dendroaspin",\N
6916,"6916","2006-05-02","2007-11-15","NMR structure of the C-terminal domain (dimer) of HPV45 oncoprotein E7",\N
6917,"6917","2006-01-23",\N,"Backbone assignments of Pyrococcus furiosus Pop5 (PF1378), an archaeal RNase P protein.",\N
6918,"6918","2005-12-16","2007-01-29","Backbone 1H, 13C, and 15N Chemical Shift Assignments for CRC-N (algal centrin N-term)",\N
6919,"6919","2005-12-16","2007-02-13","Letter to the Editor: 1H, 13C and 15N resonance assignments of the region 655-775 of the human MAN1",\N
6920,"6920","2006-04-27",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for Mid1 BBox 1",\N
6921,"6921","2009-05-27",\N,"Backbone and side chain chemical shift assignments for hydrophilic domain of human cytochrome b5",\N
6922,"6922","2006-04-20","2007-02-06","Solution structure of the Vts1 SAM domain in the presence of RNA",\N
6923,"6923","2006-04-05","2007-01-29","Backbone 1H, 13C, and 15N resonance assignments of the N-terminal domain of FKBP38 (FKBP38NTD)",\N
6924,"6924","2006-04-05",\N,"1H chemical shifts for discrepin, a scorpion toxin that blocks IA currents of the voltage dependent K+ channels",\N
6925,"6925","2006-11-06",\N,"Backbone and Beta 1H, 13C, and 15N Chemical Shift Assignments for the Bacterial Toxin Kid",\N
6926,"6926","2005-12-23","2009-07-02","Chemical Shift Assignments of Thylakoid Soluble Phosphoprotein of 9 kDa","/ftp/pub/bmrb/timedomain/bmr6926"
6927,"6927","2006-05-02","2007-02-16","Spinophilin PDZ domain",\N
6928,"6928","2006-05-02","2007-02-16","1H, 13C, and 15N NMR Assignment of the Rep Protein Nuclease Domain from the Porcine Circovirus PCV2",\N
6929,"6929","2006-04-05",\N,"1H, 13C, and 15N Chemical Shift Assignments for Nitrosomonas Europaea Protein Ne2328: Northeast Structural Genomics Consortium target NeT3",\N
6930,"6930","2009-10-20",\N,"NMR assignments of SNF RBD1",\N
6931,"6931","2006-06-13",\N,"Chemical Shift Assignments of Lm-FABP in complex with oleate",\N
6932,"6932","2006-05-02",\N,"Chemical shift assignments of phosphoryl carrier domain of pyruvate phosphate dikinase",\N
6933,"6933","2007-04-11",\N,"Complete Chemical Shift Assignment for the Neurabin PDZ Domain",\N
6934,"6934","2006-06-28","2007-02-06","1H, 15N, and 13C Assigned Chemical shift for Wzb",\N
6935,"6935","2006-08-07","2007-11-15","Comparative NMR study on the impact of point mutations on protein stability of Pseudomonas mendocina lipase",\N
6936,"6936","2006-04-14","2007-02-16","Resonance assignments for the pKM101 homologue of VirB7 (TraN) in complex with the pKM101 homologue of VirB9 (TraO)",\N
6938,"6938","2006-05-02","2007-02-16","1H, 13C and 15N NMR assignment of the region 51-160 of human KIN17 protein",\N
6939,"6939","2006-04-05",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for Ubiquitin Specific Protease 7",\N
6940,"6940","2006-06-26","2007-02-16","NMR assignment of the 2H, 13C, 15N labeled amino-terminal domain of apo-pantothenate synthetase from E.coli.",\N
6941,"6941","2006-04-05","2007-01-29","'1H, 13C, and 15N Chemical Shift Assignments for Ac-Dab-Dab-(Ala)7-Orn-Orn-NH2 where Dab-diaminobutyric acid; Orn - ornithine'",\N
6942,"6942","2006-08-07","2007-02-09","1H, 13C, and 15N Chemical Shift Assignments for Myristoylated neuronal calcium sensor-1",\N
6943,"6943","2006-08-07","2007-02-09","Resonance Assignment of Bombyx mori Chemosensory Protein 1",\N
6944,"6944","2006-08-11","2007-02-16","Resonance assignment for the N-terminal region of eukaryotic initiation factor 5 (eIF5)",\N
6945,"6945","2006-09-07",\N,"solution structure of PSD-1",\N
6946,"6946","2006-11-07",\N,"Solution structure of free form of the GTP/GDP binding domain of translation initiation factor IF2",\N
6947,"6947","2006-05-09","2007-02-06","Backbone 1H, 13C, and 15N Chemical Shift assignments for dimeric E.coli Ferric Uptake Regulator (Fur)",\N
6948,"6948","2006-05-09","2007-02-06","Backbone 1H, 13C, and 15N Chemical Shift assignments for monomeric E. coli Ferric Uptake Regulator (Fur).",\N
6949,"6949","2006-08-07",\N,"Domain 2 of receptor-associated protein",\N
6950,"6950","2006-09-11","2007-02-13","domain 3 of RAP",\N
6951,"6951","2006-08-07",\N,"Solution structure of conotoxin pl14a",\N
6952,"6952","2006-04-26",\N,"Violacin A",\N
6953,"6953","2007-09-24","2007-10-15","NMR solution of rabbit Prion Protein (91-228)",\N
6954,"6954","2006-04-26",\N,"NMR structure of influenza HA fusion peptide mutant W14A in DPC in pH5",\N
6955,"6955","2006-11-06",\N,"Solution Structure of the gene product of E. coli gene ydhA",\N
6956,"6956","2006-04-26",\N,"RNA recognition by the Vts1 SAM domain",\N
6957,"6957","2006-03-29","2009-07-02","Solution structure of the SCAN homodimer from MZF-1/ZNF42","/ftp/pub/bmrb/timedomain/bmr6957"
6960,"6960","2006-04-26",\N,"Target Structure-Based Discovery of Small Molecules that Block Human p53 and CREB Binding Protein (CBP) Association",\N
6962,"6962","2006-04-11","2007-01-29","Resonance Assignments of 10:0-ACP",\N
6963,"6963","2006-06-28","2007-11-16","1H Chemical Shift Assignments for the Second Kunitz domain of human WFIKKN1, Pro61 in cis- or trans- conformation",\N
6964,"6964","2006-03-29",\N,"NMR Structure of the Rpa2829 protein from Rhodopseudomonas palustris: Northeast Structural Genomics Consortium Target RpR43",\N
6965,"6965","2006-04-26","2006-06-13","1H and 15N assignment of the soluble domain of the ba3 oxidase subunit II of Thermus thermophilus in the oxidized state",\N
6966,"6966","2006-04-27","2007-02-16","1H and 15N assignment of cytochrome c552 from Thermus thermophilus in the reduced state",\N
6967,"6967","2006-04-27","2007-02-16","1H and 15N assignment of cytochrome c552 from Thermus thermophilus in the oxidized state",\N
6968,"6968","2006-04-27","2014-07-17","1H, 13C and 15N assignment of C', CA, CB, N, HN, HA and HB of intrinsically disordered alpha-synuclein",\N
6969,"6969","2006-04-27",\N,"Chemical Shift Assignment for SARS-CoV S2-HR2",\N
6970,"6970","2006-08-07","2007-02-09","1H, 15N, 13C assignments for the activated form of the small Rho-GTPase Rac1",\N
6971,"6971","2006-08-07","2007-02-09","NMR assignment of the b' domain of thermophilic fungal protein disulfide isomerase",\N
6972,"6972","2006-08-07","2007-02-09","NMR assignment of the a' domain of thermophilic fungal protein disulfide isomerase",\N
6973,"6973","2006-05-03","2013-07-26","human p23(1-119)",\N
6974,"6974","2006-05-03","2007-02-07","Human p23(1-160)",\N
6975,"6975","2006-04-27","2010-07-16","1H chemical shift assignments for Bcl2MidG4",\N
6976,"6976","2006-04-06",\N,"Solution NMR structure of the UPF0346 protein yozE from Bacillus subtilis. Northeast Structural Genomics target SR391.",\N
6979,"6979","2006-06-26",\N,"An Alternating Sheared AA Pair and Elements of Stability for a Single Sheared Purine-Purine Pair Flanked by Sheared GA Pairs",\N
6980,"6980","2006-03-29","2009-07-02","Chemical Shift Assignment of human allograft inflammatory factor I","/ftp/pub/bmrb/timedomain/bmr6980"
6981,"6981","2006-05-03","2007-02-07","Solution Structure of Monomeric BsaL, the Type III Secretion Needle Protein of Burkholderia pseudomallei",\N
6982,"6982","2006-11-06","2007-11-16","Solution Structure of TA0895, an MoaD homologue from Thermoplasma acidophilum",\N
6983,"6983","2006-04-27",\N,"'Backbone 1H, 13C, 15N, and 13CB Chemical Shift Assignments for Azide-Inhibited P. aeruginosa Heme Oxygenase'",\N
6984,"6984","2006-12-22",\N,"1H, 13C, and 15N Chemical Shift Assignments of the cAMP-Binding Domain A of the PKA Regulatory Subunit",\N
6985,"6985","2006-09-07","2007-02-16","Backbone 1H, 13C, and 15N Chemical Shift Assignments for the human Hexim1 TBD.",\N
6986,"6986","2006-06-28","2007-02-16","NMR ASSIGNMENT OF THE PHOSPHOTYROSINE BINDING(PTB) DOMAIN OF TENSIN",\N
6987,"6987","2006-04-27",\N,"Backbone 1H, 13C, 15N, and 13CB Chemical Shift Assignments for Cyanide-Inhibited P. aeruginosa Heme Oxygenase",\N
6988,"6988","2006-06-28",\N,"1H, 13C, and 15N Chemical Shift Assignments for HGB1-UBA",\N
6989,"6989","2007-03-06",\N,"1H, 13C, and 15N Chemical Shift Assignments for Ribosomal Protein S24E",\N
6990,"6990","2006-08-07","2009-09-28","1H, 15N and 13C resonance assignments of the cerato-platanin, a phytotoxic protein from Ceratocystis fimbriata",\N
6991,"6991","2007-06-20",\N,"Phosphorylation of Cytoplasmic Tail of Tissue Factor and its Role in Modulating",\N
6992,"6992","2006-04-27",\N,"Three-dimensional structure of the bacterial cell wall peptidoglycan",\N
6993,"6993","2007-06-20",\N,"Phosphorylation of Cytoplasmic Tail of Tissue Factor and its Role in Modulating Structure and Binding Affinity.",\N
6995,"6995","2006-11-07",\N,"Solution structure of GDP-bound form of the GTP/GDP binding domain of translation initiation factor IF2",\N
6996,"6996","2007-06-20",\N,"Phosphorylation of Cytoplasmic Tail of Tissue Factor and its Role in Modulating Structure and Binding Affinity.",\N
6997,"6997","2006-04-27","2007-02-07","Structural Insights of the Specificity and Catalysis of a Dimeric Viral SET Domain Histone H3 Lysine-27 Methyltransferase",\N
6998,"6998","2007-06-20",\N,"Phosphorylation of Cytoplasmic Tail of Tissue Factor and its Role in Modulating Structure and Binding Affinity.",\N
6999,"6999","2006-09-22","2007-02-16","KorA",\N
7000,"7000","2006-04-05","2006-09-06","Solution structure of the conserved hypothetical protein Rv2302 from the bacterium Mycobacterium tuberculosis",\N
7001,"7001","2006-10-19",\N,"Structure of the Phosphorylation Motif of the oncogenic Protein beta-Catenin Recognized By a Selective Monoclonal Antibody",\N
7002,"7002","2006-04-27",\N,"1H, 13C, and 15N Chemical Shift Assignments for the Ede1 UBA-ubiquitin complex",\N
7003,"7003","2006-08-07","2007-02-09","NMR backbone assignment of the human HSP90 N-terminal domain",\N
7004,"7004","2006-03-29",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for Rhodopseudomonas palustrus protein Rpa0253. Northeast structural genomics target RpR3.",\N
7005,"7005","2006-10-19",\N,"The PP-fold Solution Structure of Human Polypeptide YY and Human Polypeptide YY 3-36 as Determined by NMR",\N
7006,"7006","2006-10-19",\N,"Structure of human PYY",\N
7007,"7007","2006-03-10","2009-06-30","Solution structure of At5g39720.1 from Arabidopsis thaliana","/ftp/pub/bmrb/timedomain/bmr7007"
7008,"7008","2006-04-11",\N,"Second Ca2+ binding domain of the Na,Ca-exchanger (NCX1)",\N
7009,"7009","2006-04-11",\N,"First Ca2+ binding domain of the Na,Ca-exchanger (NCX1)",\N
7010,"7010","2006-11-17",\N,"Solution Structure and Immune Response to an Epidermal Growth Factor Domain from Plasmodium Falciparum Merozoite Surface Protein 1",\N
7011,"7011","2006-09-07","2007-11-16","Solution structure of 97-109 segment of staphylococcal nuclease",\N
7012,"7012","2006-09-07","2007-11-16","Solution structure of 55-72 segment of staphylococcal nuclease",\N
7013,"7013","2006-03-31","2008-09-08","1H, 15N, 13C resonance assignments for Bcl-xL protein 38 kDa dimer",\N
7014,"7014","2006-08-09","2007-02-09","NMR assigment of the SARS-CoV protein nsp1",\N
7015,"7015","2013-02-15",\N,"NMR assignments for apo- and Ca2+ saturated paramecium calmodulin",\N
7016,"7016","2013-02-15",\N,"Backbone 1H- and 15N-amide chemical shifts of apo-, (Ca2+)1- and (Ca2+)2-Eq04Q TR2C of bovine calmodulin, at 301K and pH 6.0.",\N
7017,"7017","2013-02-15",\N,"Backbone 1H- and 15N-amide chemical shifts of apo-, (Ca2+)1- and (Ca2+)2-Eq04Q TR2C of bovine calmodulin, at 301K and pH 6.0.",\N
7018,"7018","2013-02-15",\N,"chemical shift values of the methyl groups of Met residues in the Ca2+-CaM-CaMKI-peptide complex",\N
7019,"7019","2007-02-14",\N,"NMR assignment of the protein nsp3a from SARS-CoV",\N
7020,"7020","2006-09-22",\N,"Chemical Shift Assignments for a Subunit of RNA Polymerase II",\N
7021,"7021","2007-02-09",\N,"Backbone dynamics and domain motions of the Mip protein from legionella pneumophilia in solution",\N
7022,"7022","2006-08-07","2007-02-09","Letter to the Editor: 1H, 13C and 15N backbone resonance assignments of DUF589 domain from human HSPC144 protein",\N
7023,"7023","2006-06-26","2007-02-16","Assignment of 1H,13C and 15N resonances for the REF2-I mRNA export factor",\N
7024,"7024","2006-08-07","2007-02-09","Resonance assignments of the 34kD rabbitpox vCCI:human MIP-1b complex",\N
7025,"7025","2006-10-02","2007-02-16","1H, 13C, and 15N Resonance Assignments of the VAP-A: OSBP Complex",\N
7028,"7028","2013-02-15",\N,"Chemical shifts of the selected resonances in calmodulin alone and in complex with various sk-MLCK target peptides",\N
7029,"7029","2013-02-15",\N,"Chemical shifts of the selected resonances in calmodulin alone and in complex with various sk-MLCK target peptides",\N
7030,"7030","2013-02-15",\N,"Chemical shifts of the selected resonances in calmodulin alone and in complex with various sk-MLCK target peptides",\N
7031,"7031","2013-02-15",\N,"Chemical shifts of the selected resonances in calmodulin alone and in complex with various sk-MLCK target peptides",\N
7032,"7032","2007-09-24",\N,"NMR Solution Structure, Dynamics and Binding Properties of the Kringle IV Type 8 module of apolipoprotein(a)",\N
7033,"7033","2010-05-27",\N,"GSPT1/eRF3a(PAM2-2)-PABC complex",\N
7034,"7034","2006-04-05","2009-10-19","1H, 13C, and 15N chemical shift assignments for the zinc-finger region of human ZHX1",\N
7035,"7035","2007-09-24",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for 2nd SH3 domain of human NCK2 adaptor protein",\N
7036,"7036","2007-09-24",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for 3rd SH3 domain of human NCK2 adaptor protein",\N
7049,"7049","2006-08-31",\N,"1H chemical shifts of the fifth transmembrane segment of Na,K-ATPase in SDS micelles",\N
7050,"7050","2007-04-11",\N,"Solution structure of growth-blocking peptide of the cabbage armyworm, Mamestra brassicae",\N
7051,"7051","2007-04-11",\N,"Solution structure of growth-blocking peptide of the tobacco cutworm, Spodoptera litura",\N
7053,"7053","2006-06-28","2007-02-16","1H, 13C and 15N resonance assigned of a first cysteine catalytic half-domain of mouse ubiquitin-activating enzyme E1.",\N
7054,"7054","2006-04-24",\N,"NMR chemical shift assignments and structure determination of Xanthomonas campestris XCC1710: Northeast Structural Genomics Consortium Target XcR35",\N
7055,"7055","2006-08-07","2007-02-09","1H, 13C, and 15N Chemical Shift Assignments for PTH from Mycobacterium tuberculosis H37Rv",\N
7056,"7056","2007-03-09",\N,"1H, 13C, 15N assignments of an independently folded C-terminal domain of influenza polymerase subunit PB2",\N
7057,"7057","2008-10-27",\N,"Chemical Shift Assignment for hbSBD",\N
7058,"7058","2006-06-27","2008-07-07","'Backbone 1H, 13C, and 15N Chemical Shift Assignments for calponin homology domain of human MICAL_1",\N
7059,"7059","2006-10-02","2007-02-16","1H, 13C, and 15N Resonance Assignments of the Pyrazinamidase from Mycobacterium Tuberculosis",\N
7061,"7061","2006-04-27","2007-02-07","NMR structure of talin-PTB in complex with PIPKI",\N
7063,"7063","2007-02-01",\N,"Solution NMR structure of the putative cytoplasmic protein ygaC from Salmonella typhimurium. Northeast Structural Genomics target StR72.",\N
7064,"7064","2006-09-07","2008-07-07","Cycloviolacin O14",\N
7065,"7065","2007-09-24",\N,"Solution conformation of gaegurin4",\N
7066,"7066","2007-09-24","2008-07-07","Structure of the Cadmium metal-sensor CmtR from Mycobacterium tuberculosis",\N
7067,"7067","2006-11-17","2012-12-07","Human Nogo-A functional domain: nogo60",\N
7068,"7068","2006-09-07","2008-07-07","Solution structure and intermolecular interactions of the Copper form of third metal-binding domain of ATP7A, the menkes disease protein",\N
7069,"7069","2006-09-07","2008-07-07","Solution structure and intermolecular interactions of the apo form of third metal-binding domain of ATP7A, the menkes disease protein",\N
7070,"7070","2006-12-04","2007-02-16","RRMs 1 and 2 of Prp24 from S. cerevisiae",\N
7071,"7071","2007-04-11","2008-07-07","Backbone and Beta 1H, 13C, and 15N Chemical Shift Assignments for the Bacterial Antitoxin Kis",\N
7072,"7072","2006-04-24","2008-07-07","Backbone 1H, 13C, and 15N Chemical Shift Assignments for the PDZ domain of GOPC",\N
7073,"7073","2006-06-27","2008-07-07","Structure Determination of a New Protein (PF1455) from Backbone-Centered NMR Data and NMR-Assisted Structure Prediction",\N
7074,"7074","2006-06-28","2011-09-23","1H, 13C and 15N chemical shift assignments of the protein Pf0610 from pyrococcus furiosus",\N
7075,"7075","2006-10-20",\N,"Assignment of conserved hypothetical protein pa2412",\N
7078,"7078","2006-09-08","2008-07-08","1H Chemical Shift Assigments for a Potent Bowman-Birk Inhibitor from Lentil seeds",\N
7079,"7079","2006-11-06",\N,"Sequence specific assignment of a hypothetical protein RP2812 (NESG ID: RPT4) from Rhodopseudomonas palustris",\N
7080,"7080","2006-10-31","2008-07-08","Complex of TM1a(1-14)Zip with TM9a(251-284): a model for the polymerization domain (\"overlap region\")of tropomyosin",\N
7081,"7081","2007-04-11","2008-07-08","1H, 13C, and 15N Chemical Shift Assignment of the N-terminal domain of LANP",\N
7082,"7082","2009-05-27",\N,"1H, 13C, and 15N assignments for the Psuedomonas putida protein PutA45",\N
7083,"7083","2007-05-02","2008-07-08","Chemical shifts of SBD from Rhizopu oryzae glucoamylase",\N
7084,"7084","2006-06-28","2009-06-23","Dr13312 chemical shift data","/ftp/pub/bmrb/timedomain/bmr7084"
7085,"7085","2006-10-20",\N,"Assignment of hypothetical protein yst6499",\N
7086,"7086","2006-10-20",\N,"Assignment of hypothetical protein tm1012",\N
7087,"7087","2006-10-02","2007-02-16","1H, 13C and 15N Assignments of the Dengue-4 Envelope Protein Domain III",\N
7088,"7088","2006-11-21",\N,"dynamics within the fMet-tRNA binding domain of translation initiation factor IF2 from Bacillus stearothermophilus",\N
7089,"7089","2007-05-02",\N,"1H, 13C, and 15N Peak Assignments of Human Macrophage Metalloelastase, in its inhibitor-free state",\N
7090,"7090","2007-04-27",\N,"Solution structure of a purine rich hexaloop hairpin belonging to PGY/MDR1 mRNA and targeted by antisense oligonucleotides",\N
7091,"7091","2006-06-28","2008-07-29","Backbone 1H, 13C, and 15N Chemical Shift Assignments for GroES",\N
7092,"7092","2007-05-04","2008-07-15","Chemical shifts of Vigna radiata Defensin 2 from Mung bean",\N
7093,"7093","2007-11-21","2008-07-15","Chemical shift assignment of monomeric chorimate mutase from methanococcus jannaschii in a complex with a transition state analog",\N
7094,"7094","2006-10-30","2007-01-26","1H and 15N Chemical Shift Assignments for the Acylphosphatase from Eschaerichia Coli",\N
7095,"7095","2007-09-17","2008-07-15","Solution structure of BC059385 from Homo sapiens",\N
7097,"7097","2006-09-22","2010-07-14","DNA recognition by the Brinker nuclear repressor - an extreme case of the coupling between binding and folding",\N
7098,"7098","2006-06-28","2007-02-07","Linear dimer of stemloop SL1 from HIV-1",\N
7099,"7099","2006-09-22","2008-07-16","NMR Solution Structure of VP9 from White Spot Syndrome Virus",\N
7101,"7101","2006-11-17",\N,"Mistranslation of a computationally designed protein yields an exceptionally stable homodimer: Implications for protein evolution and engineering.",\N
7102,"7102","2007-04-16",\N,"High-resolution structural and thermodynamic analysis of extreme stabilization of human procarboxypeptidase by computational protein design",\N
7103,"7103","2006-11-14",\N,"1H, 15N and 13C assignments of the H98S mutant of acireductone dioxygenase from Klebsiella ATCC 8724",\N
7104,"7104","2007-05-07","2009-09-02","1H and 15N Chemical Shift Assignments for the NCAM F3 module 2.",\N
7105,"7105","2006-08-07","2010-07-14","1H, 13C and 15N chemical shift assignments for SRY.B in complex with 16-mer DNA",\N
7106,"7106","2006-08-15","2007-02-16","NMR Assignment of human RGS18 (regulator of G-protein signalling)",\N
7107,"7107","2006-09-11",\N,"1H, 13C and 15N Chemical Shift Assignments for human Keratinocyte Fatty-acid binding protein with potent small molecule inhibitor (BMS-480404)",\N
7108,"7108","2008-06-23",\N,"1H, 13C and 15N chemical shift assignments for TrxA (reduced form) from Bacillus subtilis",\N
7109,"7109","2008-06-23",\N,"1H, 13C and 15N chemical shift assignments for TrxA (oxidized form) from Bacillus subtilis",\N
7110,"7110","2006-06-28","2008-08-28","1H, 13C, 15N CHEMICAL SHIFT FOR CBP BROMODOMIAN",\N
7111,"7111","2006-08-15",\N,"Chemical shift assignment of multicrystalline ubiquitin using solid state MAS NMR spectroscopy",\N
7112,"7112","2006-11-13","2008-07-16","1H, 13C, and 15N NMR Assignment of the Master-Rep Protein Nuclease Domain (2-95) from the Faba Bean Necrotic Yellows Virus",\N
7113,"7113","2009-05-27",\N,"Chemical Shift Assignments for the First Immunoglobulin Domain of Myotilin",\N
7114,"7114","2006-11-01",\N,"1H, 13C, and 15N chemical shift assignment of Escherichia coli Maltose Binding Protein complexed with Beta-Cyclodextrin",\N
7115,"7115","2006-09-11","2007-02-16","1H, 13C and 15N resonance assignments of the apo-form of human eIF4E",\N
7116,"7116","2006-11-13",\N,"The solution structure of PHS018 from pyrococcus horikoshii",\N
7117,"7117","2007-05-18",\N,"Complete 1H, 15N, and 13C chemical shift assignments for hybrid atracotoxin",\N
7118,"7118","2007-09-24",\N,"Solution structure of neurabin SAM domain",\N
7119,"7119","2006-10-02","2007-02-16","NMR Assignment of the Human Cancer-Related Protein 32324",\N
7120,"7120","2009-05-27",\N,"The SAM domain of DLC1 defines a novel structure that interacts with elongation factor 1A1 at cortical actin and membrane ruffles",\N
7121,"7121","2007-11-21",\N,"Solution Structure of UPF0301 protein HD_1794",\N
7122,"7122","2006-10-19","2007-02-02","Structural Studies of MJ1529, an O6 Methylguanine DNA Methyltransferase",\N
7123,"7123","2007-11-21",\N,"1H Chemical shifts assignment of BR2, a toxin extracted from the venom of the spider Brachypelma runahui",\N
7124,"7124","2006-11-13",\N,"Solution Structure of MID1 B-box2 domain: A defining domain in TRIM/RBCC proteins reveals possible versatility in zinc-coordination",\N
7125,"7125","2006-11-13",\N,"Chemical Shifts Assignments of Human Adult Hemoglobin in the Carbonmonoxy Form",\N
7126,"7126","2007-03-06","2008-07-16","1H,13C and 15N resonance assignments of barnase-barstar complex NMR deuterium methyl relaxation data for free barnase and barnase-barstar complex",\N
7127,"7127","2007-05-29",\N,"Fibronectin 2F3 chemical shift assignments",\N
7128,"7128","2007-05-29",\N,"Fibronecting 1F3-2F3 backbone chemical shift assignments",\N
7129,"7129","2006-06-28","2007-02-07","Solution Structure and Folding Characteristics of the C-Terminal SH3 Domain of c-Crk-II",\N
7130,"7130","2006-10-02","2007-02-16","Backbone NMR assignment of the 29.6 kDa Rhodanese protein from Azotobacter vinelandii",\N
7131,"7131","2008-08-13",\N,"Solution structure of IGF2R domain 11",\N
7132,"7132","2006-10-30",\N,"1H, 13C and 15N Chemical Shift Assignments for the CheA P1 domain from Thermotoga maritima",\N
7133,"7133","2006-10-30",\N,"Backbone 1H and 15N Chemical Shift Assignments for the CheA P4 domain from Thermotoga maritima, in the context of a P3P4 construct",\N
7134,"7134","2006-10-19",\N,"DNA recognition by the Brinker nuclear repressor - an extreme case of the coupling between binding and folding",\N
7135,"7135","2008-11-12",\N,"Assignments of 2SSalpha in 8M urea, pH 2, 293 K",\N
7136,"7136","2008-11-12",\N,"Assignments of 2SSbeta in 8M urea, pH 2, 293 K",\N
7137,"7137","2006-10-30","2008-07-16","NMR assignments of the C-terminal domain of insulin-like growth factor binding protein 2 (IGFBP-2)",\N
7138,"7138","2006-08-11","2008-07-16","NMR study of dynamics in the FRE-FAD complex.",\N
7139,"7139","2007-03-06","2008-07-16","1H,13C and 15N resonance assignments of barnase-barstar complex NMR deuterium methyl relaxation data for free barnase and barnase-barstar complex",\N
7140,"7140","2011-05-26",\N,"Csk SH2 domain, free form",\N
7141,"7141","2011-05-26",\N,"SH2 domain of Human Csk, complex with Cbp",\N
7142,"7142","2007-06-05","2010-08-24","rabbit prion protein (91-228)",\N
7143,"7143","2010-08-16",\N,"Chemical shift changes upon ligand binding",\N
7144,"7144","2010-08-16",\N,"Chemical shift changes upon ligand binding",\N
7147,"7147","2006-10-30",\N,"The acute myeloid leukemia fusion protein AML1-ETO targets E-proteins via a PAH-like TAFH domain",\N
7149,"7149","2006-10-30",\N,"Characterization of the Molten Globule of Human Serum Retinol-Binding Protein using NMR Spectroscopy",\N
7150,"7150","2007-03-06",\N,"Chemical Shift Assignments for the talin F3 sub-domain in complex with a chimeric beta3-integrin/PIPKIg peptide",\N
7151,"7151","2007-04-18","2008-07-16","Backbone 1H, 13C, and 15N Chemical Shift Assignments for DLC2-SAM",\N
7152,"7152","2008-11-12",\N,"NMR spectroscopy of T4 Lysozyme peptide fragments",\N
7153,"7153","2008-11-12",\N,"NMR spectroscopy of T4 Lysozyme peptide fragments",\N
7154,"7154","2008-11-12",\N,"NMR spectroscopy of T4 Lysozyme peptide fragments",\N
7155,"7155","2008-11-12",\N,"NMR spectroscopy of T4 Lysozyme peptide fragments",\N
7156,"7156","2008-11-12",\N,"NMR spectroscopy of T4 Lysozyme peptide fragments",\N
7157,"7157","2008-11-12",\N,"NMR spectroscopy of T4 Lysozyme peptide fragments",\N
7158,"7158","2007-04-19","2008-07-16","Molecular characterization of the Ran binding zinc finger domain",\N
7159,"7159","2008-11-12",\N,"1H chemical shift assignments of 2SS[6-127, 30-115] at pH 3.8 and 25 C",\N
7160,"7160","2008-11-12",\N,"1H chemical shift assignments of metLYZ at pH 3.8 and 25 C",\N
7161,"7161","2006-10-02","2007-02-16","Backbone 1H, 13C and 15N Chemical Shift Assignments of Ezrin C ERMAD in a non-covalent complex with Ezrin N FERM",\N
7162,"7162","2006-10-30",\N,"1H and 15N assignments for the b' domain of ERp57",\N
7165,"7165","2006-08-11","2008-07-16","Backbone 1H, 13C, and 15N Chemical Shift Assignments for Saccharomyces cerevisiae Urm1",\N
7166,"7166","2006-08-14","2008-07-16","1H chemical shift assignments for CgNa an anemone toxin from Condylactis Gigantea",\N
7167,"7167","2006-10-02","2006-12-01","1H, 15N, 13C resonance assignments for regeneration-induced CNPase homolog (RICH) protein",\N
7168,"7168","2007-01-09",\N,"Membrane interactions of dynorphins",\N
7169,"7169","2007-01-09",\N,"Membrane interactions of dynorphins",\N
7170,"7170","2006-08-14",\N,"1H, 13C, and 15N Chemical Shift Assignments for Bacillus subtilis Hypothetical Protein yvyC: Northeast Structural Genomics Consortium target SR482","/ftp/pub/bmrb/timedomain/bmr7170"
7171,"7171","2007-04-17",\N,"Proton chemical shift assignment for tachystatin B1",\N
7172,"7172","2007-01-10","2007-02-16","Backbone and side-chain 1H, 13C and 15N resonance assignments of C-terminal domain of an actin monomer binding protein twinfilin",\N
7173,"7173","2007-04-17",\N,"Proton chemical shift assignment for tachystatin B2",\N
7174,"7174","2006-10-30",\N,"Chemical Shift Assignments for Hdm2 RING finger domain",\N
7175,"7175","2006-08-14",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for Bacillus Subilis YorP","/ftp/pub/bmrb/timedomain/bmr7175"
7176,"7176","2007-03-05",\N,"1H Chemical Shift Assignments of an Antimicrobial Peptide, Fowlicidin-3",\N
7177,"7177","2006-10-30",\N,"Solution structure of alpha-conotoxin Vc1.1",\N
7178,"7178","2007-09-12","2008-01-14","Solution NMR structure of Q8ZP25 from Salmonella typhimurium LT2.",\N
7179,"7179","2007-11-21","2008-07-16","Dispersin Solution Structure",\N
7180,"7180","2007-11-21",\N,"NMR structure of UPF0301 PROTEIN SO3346 from Shewanella oneidensis: Northeast Structural Genomics Consortium target SOR39",\N
7181,"7181","2006-11-08",\N,"Solution Structure of Hypothetical protein PA4359: Northeast Structural Genomics Target PaT89",\N
7182,"7182","2007-03-05",\N,"NMR Structure of YcgL, a Conserved Protein from Escherichia coli Representing the DUF709 Family with a Novel a/b/a Sandwich Fold",\N
7184,"7184","2006-10-11","2006-10-17","NMR solution structure of CSPsg4",\N
7185,"7185","2006-10-11",\N,"An ARC/MEDIATOR subunit required for SREBP gene activation and regulation of cholesterol and fatty acid homeostasis",\N
7186,"7186","2006-12-04","2008-07-16","Backbone 1H Chemical Shift Assignments for Magi 5",\N
7187,"7187","2006-10-02","2007-02-16","NMR asigment of Ct-ole e 9, C terminal domain from the olive allergen Ole e 9",\N
7188,"7188","2006-10-30","2008-07-16","Im7, Immunity Protein of Colicin E7",\N
7189,"7189","2006-10-12",\N,"NMR assignments of the low molecular weight protein tyrosine phosphatase from Campylobacter Jejuni",\N
7190,"7190","2007-09-24",\N,"The structure and function of a novel two-site calcium-binding fragment of calmodulin",\N
7191,"7191","2006-08-15","2009-06-24","1H, 13C, and 15N Chemical Shift Assignments for Pseudomonas aeruginosa Hypothetical Protein RPA1041: Northeast Structural Genomics Consortium target Pat90","/ftp/pub/bmrb/timedomain/bmr7191"
7192,"7192","2006-08-11","2009-06-23","Backbone 1H, 13C, and 15N Chemical Shift Assignments for Bacillus Subilis YqaI Dimer","/ftp/pub/bmrb/timedomain/bmr7192"
7193,"7193","2006-08-11",\N,"Sequence specific resonance assignments of a hypothetical protein PA1123 (NESG ID: PaT4) from Pseudomonas aeruginosa",\N
7194,"7194","2006-08-12",\N,"Transcription Factor IIIA zinc fingers 4-6 bound to 5S rRNA 55mer",\N
7195,"7195","2008-11-11",\N,"NMR solution structure of the antitumor compound PT523 and NADPH in the ternary complex with human dihydrofolate reductase",\N
7196,"7196","2008-11-11",\N,"1H and 15N chemical shifts of NH groups in DHFR complexes with brodimoprim analogues 3-5, methotrexate and trimethoprim.",\N
7197,"7197","2008-11-11",\N,"1H and 15N chemical shifts of NH groups in DHFR complexes with brodimoprim analogues 3-5, methotrexate and trimethoprim.",\N
7198,"7198","2008-11-11",\N,"1H and 15N chemical shifts of NH groups in DHFR complexes with brodimoprim analogues 3-5, methotrexate and trimethoprim.",\N
7199,"7199","2008-11-11",\N,"1H and 15N chemical shifts of NH groups in DHFR complexes with brodimoprim analogues 3-5, methotrexate and trimethoprim.",\N
7200,"7200","2008-11-11",\N,"1H and 15N chemical shifts of NH groups in DHFR complexes with brodimoprim analogues 3-5, methotrexate and trimethoprim.",\N
7201,"7201","2006-08-16",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for Bacillus subtilis YqbF",\N
7202,"7202","2007-07-02","2009-08-10","'Backbone 1H, 13C, and 15N Chemical Shift Assignments for dSUMO'",\N
7203,"7203","2006-10-19",\N,"Backbone and sidechain 1H, 15N, and 13C chemical shift assignments for HOP",\N
7204,"7204","2006-10-02","2007-02-16","Resonance assignments of a CoA binding protein from Klebsiella pneumoniae",\N
7205,"7205","2007-01-09","2008-07-16","1H, 13C, and 15N Chemical Shift Assignments for Transmembrane Segment of ErbB4",\N
7206,"7206","2006-08-14","2008-07-16","Backbone 1H, 13C, and 15N Chemical Shift Assignments for Human RNase 7",\N
7207,"7207","2008-06-05","2009-08-21","NMR assignments of the truncated human zeta-COP",\N
7208,"7208","2007-01-09",\N,"1H, 13C, 15N Chemical shift assignment for Glycophorine A in bicelles and micelles",\N
7209,"7209","2006-10-02","2007-02-16","Assignment of 1H, 13C, and 15N resonances for the PilP pilot protein from Neisseria meningitidis.",\N
7210,"7210","2007-01-09",\N,"plant homeodomain finger of the tumour suppressor ING4",\N
7211,"7211","2009-05-28",\N,"1H and 15N Chemical Shift Assignments of Erabutoxin b",\N
7212,"7212","2007-01-09",\N,"Backbone 1H Chemical Shift Assignments for J1",\N
7213,"7213","2007-01-09",\N,"Backbone 1H Chemical Shift Assignments for J1cc",\N
7214,"7214","2007-01-09",\N,"Backbone 1H Chemical Shift Assignments for J3",\N
7215,"7215","2007-01-09",\N,"Backbone 1H Chemical Shift Assignments for J7",\N
7216,"7216","2006-08-12",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for yeast triosephosphate isomerase, TIM",\N
7218,"7218","2006-10-30","2008-07-16","1H, 13C and 15N assignment of the Master-Rep protein nuclease domain from the Faba Bean Necrotic Yellows Virus",\N
7219,"7219","2006-10-19",\N,"NMR Data for the Human Ubiquitin-Conjugating Enzyme Variant hUev1a",\N
7220,"7220","2006-11-06","2008-07-16","EphrinB2 ectodomain",\N
7221,"7221","2007-03-05","2008-07-16","Amide chemical shifts of free and hyaluronan-bound Link_TSG6 at a range of pH values",\N
7222,"7222","2007-03-06","2012-10-31","Amide chemical shifts of free and hyaluronan-bound Link_TSG6 at a range of pH values",\N
7223,"7223","2009-05-28",\N,"Solution NMR structure of the C-terminal domain of the interferon alpha-inducible ISG15 protein from Homo sapiens. Northeast Structural Genomics target HR2873B",\N
7224,"7224","2010-03-04",\N,"Solution NMR structure of Phage-like element PBSX protein xkdW, Northeast Structural Genomics Consortium Target SR355 (CASP Target)",\N
7225,"7225","2007-10-08","2008-07-16","Solution NMR structure of the UPF0291 protein ynzC from Bacillus subtilis. Northeast Structural Genomics target SR384. (CASP Target)",\N
7226,"7226","2010-03-04",\N,"Solution NMR Structure of Conserved protein MTH1368, Northeast Structural Genomics Consortium Target TT821A",\N
7227,"7227","2010-03-04","2010-08-25","Solution nmr structure of hypothetical protein yppE: Northeast Structural Genomics Consortium Target SR213",\N
7228,"7228","2010-03-04",\N,"Solution NMR structure of UPF0107 protein AF_0055, Northeast Structural Genomics Consortium Target GR101 (CASP Target)",\N
7229,"7229","2006-10-19","2007-01-09","Solution structure of Brak/CXCL14",\N
7230,"7230","2006-10-19",\N,"The NMR Structure of an Internal Loop from 23S Ribosomal RNA Differs from its Structure in Crystals of the 50S Ribosomal Subunit",\N
7231,"7231","2006-10-19",\N,"Solution structure of the heme-binding protein p22HBP",\N
7232,"7232","2006-10-19",\N,"Trans-(4-aminomethyl)phenylazobenzoic acid-aPP bound to DPC micelles",\N
7233,"7233","2006-10-19",\N,"Cis-Azobenzene-avian pancreatic polypeptide bound to DPC micelles and in water",\N
7234,"7234","2006-09-08","2007-09-20","Backbone 1H, 15N, and 13C assignments for beta phosphoglucomutase in a ternary complex with glucose-6-phosphate and MgF3-",\N
7235,"7235","2006-09-08","2007-09-20","Backbone 1H, 15N, and 13C assignments for beta phosphoglucomutase in the open form",\N
7236,"7236","2007-01-09",\N,"NMR Investigation of Tyr105 Mutants in TEM-1 beta-lactamase Suggests Active-Site Dynamical Coupling",\N
7237,"7237","2007-01-09",\N,"NMR Investigation of Tyr105 Mutants in TEM-1 beta-lactamase Suggests Active-Site Dynamical Coupling",\N
7238,"7238","2007-01-09",\N,"NMR Investigation of Tyr105 Mutants in TEM-1 beta-lactamase Suggests Active-Site Dynamical Coupling",\N
7239,"7239","2007-01-09",\N,"NMR Investigation of Tyr105 Mutants in TEM-1 beta-lactamase Suggests Active-Site Dynamical Coupling",\N
7240,"7240","2006-11-06","2008-07-16","Backbone Assignment of the 98kDa homotrimeric yeast PCNA",\N
7241,"7241","2007-07-24",\N,"Chromo 2 domain of cpSRP43 complexed with cpSRP54 peptide",\N
7242,"7242","2007-11-21","2008-07-16","13Ca resonances (100%), 1Ha(99.6%), non-proline backbone 1HN and 15N (94%), and side-chain 13C and 1H (85%) chemical shift assignment for URO-synthase",\N
7243,"7243","2006-10-20","2008-07-16","beta-microseminoprotein",\N
7244,"7244","2006-11-06","2008-07-16","1H, 15N, 13C', 13CA and 13CB Chemical Shift Assignments of intrinsically disordered gamma-synuclein",\N
7245,"7245","2006-08-12","2008-07-16","Structural and Functional Characterization of TM VII of the NHE1 Isoform of the Na+/H+ Exchanger",\N
7246,"7246","2006-08-16",\N,"Backbone assignments of the RUNT domain of the mouse PEBP2alpha protein",\N
7247,"7247","2008-08-13",\N,"Solution structure of a single chain diiron protein model",\N
7248,"7248","2006-10-20","2009-09-03","1H, 13C, 15N Chemical Shift Assignments for Mesd12-155",\N
7249,"7249","2006-12-04","2008-07-16","Complete 1H, 13C, and 15N Chemical Shift Assignments for the 15.5K Protein",\N
7250,"7250","2006-08-15","2006-08-17","Backbone 1H, 13C, 15N Chemical Shift Assignments for HIV-1 unmyristoylated matrix protein",\N
7251,"7251","2008-02-05","2008-07-17","1H chemical shift assignments for wild type p53 tetramerization domain",\N
7252,"7252","2008-02-05","2008-07-17","1H chemical shift assignments for p53 tetramerization domain mutant T329F Q331K",\N
7253,"7253","2008-02-05","2008-07-17","1H chemical shift assignments for p53 tetramerization domain mutant T329V Q331K",\N
7254,"7254","2008-02-05","2008-07-17","1H chemical shift assignments for p53 tetramerization domain mutant Y327S T329G Q331G",\N
7255,"7255","2008-02-05","2008-07-17","1H chemical shift assignments for p53 tetramerization domain mutant Y327S T329E Q331G",\N
7256,"7256","2007-01-23",\N,"NMR structure of protein Hydrogenase-1 operon protein hyaE from Escherichia coli: Northeast Structural Genomics Consortium Target ER415",\N
7257,"7257","2006-12-20",\N,"Solution structure of the RRM domain of SR rich factor 9G8",\N
7258,"7258","2006-10-31","2007-01-10","Structural characterization and oligomerization of PB1-F2, a pro-apoptotic influenza A virus protein",\N
7259,"7259","2007-11-21",\N,"The solution structure of the BRCT domain from human polymerase reveals homology with the TdT BRCT domain",\N
7260,"7260","2007-02-01",\N,"Solution NMR structure of the YjcQ protein from Bacillus subtilis. Northeast Structural Genomics target SR346. (CASP Target)",\N
7261,"7261","2007-04-24",\N,"Solution NMR structure of protein ykfF from Escherichia coli. Northeast Structural Genomics target ER397. (CASP Target)",\N
7262,"7262","2007-03-06","2007-03-23","NMR assignments of the the N-terminal subdomain of IGFBP-6",\N
7263,"7263","2007-03-09",\N,"Complete 1H assignment of Meg-A12",\N
7264,"7264","2006-11-13","2008-07-17","Backbone and Selected Sidechain 1H, 13C, and 15N Chemical Shift Assignments of the beta-1,4-glycosidase Cex from Cellulomonas fimi",\N
7265,"7265","2006-11-13","2008-07-17","Backbone and Selected Sidechain 1H, 13C, and 15N Chemical Shift Assignments of the beta-1,4-glycosidase Cex from Cellulomonas fimi",\N
7266,"7266","2006-09-05",\N,"Chemical shift assignments for protein NE1680 from Nitrosomonas europaea: Northeast Structural Genomics Consortium target NeT5",\N
7267,"7267","2006-09-05",\N,"Backbone 1H, 13C, 15N Chemical Shift Assignments for HIV-1 unmyristoylated matrix protein bound to d-C8-PI(4,5)P2",\N
7268,"7268","2007-01-09","2008-07-17","1H, 13C, and 15N Chemical Shift Assignments for the N-terminal Extracellular Domain of Truncated Cadherin",\N
7269,"7269","2007-06-27","2009-09-03","1H, 13C, 15N sequence-specific backbone and sidechain resonance assignments for dockerin-containing C-terminal region of the NagH hyaluronidase from Clostridium perfringens",\N
7270,"7270","2007-06-27","2009-09-03","1H, 13C, 15N sequence-specific backbone and sidechain resonance assignments for a putative protein-protein interaction module from a family 84 glycoside hydrolase of Clostridium perfringens",\N
7271,"7271","2007-03-29","2007-08-21","Backbone and sidechain 1H, 13C and 15N resonance assignments of AF2241 from Archaeoglobus fulgidus",\N
7272,"7272","2007-01-09","2008-07-17","Backbone and Side Chains Assignments of RGS10",\N
7273,"7273","2007-09-24",\N,"Solution structure of Jingzhaotoxin-III, a novel toxin inhibiting both Nav and Kv channels",\N
7274,"7274","2007-02-01",\N,"Solution NMR structure of the YdfO protein from Escherichia coli. Northeast Structural Genomics target ER251",\N
7275,"7275","2006-09-21",\N,"Backbone 1H, 13C, 15N Chemical Shift Assignments for HIV-1 unmyristoylated matrix protein bound to di-C4-PI(4,5)P2",\N
7276,"7276","2007-01-10","2008-07-17","Complete 1H, 13C and 15N resonance assignments of Blo t 5, a major mite allergen from Blomia tropicalis",\N
7277,"7277","2007-10-09",\N,"Backbone amide chemical shifts for dG85 T. thermophilus RNase H",\N
7278,"7278","2007-10-09",\N,"Backbone amide chemical shifts for iG80b E. coli RNase H",\N
7279,"7279","2006-09-05","2008-07-17","NMR resonance assignments of the human non-chromitin architectural transcription factor HMGA1",\N
7280,"7280","2008-02-04","2008-07-17","1H, 13C, and 15N chemical shift assignments for non-aromatic parts of GB1 domain",\N
7281,"7281","2006-10-23","2008-07-17","NMR STRUCTURE OF PROTEIN YJBR FROM ESCHERICHIA COLI;NORTHEAST STRUCTURAL GENOMICS CONSORTIUM TARGET ER226",\N
7282,"7282","2008-05-22","2008-07-17","Design of a-helical peptide based on conformationally restricted libraries",\N
7283,"7283","2008-05-22","2008-07-17","The design of the beta-harpin and a-helix tethered by a 4Gly linker using conformationally restricted libraries",\N
7284,"7284","2008-05-22","2008-07-17","The design of the beta-harpin and a-helix tethered by a 4Gly linker using conformationally restricted libraries",\N
7285,"7285","2007-10-09","2008-07-17","1H, 13C and 15N assignments for a double dockerin domain",\N
7286,"7286","2007-04-26","2008-07-17","Backbone and sidechain 1H, 13C, and 15N Chemical Shift Assignments for CG7054",\N
7287,"7287","2007-01-10","2008-07-17","Backbone and side chain 1H, 13C and 15N Chemical Shift Assignments for human BRD7 bromodomain",\N
7288,"7288","2007-05-10","2008-07-17","1H, 13C, 15N Chemical Shift Assignments and 15N Relaxation Data for Transmembrane Domain of BNIP3",\N
7289,"7289","2006-10-31","2007-01-10","Structural characterization and oligomerization of PB1-F2, a pro-apoptotic influenza A virus protein",\N
7290,"7290","2006-10-31","2007-01-10","Structural characterization and oligomerization of PB1-F2, a pro-apoptotic influenza A virus protein",\N
7291,"7291","2007-04-26",\N,"NMR Assignment and Secondary Structure of Coxsackievirus and Adenovirus receptor Domain",\N
7292,"7292","2007-08-22","2009-09-03","Backbone assignment of internal interaction site of ALP",\N
7293,"7293","2006-12-20",\N,"Backbone 1H, 13C, and 15N chemical shift assignments for recoverin bound to rhodopsin kinase",\N
7294,"7294","2006-10-20","2008-07-17","1H and 13C chemical shift assignments for the bacillomycin Lc",\N
7295,"7295","2006-10-20","2008-07-17","1H chemical shift assignments and 3JHNHa coupling constants for the synthetic analogue SCP of the bacillomycin Lc.",\N
7296,"7296","2007-10-09","2008-12-30","Solution Conformation of the His 47 to Ala 47 Mutant of Pseudomonas stutzeri ZoBell Ferrocytochrome c-551",\N
7297,"7297","2006-10-23",\N,"Assignment of conserved hypothetical protein RPA1320 from Rhodopseudomonas Palustris; Northeast Structural Genomics Consortium Target RPT3 / Ontario Center for Structural Proteomics Target RP1313",\N
7298,"7298","2008-05-12",\N,"1H, 13C, 15N-NMR resonance assignments for Znf-UBP domain of Ubp-M",\N
7299,"7299","2007-03-06",\N,"Mouse Cripto CFC domain solution structure",\N
7300,"7300","2006-12-20","2008-07-17","Solution Structure of the COMMD1 N-terminal domain",\N
7301,"7301","2007-04-26","2008-07-17","Assignment of 1H, 13C, and 15N resonances for SF2/ASF RNA recognition motif 2(RRM2)",\N
7302,"7302","2006-11-14",\N,"The PX domain of Sorting Nexin 1 (SNX1)",\N
7303,"7303","2007-06-26","2009-09-03","1H, 13C and 15N resonance assignments for proapoptotic protein Nix (1~156) from Danio rerio",\N
7304,"7304","2006-10-20","2006-12-20","beta-microseminoprotein",\N
7305,"7305","2007-05-04",\N,"R21A Spc-SH3 free",\N
7306,"7306","2007-05-04",\N,"R21A Spc-SH3 bound",\N
7307,"7307","2006-12-20","2008-07-17","Backbone assignment and RDCs of L11 in complex with RNA",\N
7308,"7308","2006-12-20","2008-07-17","Backbone assignment and RDCs of L11 in complex with RNA and thiostrepton",\N
7309,"7309","2006-10-20",\N,"Backbone 1H, 13C, 15N Chemical Shift Assignments for HIV-1 myristoylated matrix protein",\N
7310,"7310","2006-11-06","2008-07-17","Automated structure based backbone and sidechain assignment of mitochondrial Cyclophilin D",\N
7311,"7311","2007-05-04",\N,"Backbone 1H, 13C, and 15N and CB Assignments for Rat Islet Amyloid Polypeptide",\N
7312,"7312","2009-10-20","2010-07-19","1H,13C and 15N resonance assignment of the VHS domain of human STAM1 protein",\N
7313,"7313","2007-06-20","2008-05-12","1H, 13C and 15N Backbone Resonance Assignments of the Pactolus I domain",\N
7314,"7314","2007-05-04",\N,"The backbone chemical shifts of ribosomal protein L11 in the complex with rRNA",\N
7315,"7315","2007-05-04",\N,"The backbone chemical shifts of ribosomal protein L11 in the complex with rRNA and thiostrepton",\N
7316,"7316","2007-05-04",\N,"Backbone 1HN, 15N, and 13C Chemical Shift Assignments for wt Im7* (* denotes his-tag) and its variants, Im7*L53AI54A and Im7*YY",\N
7317,"7317","2007-05-04",\N,"Backbone 1HN, 15N, and 13C Chemical Shift Assignments for wt Im7* (* denotes his-tag) and its variants, Im7*L53AI54A and Im7*YY",\N
7318,"7318","2007-05-04",\N,"Backbone 1HN, 15N, and 13C Chemical Shift Assignments for wt Im7* (* denotes his-tag) and its variants, Im7*L53AI54A and Im7*YY",\N
7319,"7319","2007-06-26","2010-07-14","Polymerase Beta and Double gap double hairpin DNA",\N
7320,"7320","2006-11-06",\N,"PufX structure",\N
7321,"7321","2006-11-06","2008-07-17","Complete 1H 13C 15N chemical shift assignments for LDLa module from RXFP1",\N
7322,"7322","2007-10-09",\N,"Chemical Shift Assignments for calcium-free rat beta-parvalbumin",\N
7323,"7323","2011-05-27",\N,"1H, 13C and 15N nmr chemical shift assignments for the colicin immunity protein IM2",\N
7324,"7324","2006-11-06","2008-07-17","NMR solution structure of mouse SelW",\N
7325,"7325","2007-08-22","2008-07-17","Backbone and Ile(d1), Leu and Val Sidechain Resonance Assignments of the NUDIX Domain of Yeast Dcp2",\N
7326,"7326","2007-09-17","2008-07-17","Homonuclear NMR Assignment of the Pheromone En-1",\N
7327,"7327","2007-09-17","2008-07-17","Homonuclear NMR Assignment of the Pheromone En-2",\N
7330,"7330","2007-10-09",\N,"Solution Structure of BmKalphaIT01, an alpha-insect toxin from the Venom of the Chinese Scorpion Buthus martensi Karsch",\N
7339,"7339","2010-11-16",\N,"Solution structure of Arabidopsis thaliana protein At1g70830, a member of the major latex protein family",\N
7340,"7340","2006-12-06","2009-06-08","NMR assignments for a helical diacylglycerol kinase (DAGK), 40 kDa membrane protein from E. coli",\N
7341,"7341","2007-10-16",\N,"CYCLIC MRIA: AN EXCEPTIONALLY STABLE AND POTENT CYCLIC CONOTOXIN WITH A NOVEL TOPOLOGICAL FOLD THAT TARGETS THE NOREPINEPHRINE TRANSPORTER.",\N
7342,"7342","2011-05-26",\N,"SOLUTION STRUCTURE OF THE ZN COMPLEX OF HIV-2 NCP(23-49) PEPTIDE, ENCOMPASSING PROTEIN CCHC-LINKER, DISTAL CCHC ZN-BINDING MOTIF AND C-TERMINAL TAIL",\N
7349,"7349","2008-08-14",\N,"NMR SOLUTION STRUCTURE OF A PROTEIN ASPARTIC ACID PHOSPHATE PHOSPHATASE FROM BACILLUS ANTHRACIS",\N
7350,"7350","2008-08-14",\N,"NMR SOLUTION STRUCTURE OF A PROTEIN ASPARTIC ACID PHOSPHATE PHOSPHATASE FROM BACILLUS ANTHRACIS",\N
7351,"7351","2007-10-23","2008-07-17","NMR STRUCTURE OF HUMAN RTF1 PLUS3 DOMAIN.",\N
7352,"7352","2007-06-06",\N,"SOLUTION STRUCTURE OF THE ZN COMPLEX OF EIAV NCP11(22-58) PEPTIDE, INCLUDING TWO CCHC ZN-BINDING MOTIFS.",\N
7354,"7354","2010-02-25","2010-07-14","NMR STRUCTURE OF A PROTEIN-DNA COMPLEX OF AN ALTERED SPECIFICITY MUTANT OF THE LAC REPRESSOR THAT MIMICS THE GAL REPRESSOR",\N
7355,"7355","2007-02-09",\N,"HN,CA,CB Chemical shift assignments for apo-Rat intestinal fatty acid binding protein, Clofibric acid-Rat intestinal fatty acid binding protein complex, Fenofibric acid-Rat intestinal fatty acid binding protein complex and Tolfenamic acid-Rat intestinal f",\N
7356,"7356","2007-03-08","2011-06-16","HN,CA,CB Chemical shift assignments for apo-Rat intestinal fatty acid binding protein, Clofibric acid-Rat intestinal fatty acid binding protein complex, Fenofibric acid-Rat intestinal fatty acid binding protein complex and Tolfenamic acid-Rat intestinal f",\N
7357,"7357","2007-03-09","2011-06-16","HN,CA,CB Chemical shift assignments for apo-Rat intestinal fatty acid binding protein, Clofibric acid-Rat intestinal fatty acid binding protein complex, Fenofibric acid-Rat intestinal fatty acid binding protein complex and Tolfenamic acid-Rat intestinal f",\N
7358,"7358","2007-03-06","2007-10-05","Backbone 1H, 13C, and 15N Chemical Shift Assignments for the golli myelin basic protein isoform BG21",\N
7359,"7359","2007-06-26","2009-09-03","1H, 15N and 13C chemical shift assignments for reduced and oxidised forms of the DsbA oxidoreductase from Vibrio cholerae",\N
7360,"7360","2007-06-26","2009-09-03","1H, 15N and 13C chemical shift assignments for reduced and oxidised forms of the DsbA oxidoreductase from Vibrio cholerae",\N
7361,"7361","2008-02-11",\N,"SOLUTION STRUCTURE OF A LINEAR ANALOG OF THE SQUASH TRYPSIN INHIBITOR MCOTI-II, NMR, 30 STRUCTURES.",\N
7362,"7362","2010-03-04",\N,"NMR Structure of Protein UPF0165 protein AF_2212 from Archaeoglobus Fulgidus; Northeast Structural Genomics Consortium Target GR83",\N
7364,"7364","2009-02-04",\N,"Solution Structure of Variable-type Domain of Human Receptor for Advanced Glycation Endproducts",\N
7365,"7365","2009-10-15",\N,"Solution structure of Fe65 WW domain",\N
7366,"7366","2009-10-09",\N,"Solution Structure of Putative periplasmic protein: Northest Structural Genomics Target StR106",\N
7367,"7367","2007-09-26","2012-10-31","Solution structure of a Beta-Hairpin Peptidomimetic Inhibitor of the BIV Tat-Tar Interaction",\N
7370,"7370","2007-05-04",\N,"Backbone 1H and 15N chemical shift assignments of D. crassirhizoma Plastocyanin",\N
7371,"7371","2010-03-09",\N,"Solution NMR Structure: Northeast Structural Genomics Consortium Target SiR5",\N
7375,"7375","2007-10-24",\N,"Backbone chemical shifts assignment of the soluble N-terminal region of the ATP7A",\N
7376,"7376","2007-08-23","2009-09-03","Resonance assignments of the metal sensor CzrA in the apo-, Zn2- and DNA-bound (42 kDa) states",\N
7377,"7377","2007-08-23","2010-07-16","Resonance assignments of the metal sensor CzrA in the apo-, Zn2- and DNA-bound (42 kDa) states",\N
7382,"7382","2008-05-06","2012-11-07","NMR Structure of RRM-2 of Yeast NPL3 Protein",\N
7383,"7383","2008-05-06",\N,"NMR Structure of RRM-1 of Yeast NPL3 Protein",\N
7384,"7384","2008-08-14",\N,"Solution Structure of Human Immunodificiency Virus Type-2 Nucleocapsid Protein",\N
7386,"7386","2007-10-29",\N,"Engrailed homeodomain helix-turn-helix motif",\N
7387,"7387","2008-06-12",\N,"PIPdim 18",\N
7388,"7388","2008-02-20",\N,"sPLA2 inhibitor pip 17",\N
7389,"7389","2008-02-20",\N,"sPLA2 inhibitor 9",\N
7390,"7390","2008-06-12",\N,"Solution model of crosslinked complex of cytochrome c and adrenodoxin",\N
7391,"7391","2009-04-15",\N,"Electrostatic contributions to the stability of the GCN4 leucine zipper structure.",\N
7392,"7392","2008-02-29","2010-07-16","NMR Structure of the IQ-modified Dodecamer CTC[IQ]GGCGCCATC",\N
7396,"7396","2008-06-17",\N,"Solution Structure of ETO-TAFH refined in explicit solvent",\N
7397,"7397","2008-06-17",\N,"Purification and structural characterization of a D-amino acid containing conopeptide, marmophine, from Conus marmoreus",\N
7399,"7399","2009-10-12",\N,"Solution structure of rhodostomin D51E mutant",\N
7400,"7400","2009-10-12",\N,"Solution structure of rhodostomin P48A mutant",\N
7401,"7401","2007-10-15",\N,"Full-sequence computational design and solution structure of a thermostable protein variant",\N
7402,"7402","2008-07-08",\N,"Spatial Structure and Membrane Permeabilization for Latarcin-1, a Spider Antimicrobial Peptide",\N
7403,"7403","2008-06-26",\N,"Solution structure of the CR7 terminal hairpin loop from human telomerase RNA",\N
7404,"7404","2008-06-26",\N,"Solution structure of the U64 H/ACA snoRNA 3' terminal hairpin loop",\N
7405,"7405","2008-06-26",\N,"Solution structure of the U85 C/D-H/ACA scaRNA 5' terminal hairpin loop",\N
7406,"7406","2008-06-25","2012-11-08","NMR resonance assignment of the Ccc2ab protein",\N
7407,"7407","2008-10-31",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for MxiD in complex with MxiM",\N
7408,"7408","2008-02-11",\N,"Mapping intramolecular interactions between domains in HMGB1 using a tail-truncation approach",\N
7409,"7409","2008-02-11",\N,"Mapping intramolecular interactions between domains in HMGB1 using a tail-truncation approach",\N
7410,"7410","2008-02-11",\N,"Mapping intramolecular interactions between domains in HMGB1 using a tail-truncation approach",\N
7411,"7411","2008-02-11",\N,"Mapping intramolecular interactions between domains in HMGB1 using a tail-truncation approach",\N
7412,"7412","2008-02-11",\N,"Mapping intramolecular interactions between domains in HMGB1 using a tail-truncation approach",\N
7413,"7413","2008-02-11",\N,"Mapping intramolecular interactions between domains in HMGB1 using a tail-truncation approach",\N
7414,"7414","2008-06-27",\N,"Evidence of reciprocical reorientation of the catalytic and hemopexin-like domains of full-length MMP-12",\N
7415,"7415","2008-06-27",\N,"Evidence of reciprocical reorientation of the catalytic and hemopexin-like domains of full-length MMP-12",\N
7416,"7416","2009-10-20",\N,"Solution structure of CaM complexed to DRP1p",\N
7417,"7417","2009-10-20",\N,"Solution structure of CaM complexed to DRP1p",\N
7418,"7418","2009-10-20",\N,"Solution structure of CaM complexed to DRP1p",\N
7419,"7419","2008-08-22","2009-01-14","SOLUTION STRUCTURE OF AMINO TERMINAL DOMAIN OF HUMAN DNA POLYMERASE EPSILON SUBUNIT B REVEALS ITS HOMOLOGY TO C-DOMAINS OF AAA PROTEINS.",\N
7420,"7420","2008-08-08",\N,"STRUCTURE OF CCP MODULE 7 OF COMPLEMENT FACTOR H- THE AMD AT RISK VARIENT (402H)",\N
7421,"7421","2008-08-08",\N,"STRUCTURE OF CCP MODULE 7 OF COMPLEMENT FACTOR H- THE AMD NOT AT RISK VARIENT (402Y)",\N
7422,"7422","2008-06-30",\N,"Pseudo Contact shifts and RDCs of Galectin-3 with C-terminal LBT tagged at a proton frequency of 600MHz.",\N
7423,"7423","2009-04-04","2009-04-27","Solution structure of CaM complexed to DAPk peptide",\N
7424,"7424","2009-04-04","2009-04-27","Solution structure of CaM complexed to DAPk peptide",\N
7425,"7425","2009-04-04","2009-04-27","Solution structure of CaM complexed to DAPk peptide",\N
7426,"7426","2008-08-13",\N,"Yersinia pseudotuberculosis type III secretion effector YopE.",\N
7427,"7427","2008-08-13",\N,"Yersinia pseudotuberculosis type III secretion effector YopE.",\N
7428,"7428","2008-08-07",\N,"Local and global structure of the monomeric subunit of the potassium channel KcsA probed by NMR",\N
7429,"7429","2008-10-03","2009-03-03","Backbone 1H and 15N Chemical Shift Assignments for the Phosphotyrosine Binding Domain of Insulin Receptor Substrate 1 in the Apo and Phosphopeptide Bound Forms",\N
7430,"7430","2009-04-22","2009-05-26","Solution structure of Reduced ERp18",\N
7432,"7432","2009-08-20",\N,"Structural characterization of IscU and its interaction with HscB",\N
7433,"7433","2009-06-23","2010-01-21","Extracellular CD147 (EMMPRIN): Isoform -3",\N
7434,"7434","2009-11-24",\N,"Backbone assignment of 3F5 heavy chain antibody fragment in its free form and in complex with PABPN1",\N
7435,"7435","2011-01-25",\N,"HVS ORF57 8-120 backbone assignment, in complex with REF2-I 54-155.",\N
9500,"9500","2009-05-21",\N,"Structure of actin-interacting domain of troponin",\N
10001,"10001","2006-06-28","2009-07-15","A high resolution structure of mastoparan-X strongly bound to lipid-bilayer membrane determined by solid-state NMR",\N
10002,"10002","2006-06-28","2008-10-16","F-spondin TSR 4",\N
10004,"10004","2006-04-27","2007-02-15","1H, 13C and 15N resonance assignments of the 2'-5' RNA ligase-like protein from Pyrococcus furiosus",\N
10005,"10005","2007-06-13",\N,"1H, 13C, and 15N Chemical Shift Assignments for ChitinaseC chitin binding domain",\N
10006,"10006","2006-10-23",\N,"SOLUTION STRUCTURE OF FIBRONECTIN TYPE III DOMAIN OF MOUSE HYPOTHETICAL PROTEIN",\N
10008,"10008","2006-11-06",\N,"Solution structure of C-terminal fibronectin type III domain of mouse 1700129L13Rik protein",\N
10009,"10009","2006-11-06",\N,"Solution structure of SH3 domain of mouse Kalirin-9a protein",\N
10010,"10010","2007-06-13",\N,"bovine beta-lactoglobulin A34C mutant",\N
10011,"10011","2006-11-14",\N,"SOLUTION STRUCTURE OF THE SWIRM DOMAIN OF HUMAN LSD1",\N
10012,"10012","2009-06-01",\N,"Structure of actin-interacting domain of troponin",\N
10013,"10013","2006-12-06",\N,"Solution Structure Of The Ring Finger Domain Of The Human Kiaa1045 Protein",\N
10014,"10014","2006-11-21",\N,"Assignments of a GAAG tetraloop in helix 6 of SRP RNA from Pyrococcus furiosus",\N
10015,"10015","2006-06-27","2007-02-07","Assignments of a HIV-1 integrase Zn finger domain mutant",\N
10016,"10016","2006-06-27","2008-07-01","Backbone 1H, 13C and 15N Chemical Shift Assignments for the Nucleotide-Free Form of Human ABCB6 C-Terminal Domain",\N
10017,"10017","2006-06-27","2008-07-01","Backbone 1H, 13C and 15N Chemical Shift Assignments for the ADP-BOUND Form of Human ABCB6 C-Terminal Domain",\N
10018,"10018","2006-11-21",\N,"1H Chemical Shift Assignments for LINE RNA",\N
10019,"10019","2010-05-27",\N,"GSPT1/eRF3a(PAM2-1)-PABC complex",\N
10021,"10021","2007-06-13",\N,"Backbone and sidechain 13C and 15N Chemical Shift Assignments of H+-ATP synthase subunit c in the solid state",\N
10022,"10022","2006-10-26","2008-07-16","3D Structure of amyloid protofibrils of beta2-microglobulin fragment probed by solid-state NMR",\N
10023,"10023","2006-12-04","2008-07-16","Chemical shift assignment of human eIF2alpha",\N
10024,"10024","2007-06-13",\N,"Chemical shift assignments for the Rhodobacter sphaeroides PufX membrane protein",\N
10025,"10025","2008-07-16",\N,"Solution structure of kinase associated domain 1 of mouse MAP/microtubule affinity-regulating kinase 3",\N
10026,"10026","2008-06-24",\N,"Solution structure of kinase associated domain 1 of mouse MAP/microtubule affinity-regulating kinase 3",\N
10027,"10027","2007-06-26","2009-09-03","chemical shift assignment of DnaA domain I-II",\N
10028,"10028","2007-10-19","2008-07-16","Solution structure of the second WW domain from mouse salvador homolog 1 protein (mm45).",\N
10029,"10029","2008-08-12",\N,"Solution structure of the fifth PDZ domain of human membrane associated guanylate kinase inverted-2 (KIAA0705 protein)",\N
10030,"10030","2008-08-12",\N,"Solution structure of the forth CH domain from human plastin 3 T-isoform",\N
10031,"10031","2008-08-13",\N,"Solution structure of the 2nd mbt domain from human KIAA1617 protein",\N
10032,"10032","2008-08-13",\N,"Solution structure of the first mbt domain from human KIAA1798 protein",\N
10033,"10033","2008-08-13",\N,"Soluiotn structure of J-domain of mouse DnaJ like protein",\N
10034,"10034","2008-08-13",\N,"Solution structure of Fibronectin type III domain derived from human KIAA0970 protein",\N
10035,"10035","2008-08-13",\N,"Solution structure of Lectin C-type domain derived from a hypothetical protein from C. elegans",\N
10036,"10036","2008-08-13",\N,"Solution structure of mouse CGI-38 protein",\N
10037,"10037","2008-08-13",\N,"Solution structure of the third mbt domain from human KIAA1798 protein",\N
10038,"10038","2008-08-12",\N,"Solution structure of zf-C2H2 domains from human Zinc finger protein 295",\N
10039,"10039","2008-08-13",\N,"Solution Structure of the Pleckstrin Homology Domain of Mouse Ethanol Decreased 4 Protein",\N
10040,"10040","2008-08-13",\N,"Solution Structure of the RA Domain of Human Grb7 Protein",\N
10041,"10041","2008-08-13",\N,"Solution Structure of the Tudor Domain from Mouse Hypothetical Protein Homologous to Histone Acetyltransferase",\N
10042,"10042","2008-08-13",\N,"Solution Structure of the CS Domain of Human KIAA1068 Protein",\N
10043,"10043","2008-08-13",\N,"Solution Structure of the N-terminal Domain of Mouse Putative Signal Recoginition Particle 54 (SRP54)",\N
10044,"10044","2008-08-13",\N,"Solution structure of homeobox domain of Arabidopsisthaliana zinc finger homeobox family protein",\N
10045,"10045","2008-08-13",\N,"Solution structure of homeobox domain of Arabidopsis thaliana hypothetical protein F22K18.140",\N
10046,"10046","2008-08-13",\N,"Solution structure of the PB1 domain of mouse mitogen activated protein kinase kinase 5 (MAP2K5)",\N
10047,"10047","2008-08-13",\N,"Solution Structure of the Homeobox Domain of Human Homeodomain Leucine Zipper-Encoding Gene (Homez)",\N
10048,"10048","2008-08-13",\N,"Solution Structure of the UBA Domain of Human Tudor Domain Containing Protein 3",\N
10049,"10049","2008-08-13",\N,"Solution structure of the N-terminal Domain I of mouse transcription elongation factor S-II protein 3",\N
10050,"10050","2008-08-13",\N,"Solution structure of N-terminal ubiquitin-like domain of human NEDD8 ultimate buster-1",\N
10051,"10051","2007-11-13",\N,"Backbone 1H and 15N assignment for the human c-Ha Ras (Y32W) in the GDP-bound state",\N
10052,"10052","2007-06-13","2008-07-17","characterization of PCP-0SH in the D1 state was examined by using H/D exchange experiments.",\N
10053,"10053","2007-08-22","2009-09-03","Backbone 1H, 13C, and 15N assignments of a 59 kDa Salmonella typhimurium periplasmic oligopeptide binding protein OppA",\N
10054,"10054","2008-08-13",\N,"Solution structure of the first cold-shock domain of the human KIAA0885 protein (UNR protein)",\N
10055,"10055","2008-08-13",\N,"Solution Structure of Glia Maturation Factor-gamma from Mus Musculus",\N
10056,"10056","2008-08-13",\N,"Solution structure of the Ras-binding domain of mouse RGS14",\N
10057,"10057","2008-08-13",\N,"Solution structure of Iron-sulfur cluster protein U (IscU)",\N
10058,"10058","2008-08-13",\N,"Solution Structure of the PICOT homology 2 domain of the mouse PKC-interacting cousin of thioredoxin protein",\N
10059,"10059","2008-08-13",\N,"Solution Structure of the Band 7 Domain of the mouse Flotillin 2 Protein",\N
10060,"10060","2008-08-13",\N,"Solution structure of hypothetical protein C330018D20Rik from Mus musculus",\N
10061,"10061","2008-08-13",\N,"Solution structure of PDZ domain of mouse Cypher protein",\N
10062,"10062","2007-03-23",\N,"Backbone 1H and 15N Chemical Shift Assignments for Nedd8",\N
10063,"10063","2008-08-14",\N,"Solution structure of the fourth SH3 domain of human intersectin 2 (KIAA1256)",\N
10064,"10064","2008-08-14",\N,"Solution Structure of The forth PDZ Domain of Human Atrophin-1 Interacting Protein 1 (KIAA0705 Protein)",\N
10065,"10065","2008-08-14",\N,"Solution structure of the SAND domain of the putative nuclear protein homolog (5830484A20Rik)",\N
10066,"10066","2008-08-14",\N,"Solution structure of the third PDZ domain of human KIAA1526 protein",\N
10067,"10067","2008-08-14",\N,"Solution Structure of The FHA Domain of Arabidopsis thaliana Hypothetical Protein",\N
10068,"10068","2008-08-14",\N,"Solution Structure of the CH domain from Mouse Trangelin",\N
10069,"10069","2008-08-14",\N,"Solution structure of the Villin headpiece domain of human actin-binding LIM protein homologue (KIAA0843 protein)",\N
10070,"10070","2008-08-14",\N,"Solution structure of RRM domain in heterogeneous nuclear ribonucleoprotein H'",\N
10071,"10071","2008-08-14",\N,"Solution structure of RRM domain in RNA-binding protein NP_057951",\N
10072,"10072","2008-08-14",\N,"Solution structure of RRM domain in HNRPC protein",\N
10073,"10073","2008-08-14",\N,"C2 domain-containing protein from putative elicitor-responsive gene",\N
10074,"10074","2008-08-14",\N,"The first C2 domain of human synaptotagmin XIII",\N
10075,"10075","2008-08-14",\N,"The fourth FN3 domain of human sidekick-2",\N
10076,"10076","2008-08-14",\N,"The eighth FN3 domain of human sidekick-2",\N
10077,"10077","2008-08-14",\N,"Solution structure of the RNA binding domain of eukaryotic initiation factor 4B",\N
10078,"10078","2007-08-22","2009-09-03","Backbone Resonance Assignments for LolA",\N
10079,"10079","2008-08-14",\N,"Solution structure of putative domain of human KIAA0561 protein",\N
10080,"10080","2008-08-14",\N,"Solution structure of mouse putative 42-9-9 protein",\N
10081,"10081","2008-08-14",\N,"Solution structure of the PDZ domain of mouse Rhophilin-2",\N
10082,"10082","2008-08-14",\N,"Solution structure of RRM domain in calcipressin 1",\N
10083,"10083","2008-08-14",\N,"PDZ domain of human RIM2B",\N
10084,"10084","2008-08-14",\N,"Nuclear move domain of nuclear distribution gene C homolog",\N
10085,"10085","2008-08-14",\N,"Solution structure of the first RRM domain in heterogeneous nuclear ribonucleoprotein H",\N
10086,"10086","2008-08-14",\N,"RA domain of guanine nucleotide exchange factor for Rap1",\N
10087,"10087","2008-08-14",\N,"Solution structure of C-terminal ubiquitin like domain of human 2'-5'-oligoadenylate synthetase-like protain (p59 OASL)",\N
10088,"10088","2008-08-14",\N,"Solution structure of the second PDZ domain of human scribble (KIAA0147 protein)",\N
10089,"10089","2008-08-14",\N,"Solution structure of phosphotyrosine interaction domain of mouse Numb protein",\N
10090,"10090","2008-08-14",\N,"Solution structure of hypothetical protein F20O9.120 from Arabidopsis thaliana",\N
10091,"10091","2008-08-14",\N,"Solution structure of the C-terminal ubiquitin-like domain of mouse tubulin-specific chaperone e",\N
10092,"10092","2008-08-14",\N,"Solution structure of the DEATH domain of Interleukin-1 receptor-associated kinase4 (IRAK4) from Mus musculus",\N
10093,"10093","2008-08-14",\N,"Solution structure of the second CUT domain of human Homeobox protein Cux-2",\N
10094,"10094","2008-08-14",\N,"Solution structure of the third CUT domain of human Homeobox protein Cux-2",\N
10095,"10095","2008-08-29",\N,"Solution structure of the KH domain of human ribosomal protein S3",\N
10096,"10096","2007-08-22","2009-09-03","Backbone Resonance Assignments for LolB",\N
10097,"10097","2008-08-15",\N,"Solution Structure of the SH3 Domain Binding Glutamic Acid-rich Protein Like 3",\N
10098,"10098","2008-08-15",\N,"Solution Structure of The C1 Domain of The Human Diacylglycerol Kinase Delta",\N
10099,"10099","2008-08-15",\N,"Solution Structure of the First Fibronectin Type III domain of human KIAA1568 Protein",\N
10100,"10100","2008-08-15",\N,"Solution Structure of The Third PDZ Domain of Human Atrophin-1 Interacting Protein 1 (KIAA0705 Protein)",\N
10101,"10101","2008-08-15",\N,"Solution structure of four helical up-and-down bundle domain of the hypothetical rotein 2610208M17Rik similar to the protein FLJ12806",\N
10102,"10102","2008-08-15",\N,"Solution structure of the second fibronectin Type III domain of human KIAA1568 protein",\N
10103,"10103","2008-08-15",\N,"Solution structure of the fourth PDZ domain of human scribble (KIAA0147 protein)",\N
10104,"10104","2008-08-15",\N,"The forkhead associated (FHA) domain like structure from mouse polynucleotide kinase 3'-phosphatase",\N
10105,"10105","2008-08-15",\N,"Solution structure of the SWIB/MDM2 domain of the hypothetical protein At5g14170 from Arabidopsis thaliana",\N
10106,"10106","2008-08-15",\N,"Solution structure of the SWIB/MDM2 domain of the hypothetical protein At5g08430 from Arabidopsis thaliana",\N
10107,"10107","2008-08-15",\N,"Solution structure of the CH domain from mouse EB-1",\N
10108,"10108","2008-08-29",\N,"Solution Structure of DC1 Domain of PDI-like Hypothetical Protein from Arabidopsis thaliana",\N
10109,"10109","2008-08-29",\N,"Solution Structure of the PDZ Domain from Mouse Glutamate Receptor Interacting Protein 1A-L (GRIP1) Homolog",\N
10110,"10110","2008-08-29",\N,"Solution Structure of the Gas2 Domain of the Growth Arrest Specific 2 Protein",\N
10111,"10111","2008-08-29",\N,"Solution structure of the 6th HMG box of mouse UBF1",\N
10112,"10112","2008-08-29",\N,"Solution structure of the ubiquitin domain from mouse D7Wsu128e protein",\N
10113,"10113","2008-08-15",\N,"Solution Structure of the Pleckstrin Homology Domain of Mouse APS",\N
10114,"10114","2008-08-15",\N,"Solution Structure of the C-terminal Pleckstrin Homology Domain of Sbf1 from Mouse",\N
10115,"10115","2008-08-15",\N,"Solution Structure of the Pleckstrin Homology Domain of Oxysterol-Binding Protein-Related Protein 8 (KIAA1451 Protein)",\N
10116,"10116","2008-06-27",\N,"The Confirmation of the Denatured Structure of Pyrrolidone Carboxyl Peptidase under Non denaturing Conditions: Helix Propensity of wild-type H6-peptide",\N
10117,"10117","2008-06-27",\N,"The Confirmation of the Denatured Structure of Pyrrolidone carboxyl Peptidase under Non denaturing Conditions: Deference in Helix Propensity of Two Synthetic Peptides with Single Amino Acid Substitution",\N
10118,"10118","2008-09-22","2008-11-21","1H 13C and 15N Chemical Shift Assignments for C-terminal domain of PH0471",\N
10119,"10119","2008-09-02",\N,"DnaJ domain of human KIAA0730 protein",\N
10120,"10120","2008-09-02",\N,"Solution structure of immunoglobulin like domain of mouse nuclear lamin",\N
10121,"10121","2008-09-02",\N,"Solution structure of a putative peptidyl-tRNA hydrolase domain in a mouse hypothetical protein",\N
10122,"10122","2008-09-02",\N,"Solution structure of the second SH3 domain of human intersectin 2 (KIAA1256)",\N
10123,"10123","2008-07-16",\N,"Solution structure of the PWWP domain of mouse Hepatoma-derived growth factor, related protein 3",\N
10124,"10124","2008-09-02",\N,"Solution structure of the second PDZ domain of human membrane associated guanylate kinase inverted-2 (MAGI-2)",\N
10125,"10125","2008-09-02",\N,"Solution structure of the dsRBD from hypothetical protein BAB26260",\N
10126,"10126","2008-09-02",\N,"Solution structure of the R3H domain from human hypothetical protein BAA76846",\N
10127,"10127","2008-09-02",\N,"Solution structure of the alpha-helical domain from mouse hypothetical PNPase",\N
10128,"10128","2008-09-02",\N,"Solution structure of the second FNIII domain of DSCAML1 protein",\N
10129,"10129","2008-09-02",\N,"Solution structure of the first Fn3 domain of Sidekick-2 protein",\N
10130,"10130","2008-09-02",\N,"Solution structure of a novel beta-grasp fold like domain of Hypothetical protein (Arabidopsis thaliana)",\N
10131,"10131","2008-09-02",\N,"Solution Structure of the N-terminal Pleckstrin Homology Domain Of TAPP2 from Mouse",\N
10132,"10132","2008-02-11",\N,"1H and 15N assignment of oxidized Pseudomonas aeruginosa cytochrome c551",\N
10133,"10133","2008-02-11",\N,"1H and 15N assignment of reduced Pseudomonas aeruginosa cytochrome c551",\N
10134,"10134","2008-02-11",\N,"1H and 15N assignment of oxidized Hydrogenobacter thermophilus cytochrome c552",\N
10135,"10135","2008-02-11",\N,"1H and 15N assignment of reduced Hydrogenobacter thermophilus cytochrome c552",\N
10136,"10136","2008-09-26",\N,"Solution structure of the first SH3 domain of human intersectin2 (KIAA1256)",\N
10137,"10137","2008-02-20","2008-02-20","Lipocalin-type Prostaglandin D synthase",\N
10138,"10138","2008-06-12",\N,"Solution structure of the N-terminal domain of RimM from Thermus thermophilus HB8",\N
10139,"10139","2008-06-12",\N,"Backbone NMR assignments of RimM from Thermus thermophilus",\N
10140,"10140","2008-06-12",\N,"Backbone NMR assignments of of RimM complexed with rS19",\N
10141,"10141","2008-12-10",\N,"Solution structure of the alpha adaptinC2 domain from human Adapter-related protein complex 1 gamma 2 subunit",\N
10142,"10142","2008-12-10",\N,"Solution structure of the N-terminal extended 20th Filamin domain from human Filamin-B",\N
10143,"10143","2008-12-10",\N,"Solution structure of the 14th filamin domain from human Filamin-B",\N
10144,"10144","2008-12-10",\N,"Solution structure of the RhoGAP domain from human Rho GTPase activating protein 5 variant",\N
10145,"10145","2008-12-10",\N,"Solution structure of the N-teruminus extended RhoGAP domain from human Rho GTPase activating protein 5 variant",\N
10146,"10146","2008-12-10",\N,"Solution structure of the 21th filamin domain from human Filamin-B",\N
10147,"10147","2008-12-10",\N,"Solution structure of the CH domain from human Sperm flagellar protein 1",\N
10148,"10148","2008-12-10",\N,"Solution structure of three zf-C2H2 domains from mouse protein odd-skipped-related 2 splicing isoform 2",\N
10149,"10149","2008-12-11",\N,"Solution structure of the CH domain from human MICAL-2",\N
10150,"10150","2008-12-11",\N,"Solution structure of the SANT domain of fission yeast SPCC24B10.08c protein",\N
10151,"10151","2008-12-11",\N,"Solution structure of the C2H2 type zinc finger (region 887-919) of human Zinc finger protein 268",\N
10152,"10152","2008-12-11",\N,"Solution structure of the C2H2 type zinc finger (region 495-525) of human Zinc finger protein 268",\N
10153,"10153","2008-12-11",\N,"Solution structure of the C2H2 type zinc finger (region 519-551) of human Zinc finger protein 484",\N
10154,"10154","2008-12-11",\N,"Solution structure of the C2H2 type zinc finger (region 557-589) of human Zinc finger protein 473",\N
10155,"10155","2008-12-11",\N,"Solution structure of the C2H2 type zinc finger (region 603-635) of human Zinc finger protein 484",\N
10156,"10156","2008-12-11",\N,"Solution structure of the C2H2 type zinc finger (region 715-747) of human Zinc finger protein 484",\N
10157,"10157","2009-02-20",\N,"Solution structure of the C2H2 type zinc finger (region 626-654) of human B-cell lymphoma 6 protein",\N
10158,"10158","2009-02-20",\N,"Solution structure of the C2H2 type zinc finger (region 370-400) of human Zinc finger protein 473",\N
10159,"10159","2009-02-20",\N,"Solution structure of the 16th filamin domain from human Filamin-B",\N
10160,"10160","2009-02-20",\N,"Solution structure of the 17th filamin domain from human Filamin-B",\N
10161,"10161","2009-02-20",\N,"Solution structure of the 22th filamin domain from human Filamin-B",\N
10162,"10162","2009-02-20",\N,"Solution structure of the 23th filamin domain from human Filamin-B",\N
10163,"10163","2009-02-20",\N,"Solution structure of the 24th filamin domain from human Filamin-B",\N
10164,"10164","2009-02-23",\N,"Solution structure of the A1pp domain from human protein C6orf130",\N
10165,"10165","2009-02-23",\N,"Solution structure of the CBM_21 domain from human protein phosphatase 1, regulatory (inhibitor) subunit 3B",\N
10166,"10166","2009-02-23",\N,"Solution structure of the C2H2 type zinc finger (region 637-667) of human Zinc finger protein 268",\N
10167,"10167","2009-02-23",\N,"Solution structure of the C2H2 type zinc finger (region 584-616) of human Zinc finger protein 28 homolog",\N
10168,"10168","2009-02-23",\N,"Solution structure of the C2H2 type zinc finger (region 640-672) of human Zinc finger protein 28 homolog",\N
10169,"10169","2009-02-24",\N,"Solution structure of the C2H2 type zinc finger (region 171-203) of human Zinc finger protein 224",\N
10170,"10170","2009-02-24",\N,"Solution structure of the C2H2 type zinc finger (region 415-447) of human Zinc finger protein 28 homolog",\N
10171,"10171","2009-02-24",\N,"Solution structure of the C2H2 type zinc finger (region 311-343) of human Zinc finger protein 224",\N
10172,"10172","2009-02-24",\N,"Solution structure of the C2H2 type zinc finger (region 395-427) of human Zinc finger protein 224",\N
10173,"10173","2009-02-24",\N,"Solution structure of the C2H2 type zinc finger (region 592-624) of human Zinc finger protein 347",\N
10174,"10174","2009-02-24",\N,"Solution structure of the C2H2 type zinc finger (region 340-372) of human Zinc finger protein 347",\N
10175,"10175","2009-02-24",\N,"Solution structure of the C2H2 type zinc finger (region 556-588) of human Zinc finger protein 28 homolog",\N
10176,"10176","2009-02-24",\N,"Solution structure of the C2H2 type zinc finger (region 696-728) of human Zinc finger protein 28 homolog",\N
10177,"10177","2009-02-24",\N,"Solution structure of the C2H2 type zinc finger (region 687-719) of human Zinc finger protein 484",\N
10178,"10178","2009-02-24",\N,"Solution structure of the C2H2 type zinc finger (region 204-236) of human Zinc finger protein 473",\N
10179,"10179","2009-02-26",\N,"Solution structure of the C2H2 type zinc finger (region 724-756) of human Zinc finger protein 28 homolog",\N
10180,"10180","2009-02-26",\N,"Solution structure of the C2H2 type zinc finger (region 339-371) of human Zinc finger protein 224",\N
10181,"10181","2009-02-26",\N,"Solution structure of the C2H2 type zinc finger (region 367-399) of human Zinc finger protein 224",\N
10182,"10182","2009-02-26",\N,"Solution structure of the C2H2 type zinc finger (region 725-757) of human Zinc finger protein 473",\N
10183,"10183","2009-02-26",\N,"Solution structure of the C2H2 type zinc finger (region 379-411) of human Zinc finger protein 484",\N
10184,"10184","2009-02-26",\N,"Solution structure of the C2H2 type zinc finger (region 463-495) of human Zinc finger protein 484",\N
10185,"10185","2009-02-26",\N,"Solution structure of the C2H2 type zinc finger (region 607-639) of human Zinc finger protein 268",\N
10186,"10186","2009-02-26",\N,"Solution structure of the C2H2 type zinc finger (region 369-401) of human Zinc finger protein 95 homolog",\N
10187,"10187","2009-02-26","2013-11-13","Solution structure of the C2H2 type zinc finger (region 479-511) of human Zinc finger protein 224",\N
10188,"10188","2009-02-26",\N,"Solution structure of the C2H2 type zinc finger (region 564-596) of human Zinc finger protein 347",\N
10189,"10189","2009-02-27",\N,"Solution structure of the C2H2 type zinc finger (region 341-373) of human Zinc finger protein 95 homolog",\N
10190,"10190","2009-02-27",\N,"Solution structure of the C2H2 type zinc finger (region 425-457) of human Zinc finger protein 95 homolog",\N
10191,"10191","2009-02-27",\N,"Solution structure of the C2H2 type zinc finger (region 719-751) of human Zinc finger protein 268",\N
10192,"10192","2009-02-27",\N,"Solution structure of the C2H2 type zinc finger (region 283-315) of human Zinc finger protein 224",\N
10193,"10193","2009-02-27",\N,"Solution structure of the Myb-like DNA-binding domain of human ZZZ3 protein",\N
10194,"10194","2009-02-27",\N,"Solution structure of the SH3 domain of mouse RUN and TBC1 domain containing 3",\N
10195,"10195","2009-02-27",\N,"Solution structure of the second SH3 domain of human Vinexin",\N
10196,"10196","2009-03-05",\N,"Solution structure of the C2H2 type zinc finger (region 768-800) of human Zinc finger protein 95 homolog",\N
10197,"10197","2009-03-05",\N,"Solution structure of the C2H2 type zinc finger (region 199-231) of human Zinc finger protein 224",\N
10198,"10198","2009-03-05",\N,"Solution structure of the C2H2 type zinc finger (region 423-455) of human Zinc finger protein 224",\N
10199,"10199","2014-04-28",\N,"Solution structure of the C2H2 type zinc finger (region 312-344) of human Zinc finger protein 347",\N
10200,"10200","2009-03-05",\N,"Solution structure of the C2H2 type zinc finger (region 342-372) of human Zinc finger protein 473",\N
10201,"10201","2009-03-05",\N,"Solution structure of the C2H2 type zinc finger (region 641-673) of human Zinc finger protein 473",\N
10202,"10202","2009-03-05",\N,"Solution structure of the C2H2 type zinc finger (region 491-523) of human Zinc finger protein 484",\N
10203,"10203","2009-03-05",\N,"Solution structure of the C2H2 type zinc finger (region 547-579) of human Zinc finger protein 484",\N
10204,"10204","2009-03-05",\N,"Solution structure of the C2H2 type zinc finger (region 612-644) of human Zinc finger protein 28 homolog",\N
10205,"10205","2009-03-05",\N,"Solution structure of the C2H2 type zinc finger (region 668-70) of human Zinc finger protein 28 homolog",\N
10206,"10206","2009-03-18",\N,"Solution structure of the C2H2 type zinc finger (region 780-812) of human Zinc finger protein 28 homolog",\N
10207,"10207","2009-03-18",\N,"Solution structure of the C2H2 type zinc finger (region 368-400) of human Zinc finger protein 347",\N
10208,"10208","2009-03-18",\N,"Solution structure of the C2H2 type zinc finger (region 315-345) of human Zinc finger protein 473",\N
10209,"10209","2009-03-18",\N,"Solution structure of the C2H2 type zinc finger (region 809-841) of human Zinc finger protein 473",\N
10210,"10210","2009-03-18",\N,"Solution structure of the C2H2 type zinc finger (region 528-560) of human Zinc finger protein 28 homolog",\N
10211,"10211","2009-03-18",\N,"Solution structure of the SH3 domain of human Tyrosine-protein kinase ITK/TSK",\N
10212,"10212","2010-03-11",\N,"Solution structure of the SH3 domain of the human SRC-like adopter protein (SLAP)",\N
10213,"10213","2008-08-19","2008-12-16","Solution structure of the GUCT domain from human ATP-dependent RNA helicase DDX50, DEAD box protein 50",\N
10214,"10214","2009-04-04",\N,"Solution structure of the second WW domain from the human membrane-associated guanylate kinase, WW and PDZ domain-containing protein 1. MAGI-1",\N
10215,"10215","2009-04-04",\N,"Solution structure of the short-isoform of the second WW domain from the human membrane-associated guanylate kinase, WW and PDZ domain-containing protein 1 (MAGI-1)",\N
10216,"10216","2009-05-28",\N,"Solution structure of the C2H2 type zinc finger (region 411-441) of human Zinc finger protein 268",\N
10217,"10217","2009-05-28",\N,"Solution structure of the C2H2 type zinc finger (region 693-723) of human Zinc finger protein 268",\N
10218,"10218","2009-05-28",\N,"Solution structure of the C2H2 type zinc finger (region 355-385) of human Zinc finger protein 268",\N
10219,"10219","2009-05-28",\N,"Solution structure of the C2H2 type zinc finger (region 441-469) of human Zinc finger protein 268",\N
10220,"10220","2009-05-28",\N,"Solution structure of the C2H2 type zinc finger (region 397-429) of human Zinc finger protein 95 homolog",\N
10221,"10221","2009-05-28",\N,"Solution structure of the C2H2 type zinc finger (region 255-287) of human Zinc finger protein 224",\N
10222,"10222","2009-05-29",\N,"Solution structure of the C2H2 type zinc finger (region 775-807) of human Zinc finger protein 268",\N
10223,"10223","2009-05-29",\N,"Solution structure of the C2H2 type zinc finger (region 760-792) of human Zinc finger protein 347",\N
10224,"10224","2009-08-19",\N,"Solution structure of the C2H2 type zinc finger (region 859-889) of human Zinc finger protein 268",\N
10225,"10225","2009-08-19",\N,"Solution structure of the C2H2 type zinc finger (region 301-331) of human Zinc finger protein 268",\N
10226,"10226","2009-08-19",\N,"Solution structure of the C2H2 type zinc finger (region 273-303) of human Zinc finger protein 268",\N
10227,"10227","2009-08-19",\N,"Solution structure of the C2H2 type zinc finger (region 551-583) of human Zinc finger protein 268",\N
10228,"10228","2009-08-19",\N,"Solution structure of the C2H2 type zinc finger (region 628-660) of human Zinc finger protein 95 homolog",\N
10229,"10229","2009-08-19",\N,"Solution structure of the C2H2 type zinc finger (region 385-413) of human Zinc finger protein 268",\N
10230,"10230","2009-08-19",\N,"Solution structure of the C2H2 type zinc finger (region 563-595) of human Zinc finger protein 224",\N
10231,"10231","2009-08-19",\N,"Solution structure of the C2H2 type zinc finger (region 598-626) of human B-cell lymphoma 6 protein",\N
10232,"10232","2009-08-19",\N,"Solution structure of the C2H2 type zinc finger (region 796-828) of human Zinc finger protein 95 homolog",\N
10233,"10233","2009-08-19",\N,"Solution structure of the C2H2 type zinc finger (region 284-316) of human Zinc finger protein 347",\N
10234,"10234","2009-08-19",\N,"Solution structure of the C2H2 type zinc finger (region 648-680) of human Zinc finger protein 347",\N
10235,"10235","2009-03-19",\N,"Solution Structure of the C-terminal Phosphotyrosine Interaction Domain of APBB2 from Mouse",\N
10236,"10236","2009-03-19",\N,"Structure of the C-terminal PID Domain of Fe65L1 Complexed with the Cytoplasmic Tail of APP Reveals a Novel Peptide Binding Mode",\N
10237,"10237","2009-03-19",\N,"Solution structure of the chimera of the C-terminal PID domain of Fe65L and the C-terminal tail peptide of APP",\N
10238,"10238","2009-03-19",\N,"Solution structure of the chimera of the C-terminal tail peptide of APP and the C-terminal PID domain of Fe65L",\N
10239,"10239","2009-03-19",\N,"Solution structure of the chimera of the C-terminal tail peptide of APP and the C-terminal PID domain of Fe65L",\N
10240,"10240","2009-11-03",\N,"Solution structures of the SH3 domain of human Src substrate cortactin",\N
10241,"10241","2009-11-03",\N,"Solution structures of the SH3 domain of human rho guanine exchange factor (GEF) 16",\N
10242,"10242","2009-11-03",\N,"Solution structures of the PDZ domain of human Interleukin-16",\N
10243,"10243","2009-11-03",\N,"Solution structures of the C2H2 type zinc finger domain of human Zinc finger protein 24",\N
10244,"10244","2009-11-03",\N,"Solution structures of the C2H2 type zinc finger domain of human Zinc finger protein 462",\N
10245,"10245","2009-11-03",\N,"Solution structures of the SH3 domain of human megakaryocyte-associated tyrosine-protein kinase.",\N
10246,"10246","2009-11-03",\N,"Solution structures of the C2H2 type zinc finger domain of human Transcriptional repressor CTCF",\N
10247,"10247","2009-11-03",\N,"Solution structures of the LIM domain of human NEDD9 interacting protein with calponin homology and LIM domains",\N
10248,"10248","2009-11-20",\N,"Solution Structure of the HMG_box Domain of Murine Bobby Sox Homolog",\N
10249,"10249","2009-11-20",\N,"Solution structure of the C-terminal PH domain of human pleckstrin",\N
10250,"10250","2009-11-20",\N,"Solution structure of the PH domain of human Docking protein BRDG1",\N
10251,"10251","2009-11-20",\N,"Solution structure of the C-terminal PH domain of human pleckstrin 2",\N
10252,"10252","2009-11-20",\N,"Solution structure of the HMG_box domain of thymus high mobility group box protein TOX from mouse",\N
10253,"10253","2009-11-20",\N,"Solution structure of the PH domain of protein kinase C, D2 type from human",\N
10254,"10254","2009-11-20",\N,"Solution structure of the C-terminal PH domain of FYVE, RhoGEF and PH domain containing protein 3 (FGD3) from human",\N
10255,"10255","2009-11-20",\N,"Solution structure of the N-terminal PH domain of ARAP2 protein from human",\N
10256,"10256","2009-11-20",\N,"Solution structure of the C-terminal PH domain of hypothetical protein KIAA1914 from human",\N
10257,"10257","2009-11-24",\N,"Solution structures of the C2H2 type zinc finger domain of human zinc finger BED domain containing protein 2",\N
10258,"10258","2009-11-24",\N,"Solution structures of the fn3 domain of human ephrin type-B receptor 1",\N
10259,"10259","2009-11-24",\N,"Solution structures of the PDZ domain of human unnamed protein product",\N
10260,"10260","2009-11-24",\N,"Solution structures of the fn3 domain of human receptor-type tyrosine-protein phosphatase F",\N
10261,"10261","2009-11-24",\N,"Solution structures of the WHEP-TRS domain of human methionyl-tRNA synthetase",\N
10262,"10262","2009-11-24",\N,"Solution structures of the fn3 domain of human collagen alpha-1(XX) chain",\N
10263,"10263","2009-11-24",\N,"Solution structures of the 6th fn3 domain of human receptor-type tyrosine-protein phosphatase F",\N
10264,"10264","2010-03-11",\N,"The solution structure of the VHS domain of human Signal transducing adaptor molecule 2",\N
10265,"10265","2009-12-14",\N,"Solution structures of the fn3 domain of human receptor-type tyrosine-protein phosphatase F",\N
10266,"10266","2009-12-14",\N,"Solution structures of the fn3 domain of human receptor-type tyrosine-protein phosphatase F",\N
10267,"10267","2009-12-14",\N,"Solution structures of the PDZ domain of mus musculus PDZ domain-containing protein 1",\N
10268,"10268","2009-12-14",\N,"Solution structures of the CA domain of human protocadherin 9",\N
10269,"10269","2009-12-14",\N,"Solution structures of the Chromo domain of human chromodomain helicase-DNA-binding protein 4",\N
10270,"10270","2009-12-14",\N,"Solution structures of the fn3 domain of human contactin 1",\N
10271,"10271","2009-12-14",\N,"Solution structures of the fn3 domain of human collagen alpha-1(XX) chain",\N
10272,"10272","2009-12-14",\N,"Solution structures of the SH3 domain of human KIAA0418",\N
10273,"10273","2009-12-14",\N,"Solution structures of the TGS domain of human developmentally-regulated GTP-binding protein 1",\N
10274,"10274","2009-12-14",\N,"Solution structures of the fn3 domain of human collagen alpha-1(XX) chain",\N
10275,"10275","2009-12-14",\N,"Solution structures of the PAAD_DAPIN domain of mus musculus interferon-activatable protein 205",\N
10276,"10276","2009-12-14",\N,"Solution structure of the Tudor domain of Tudor domain containing protein 3 from mouse",\N
10277,"10277","2009-12-14",\N,"Solution structure of the Chromo domain of chromobox homolog 2 from human",\N
10278,"10278","2009-12-14",\N,"Solution structure of the PH domain of Pleckstrin homology domain-containing protein family B member 1 from mouse\"",\N
10279,"10279","2009-12-14",\N,"Solution structure of the PH domain of Docking protein 2 from human",\N
10280,"10280","2009-12-14",\N,"Solution structure of the PH domain of Oxysterol binding protein-related protein 11 from human",\N
10281,"10281","2009-12-17",\N,"Solution structure of the homeobox domain of the human paired box protein Pax-6",\N
10282,"10282","2009-12-17",\N,"Solution structure of the homeobox domain of the human hypothetical protein FLJ21616",\N
10283,"10283","2009-12-17",\N,"Solution structure of the first homeobox domain of AT-binding transcription factor 1 (ATBF1)",\N
10284,"10284","2009-12-17",\N,"Solution structure of the second homeobox domain of AT-binding transcription factor 1 (ATBF1)",\N
10285,"10285","2009-12-17",\N,"Solution structure of the third homeobox domain of AT-binding transcription factor 1 (ATBF1)",\N
10286,"10286","2009-12-17",\N,"Solution structure of the homeobox domain of the hypothetical protein, DKFZp686K21156",\N
10287,"10287","2009-12-17",\N,"Solution structure of the second homeobox domain of Zinc fingers and homeoboxes protein 3 (Triple homeobox 1 protein)",\N
10288,"10288","2009-12-17",\N,"Solution structure of the homeobox domain of Hepatocyte nuclear factor 1-beta (HNF-1beta)",\N
10289,"10289","2009-12-17",\N,"Solution structure of the homeobox domain of Zinc finger homeobox protein 1b (Smad interacting protein 1)",\N
10290,"10290","2009-12-17",\N,"The solution structure of the homeobox domain of human Homeobox protein DLX-5",\N
10291,"10291","2009-12-17",\N,"The solution structure of the homeobox domain of human homeobox protein TGIF2LX",\N
10292,"10292","2009-12-17",\N,"Solution structure of the third homeobox domain of Zinc fingers and homeoboxes protein 2",\N
10293,"10293","2009-12-17",\N,"Solution structure of the homeobox domain of LIM/homeobox protein Lhx9",\N
10294,"10294","2009-12-17",\N,"Solution structure of the homeobox domain of Homeobox protein OTX2",\N
10295,"10295","2009-12-17",\N,"Solution structure of the homeobox domain of Homeobox protein BarH-like 1",\N
10296,"10296","2009-12-17",\N,"Solution structure of the homeobox domain of Homeobox protein goosecoid",\N
10297,"10297","2009-12-17",\N,"Solution structure of the homeobox domain from human NIL-2-A zinc finger protein, transcription factor 8",\N
10298,"10298","2009-12-17",\N,"structure of the third Homeodomain from the human homeobox and leucine zipper protein, Homez",\N
10299,"10299","2010-01-11",\N,"Solution structures of the fn3 domain of human Tripartite motif protein 9",\N
10300,"10300","2010-01-11",\N,"Solution structures of the fn3 domain of human Proto-oncogene tyrosine-protein kinase MER precursor",\N
10301,"10301","2010-01-11",\N,"Solution structures of the SH3 domain of human Crk-like protein",\N
10302,"10302","2010-01-11",\N,"Solution structures of the SH3 domain of human SH3-containing GRB2-like protein 2",\N
10303,"10303","2010-03-11",\N,"Solution structure of the C2H2 type zinc finger (region 752-784) of human Zinc finger protein 28 homolog",\N
10304,"10304","2010-03-11",\N,"Solution structure of the C2H2 type zinc finger (region 544-576) of human Zinc finger protein 95 homolog",\N
10305,"10305","2010-03-11",\N,"Solution structure of the C2H2 type zinc finger (region 536-568) of human Zinc finger protein 347",\N
10306,"10306","2010-03-11",\N,"Solution structure of the 1st zf-C2H2 domain from Human B-cell lymphoma 6 protein",\N
10307,"10307","2010-03-11",\N,"Solution structure of the C2H2 type zinc finger (region 426-458) of human Zinc finger protein 473",\N
10308,"10308","2010-03-11",\N,"Solution structure of the C2H2 type zinc finger (region 484-512) of human Zinc finger protein 473",\N
10309,"10309","2010-03-11",\N,"Solution structure of the C2H2 type zinc finger (region 771-803) of human Zinc finger protein 484",\N
10310,"10310","2010-03-11",\N,"Solution structure of the C2H2 type zinc finger (region 396-428) of human Zinc finger protein 347",\N
10311,"10311","2010-03-11",\N,"Solution structure of the PH domain of PEPP-3 from human",\N
10312,"10312","2010-03-11",\N,"Solution structure of the PH domain of Protein kinase C, nu type from human",\N
10313,"10313","2010-03-11",\N,"Solution structure of the PH domain of PIP2-dependent ARF1 GTPase-activating protein from human",\N
10314,"10314","2010-03-11",\N,"Solution structure of the PH domain of Evectin-2 from mouse",\N
10315,"10315","2010-03-11",\N,"Solution structure of the PH domain of Rho GTPase activating protein 21 from human",\N
10316,"10316","2010-03-11",\N,"Solution structure of the PH domain of TBC1 domain family member 2 protein from human",\N
10317,"10317","2010-03-11",\N,"Solution structure of the PH domain of pleckstrin homology domain-containing protein family A member 5 from human",\N
10318,"10318","2010-03-11",\N,"\"Solution structure of the PTB domain of KIAA1075 protein from human\"",\N
10319,"10319","2010-03-11",\N,"Solution structure of the PH domain of KIAA0640 protein from human",\N
10320,"10320","2010-04-07",\N,"Solution structure of the 9th filamin domain from human Filamin-B",\N
10321,"10321","2010-04-07",\N,"Solution structure of the 11th filamin domain from human Filamin-B",\N
10322,"10322","2010-04-07",\N,"Solution structure of the 12th filamin domain from human Filamin-B",\N
10323,"10323","2010-04-07",\N,"Solution structure of the 13th filamin domain from human Filamin-B",\N
10324,"10324","2010-04-07",\N,"Solution structure of the 20th Filamin domain from human Filamin-B",\N
10325,"10325","2010-04-07",\N,"Solution structure of the 15th Filamin domain from human Filamin-B",\N
10326,"10326","2010-04-07",\N,"Solution structure of the 18th Filamin domain from human Filamin-B",\N
10327,"10327","2010-04-07",\N,"Solution structure of the filamin domain from human tripartite motif protein 45",\N
10328,"10328","2010-04-14",\N,"Solution structure of the 14th Filamin domain from human Filamin C",\N
10329,"10329","2010-04-14",\N,"Solution structure of the 16th Filamin domain from human Filamin C",\N
10330,"10330","2010-04-14",\N,"Solution structure of the 17th Filamin domain from human Filamin C",\N
10331,"10331","2010-04-14",\N,"Solution structure of the 22th Filamin domain from human Filamin C",\N
10332,"10332","2010-04-14",\N,"Solution structure of the 23th Filamin domain from human Filamin C",\N
10333,"10333","2010-04-14",\N,"Solution structure of the filamin domain from human BK158_1 protein",\N
10334,"10334","2010-04-14",\N,"Solution structure of the 19th filamin domain from human Filamin-B",\N
10335,"10335","2010-04-14",\N,"Solution structure of the 10th filamin domain from human Filamin-B",\N
10336,"10336","2010-12-09",\N,"Solution structure of the DUF1000 domain of a thioredoxin-like protein 1","/ftp/pub/bmrb/timedomain/bmr10336"
10337,"10337","2012-08-14",\N,"Solution structure of SH3 domain in Suppressor of T-cell receptor signaling 1",\N
11000,"11000","2008-02-20",\N,"C-Terminal Domain of Epsilon Subunit of F1F0-ATP Synthase from The Thermophilic Bacillus PS3 WITH ATP",\N
11001,"11001","2008-03-13",\N,"Solution structure of Cu(I) loaded human Sco2",\N
11002,"11002","2008-08-25","2008-11-21","NMR structure of the antimicrobial peptide RP-1 bound to SDS micelles",\N
11003,"11003","2008-08-25","2008-11-21","NMR structure of the antimicrobial peptide RP-1 bound to DPC micelles",\N
11004,"11004","2008-06-25",\N,"NMR Structure of Ebola fusion peptide in SDS micelles at pH 7",\N
11005,"11005","2007-10-08","2008-07-03","Solution structure of a bent alpha-helix",\N
11006,"11006","2010-10-22",\N,"The Glycosylated EGF-Like Repeats 12 From Mouse NOTCH-1, NMR, Minimized Average Structure",\N
11007,"11007","2008-06-25",\N,"FBP28WW2 domain in complex with PTPPPLPP peptide",\N
11008,"11008","2008-06-25",\N,"FBP28WW2 domain in complex with a PPPLIPPPP peptide",\N
11009,"11009","2008-06-25",\N,"SOLUTION STRUCTURE OF THE LSM DOMAIN OF Dm EDC3 (ENHANCER OF DECAPPING 3)",\N
11010,"11010","2008-06-27",\N,"Rac1/PRK1 Complex",\N
11011,"11011","2008-06-27",\N,"Solution structure of the N-terminal soluble domains of Bacillus subtilis CopA",\N
11013,"11013","2008-06-18",\N,"The dynein stalk head, the microtubule binding domain of dynein, derived from mouse",\N
11014,"11014","2008-07-15","2008-07-29","Liquid crystal solution structure of the kissing complex formed by the apical loop of the HIV TAR RNA and a high affinity RNA aptamer optimized by SELEX.",\N
11016,"11016","2008-06-27",\N,"Humal Insulin Mutant B31Lys -B32Arg",\N
11017,"11017","2008-03-24","2009-06-23","NMR solution structure of TnpE protein from Shigella flexneri. Northeast Structural Genomics Target SfR125.","/ftp/pub/bmrb/timedomain/bmr11017"
11018,"11018","2008-01-09","2008-07-07","NMR structure note: murine Itk SH3 domain",\N
11019,"11019","2008-06-27",\N,"Cox17",\N
11020,"11020","2008-01-09",\N,"Solution structure of human Cu(I)Cox17",\N
11021,"11021","2008-11-11","2008-11-25","NMR STRUCTURE OF THE MUTANT OF CHIGNOLIN, CLN025",\N
11022,"11022","2008-11-11",\N,"1H chemical shift assignment for big defensin",\N
11024,"11024","2008-03-05","2008-07-07","NMR STRUCTURE OF THE S. AUREUS VRAR DNA BINDING DOMAIN",\N
11026,"11026","2009-05-21",\N,"SOLUTION STRUCTURE OF ALPHA-SPECTRIN SH3-BERGERAC FROM CHICKEN",\N
11027,"11027","2009-05-21",\N,"SPECTRIN SH3 CHIMERA WITH A LIGAND LINKED TO BE BOUND IN ORIENTATION II",\N
11028,"11028","2008-04-08","2009-03-31","Solid-state NMR assignment of the rigid core of the HET-s(218-289) prion protein in its amyloid conformation.",\N
11029,"11029","2008-11-11","2010-06-30","Solution Structure of the N-terminal SAP Domain of SUMO E3 Ligases from Saccharomyces cerevisiae",\N
11030,"11030","2008-11-11","2010-06-30","Solution Structure of the N-terminal SAP Domain of SUMO E3 Ligases from Oryza sativa",\N
11031,"11031","2008-03-31",\N,"The solution structure of phtotactic transducer protein HtrII linker region from Natronomonas pharaonis",\N
11032,"11032","2008-04-16","2008-07-07","Solution structure of the knotted tudor domain of the yeast histone acetyltransferase protein, Esa1",\N
11033,"11033","2008-04-16","2008-07-07","Solution structure of the presumed chromodomain of the yeast histone acetyltransferase protein, Esa1",\N
11034,"11034","2008-12-11",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for N-terminal DNA Recognition Domain of the Bacillus subtilis transition-state regulator SpoVT",\N
11035,"11035","2009-02-27","2009-03-13","1H, 13C, and 15N chemical shift assignments for Thermus thermophilus HB8 TTHA1718 protein",\N
11036,"11036","2008-11-11",\N,"NMR solution structures of KAP-1PHD finger-bromodomain",\N
11037,"11037","2009-02-27","2009-03-13","1H, 13C, and 15N chemical shift assignments for Thermus thermophilus HB8 TTHA1718 protein in living E. coli cells",\N
11038,"11038","2009-04-29",\N,"The DNA binding domain of RTBP1",\N
11040,"11040","2008-08-28",\N,"Structural Basis of PxxDY motif recognition in SH3 binding",\N
11041,"11041","2008-06-30","2008-07-29","Solution structure of domains 3 and 4 of human ATP7B",\N
11042,"11042","2010-03-11",\N,"Assigned chemical shifts of RelE",\N
11043,"11043","2009-05-21",\N,"Structure of chimeric variant of SH3 domain - SHH",\N
11044,"11044","2009-07-17","2009-09-09","Solution structure of Magi4, a spider toxin from Macrothele gigas",\N
11045,"11045","2009-10-13","2010-01-25","Mhr1p-bound ssDNA",\N
11046,"11046","2009-10-13","2010-01-25","hsRad51-bound ssDNA",\N
11047,"11047","2009-10-13","2010-01-25","RecO-bound ssDNA",\N
11048,"11048","2009-10-13","2010-01-25","RecT-bound ssDNA",\N
11049,"11049","2009-03-03",\N,"Structure of the N-terminal BARpeptide in DPC micelles",\N
11050,"11050","2009-03-03",\N,"Structure of the N-terminal BARpeptide in SDS micelles",\N
11051,"11051","2009-04-29","2011-07-01","Disulfide-free variant of hen lysozyme: 0SS",\N
11052,"11052","2009-04-29","2011-07-01","Two-disulfide variant of hen lysozyme: 2SS[6-127, 64-80]",\N
11053,"11053","2009-07-14","2009-07-20","Chemical shifts assignment for the West Nile virus NS2B(K96A)-NS3 protease",\N
11054,"11054","2009-10-14",\N,"Solution structure of a novel insect chemokine isolated from integument",\N
11055,"11055","2008-09-29","2009-02-27","NMR structure of Grb2 SH2 domain complexed with the inhibitor",\N
11056,"11056","2009-04-17","2009-05-06","KMTM7 a peptide derived from V-ATPase subunit a, putative TM7",\N
11057,"11057","2012-07-19",\N,"MICROTUBULE BINDING DOMAIN OF DYNEIN-C",\N
11058,"11058","2009-03-18",\N,"Chemical shift assignment of PACAP21 bound to phospholipid membranes by magic angle spinning solid-state NMR",\N
11059,"11059","2009-03-18","2013-09-12","Chemical shift assignment of PACAP27 bound to phospholipid membranes by magic angle spinning solid-state NMR",\N
11060,"11060","2010-01-11",\N,"Unusual Thermal Disassembly of the SPFH Domain Oligomer from Pyrococcus horikoshii",\N
11061,"11061","2010-03-11",\N,"Solution structure of the monomeric form of mouse APOBEC2",\N
11062,"11062","2010-01-11","2010-02-04","Solution structure of mouse lipocalin-type prostaglandin D synthase possessing a intrinsic disulfide bond.",\N
11063,"11063","2010-01-12",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for KP-PmrD",\N
11064,"11064","2009-06-25","2011-07-07","Solid-state NMR assignment of the rigid core of the HET-s(218-289) prion protein in its amyloid conformation.",\N
11065,"11065","2009-04-23","2009-05-06","Solution structure of the 4.1R FERM alpha lobe domain",\N
11067,"11067","2009-04-16","2009-08-20","Backbone resonance assignments for the cytoplasmic regions of G protein-activated inwardly rectifying potassium channel1 (GIRK1)",\N
11068,"11068","2009-09-04","2010-01-21","solution structure of 1-23 GBP (growth-blocking peptide)",\N
11069,"11069","2009-09-04","2010-01-21","solution structure of 1-28 GBP (growth-blocking peptide)",\N
11070,"11070","2009-09-04","2010-01-21","DPC micelle bound structure of 1-28 GBP (growth-blocking peptide)",\N
11072,"11072","2009-07-14","2009-09-02","The solution structure of the N-terminal fragment of big defensin",\N
11073,"11073","2009-10-14",\N,"Solution structure of juvenile hormone binding protein from silkworm in complex with JH III",\N
11074,"11074","2011-06-03",\N,"Chemical shifts assignment for the segmentally labelled beta subunit (391-473 residues) of the F1-ATPase in the F1 complex",\N
11075,"11075","2010-04-01","2011-07-05","1H, 13C, and 15N Chemical Shift Assignments for N-terminal domain of kp60",\N
11076,"11076","2011-06-03",\N,"NMR based model structure of mesoderm development (MESD) in solution.",\N
11077,"11077","2009-10-14","2010-01-20","Solution structure of the E. coli ribosome hibernation promoting factor HPF",\N
11078,"11078","2010-03-12",\N,"Solution structure of the TIR domain of human MyD88",\N
11080,"11080","2011-06-03",\N,"3D structure of Pin from the psychrophilic archeon Cenarcheaum symbiosum (CsPin)",\N
11081,"11081","2011-05-19",\N,"Solution structure of the human DDEF1 SH3 domain",\N
11082,"11082","2011-05-19",\N,"Solution structure of the complex between the DDEF1 SH3 domain and the APC SAMP1 motif",\N
11083,"11083","2010-05-27",\N,"Solution structure of the Leucine Rich Repeat of human Acidic leucine-rich nuclear phosphoprotein 32 family member B",\N
11084,"11084","2011-01-04",\N,"Solution structure of the CH domain of human calponin-2",\N
11085,"11085","2011-01-04",\N,"Solution structure of the CH domain of human NEDD9 interacting protein with calponin homology and LIM domains",\N
11086,"11086","2011-01-04",\N,"Solution structure of the CH domain of human microtubule-associated protein RP/EB family member 3",\N
11087,"11087","2011-01-14",\N,"Solution structure of the PH domain of Kindlin-3 from human",\N
11088,"11088","2011-01-19",\N,"Solution structure of the PH domain of Dynamin-2 from human",\N
11089,"11089","2011-01-19",\N,"Solution structure of the PH domain of Pleckstrin homology domain-containing family A member 6 from human",\N
11090,"11090","2011-01-19",\N,"Solution structure of the N-terminal PapD-like domain of HYDIN protein from human",\N
11091,"11091","2011-01-19",\N,"Solution structure of the C-terminal PapD-like domain from human HYDIN protein",\N
11092,"11092","2011-01-19",\N,"Solution structure of the chromo domain of Mortality factor 4-like protein 1 from human",\N
11093,"11093","2011-01-19",\N,"Solution structure of the BTK motif of tyrosine-protein kinase ITK from human",\N
11094,"11094","2011-02-14",\N,"Solution structure of the complex of the PTB domain of SNT-2 and 19-residue peptide (aa 1571-1589) of hALK",\N
11095,"11095","2011-02-14",\N,"Solution structure of the chimera of the PTB domain of SNT-2 and 19-residue peptide (aa 1571-1589) of hALK",\N
11096,"11096","2011-02-17",\N,"Solution structure of the first fibronectin type III domain of human Netrin receptor DCC",\N
11097,"11097","2011-02-17",\N,"Solution structure of the fifth fibronectin type III domain of human Netrin receptor DCC",\N
11098,"11098","2011-02-17",\N,"Solution structure of the sixth fibronectin type III domain of human Netrin receptor DCC",\N
11099,"11099","2011-02-17",\N,"Solution structure of the fourth fibronectin type III domain of human Netrin receptor DCC",\N
11100,"11100","2011-02-17",\N,"The solution structure of the first thioredoxin domain of mouse Protein disulfide-isomerase A6",\N
11101,"11101","2011-02-17",\N,"The solution structure of the first thioredoxin domain of mouse Protein disulfide-isomerase A4",\N
11102,"11102","2011-02-17",\N,"The solution structure of the second thioredoxin domain of human Protein disulfide-isomerase A3",\N
11103,"11103","2011-02-17",\N,"Solution structure of the second fibronectin type III domain of human Netrin receptor DCC",\N
11104,"11104","2011-02-18",\N,"The solution structure of the second thioredoxin domain of mouse Protein disulfide-isomerase A4",\N
11105,"11105","2011-02-18",\N,"The solution structure of the thioredoxin domain of human Thioredoxin-related transmembrane protein 2",\N
11106,"11106","2011-02-18",\N,"The solution structure of the FN3 domain of human Midline 2 protein",\N
11107,"11107","2011-02-18",\N,"The solution structure of the third thioredoxin domain of human Thioredoxin domain-containing protein 5",\N
11108,"11108","2011-02-18",\N,"The solution structure of the thioredoxin domain of human Thioredoxin-like protein 2",\N
11109,"11109","2011-02-18",\N,"The solution structure of the third thioredoxin domain of mouse Protein disulfide-isomerase A4",\N
11110,"11110","2011-02-18",\N,"The solution structure of the 33rd fibronectin type III domain of human Tenascin-X",\N
11111,"11111","2011-02-18",\N,"The solution structure of the sixth fibronectin type III domain of human Neogenin",\N
11112,"11112","2011-02-18",\N,"The solution structure of the fourth fibronectin type III domain of human Neogenin",\N
11113,"11113","2011-02-18",\N,"The solution structure of the thioredoxin-like domain of human Thioredoxin-related transmembrane protein",\N
11114,"11114","2011-02-18",\N,"The solution structure of the second thioredoxin-like domain of human Protein disulfide-isomerase",\N
11115,"11115","2010-10-01",\N,"Complex structure of the zf-CW domain and the H3K4me3 peptide",\N
11116,"11116","2011-04-01",\N,"The solution structure of the second thioredoxin-like domain of human Protein disulfide-isomerase A6",\N
11117,"11117","2011-04-01",\N,"The solution structure of the second fibronectin type III domain of mouse Ephrin type-A receptor 1",\N
11118,"11118","2011-04-01",\N,"The solution structure of the fifth fibronectin type III domain of human Neogenin",\N
11119,"11119","2011-04-01",\N,"The solution structure of the first fibronectin type III domain of human Neogenin",\N
11120,"11120","2011-04-01",\N,"The solution structure of the third fibronectin type III domain of human Neogenin",\N
11121,"11121","2011-04-01",\N,"The solution structure of the second fibronectin type III domain of human Neogenin",\N
11122,"11122","2011-04-01",\N,"The solution structure of the tetratrico peptide repeat of human Smooth muscle cell associated protein-1, isoform 2",\N
11123,"11123","2011-04-01",\N,"Solution structure of the SANT domain of human SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily C member 1",\N
11124,"11124","2011-04-01",\N,"Solution structure of the CH domain of human Calponin 1",\N
11125,"11125","2011-04-01",\N,"Solution structure of the 6th fibronectin type III domain from human fibronectin type III domain containing protein 3",\N
11126,"11126","2011-04-01",\N,"Solution structure of the second CH domain of human spectrin beta chain, brain 2",\N
11127,"11127","2011-04-01",\N,"Solution structure of the 2nd fibronectin type III domain from mouse biregional cell adhesion molecule-related/down-regulated oncogenes (Cdon) binding protein",\N
11128,"11128","2011-04-01",\N,"Solution structure of the 3rd fibronectin type III domain from mouse biregional cell adhesion molecule-related/down-regulated oncogenes (Cdon) binding protein",\N
11129,"11129","2011-04-01",\N,"Solution structure of the CH domain of human Rho guanine nucleotide exchange factor 6",\N
11130,"11130","2011-04-01",\N,"Solution structure of two zf-C2H2 domains from human Zinc finger protein 512",\N
11131,"11131","2011-04-01",\N,"Solution structure of the FYVE domain from human FYVE domain containing 27 isoform b protein",\N
11132,"11132","2011-04-01",\N,"Solution structure of the HMG box like domain from human hypothetical protein FLJ14904",\N
11133,"11133","2011-04-01",\N,"Solution structure of the fourth CH domain from human L-plastin",\N
11134,"11134","2011-04-01",\N,"Solution structure of the HMG box domain from human WD repeat and HMG-box DNA binding protein 1",\N
11135,"11135","2011-04-01",\N,"Solution structure of the 8th KH type I domain from human Vigilin",\N
11136,"11136","2011-04-01",\N,"Solution structure of the 12th KH type I domain from human Vigilin",\N
11137,"11137","2011-04-01",\N,"Solution structure of the 14th KH type I domain from human Vigilin",\N
11138,"11138","2011-04-01",\N,"Solution structure of the 13th KH type I domain from human Vigilin",\N
11139,"11139","2011-04-01",\N,"Solution structure of the 1st KH type I domain from human Vigilin",\N
11140,"11140","2011-04-01",\N,"Solution structure of the 4th KH type I domain from human Vigilin",\N
11141,"11141","2011-04-01",\N,"Solution structure of the CH domain from human Vav-3 protein",\N
11142,"11142","2011-04-01",\N,"Solution structure of the CH domain from human Smoothelin splice isoform L2",\N
11143,"11143","2011-04-01",\N,"Solution structure of the CH domain from human MICAL-3 protein",\N
11144,"11144","2011-04-01",\N,"Solution structure of the DnaJ domain from human Williams-Beuren syndrome chromosome region 18 protein",\N
11145,"11145","2011-04-01",\N,"Solution structure of the CH domain from human EH domain binding protein 1",\N
11146,"11146","2011-04-01",\N,"Solution structure of the eIF-5_eIF-2B domain from human Eukaryotic translation initiation factor 5",\N
11147,"11147","2011-04-01",\N,"Solution structure of the tandem HMG box domain from Human High mobility group protein B1",\N
11148,"11148","2011-04-01",\N,"Solution structure of the TIG domain from Human Nuclear factor of activated T-cells, cytoplasmic 4",\N
11149,"11149","2012-08-02",\N,"Structural study of the UBA domain of p62 and its interaction with ubiquitin",\N
11150,"11150","2011-05-05",\N,"Solution structure of the Somatomedin B domain of human Ectonucleotide pyrophosphatase/phosphodiesterase family member",\N
11151,"11151","2011-05-05",\N,"Solution structure of the first Phorbol esters/diacylglycerol binding domain of human Protein kinase C, delta",\N
11152,"11152","2011-05-05",\N,"Solution structure of the fibronectin type III domain of human Integrin beta-4",\N
11153,"11153","2011-05-05",\N,"Solution structure of the SH3 domain of 130 kDa phosphatidylinositol 4,5-biphosphate-dependent ARF1 GTPase-activating protein",\N
11154,"11154","2011-05-05",\N,"Solution structure of the SH3 domain of Sorbin and SH3 domain-containing protein 1",\N
11155,"11155","2011-05-05",\N,"Solution structure of the SH3 domain of Abl interactor 2 (Abelson interactor 2)",\N
11156,"11156","2011-05-05",\N,"Solution structure of the SH3 domain of human Nostrin",\N
11157,"11157","2011-05-05",\N,"Solution structure of the BTK motif of human Cytoplasmic tyrosine-protein kinase BMX",\N
11158,"11158","2011-05-05",\N,"Solution structure of the HMG box of human Transcription factor SOX-17",\N
11159,"11159","2011-05-05",\N,"Solution structure of the Ring finger of human Retinoblastoma-binding protein 6",\N
11160,"11160","2011-05-05",\N,"Solution structure of the HMG box of human Myeloid/lymphoid or mixed-lineage leukemia protein 3 homolog",\N
11161,"11161","2011-05-05",\N,"Solution structure of the Zinc finger, C3HC4 type (RING finger) domain Tripartite motif protein 30",\N
11162,"11162","2011-05-05",\N,"Solution structure of the Zinc finger, C3HC4 type (RING finger) domain of RING finger protein 126",\N
11163,"11163","2011-05-05",\N,"Solution structure of the Zinc finger, C3HC4 type (RING finger) domain of Tripartite motif-containing protein 5",\N
11164,"11164","2011-05-05",\N,"Solution structure of the Zinc finger, C3HC4 type (RING finger) domain of TNF receptor-associated factor 3",\N
11165,"11165","2011-05-05",\N,"Solution structure of the C2H2 type zinc finger (region 329-359) of human Zinc finger protein 268",\N
11166,"11166","2011-05-05",\N,"Solution structure of the C2H2 type zinc finger (region 581-609) of human Zinc finger protein 268",\N
11167,"11167","2011-05-05",\N,"Solution structure of the C2H2 type zinc finger (region 508-540) of human Zinc finger protein 347",\N
11168,"11168","2011-05-05",\N,"Solution structure of the C2H2 type zinc finger (region 732-764) of human Zinc finger protein 347",\N
11169,"11169","2011-05-05",\N,"Solution structure of the C2H2 type zinc finger (region 435-467) of human Zinc finger protein 484",\N
11170,"11170","2011-05-05",\N,"Solution structure of the C2H2 type zinc finger (region 631-663) of human Zinc finger protein 484",\N
11171,"11171","2011-05-05",\N,"Solution structure of the C2H2 type zinc finger (region 659-691) of human Zinc finger protein 484",\N
11173,"11173","2010-06-16",\N,"Solution Structure of the First UBA Domain in the Human Ubiquitin Specific Protease 5 (Isopeptidase 5)",\N
11175,"11175","2010-09-09",\N,"Solution structure of calponin homology domain of IQGAP1",\N
11177,"11177","2011-06-03",\N,"Backbone chemical shift assignments for Thermus thermophilus RecO",\N
11178,"11178","2011-07-20",\N,"Solution structure of the SH3 domain of human olygophrein-1 like protein (KIAA0621)",\N
11179,"11179","2011-07-20",\N,"Solution structure of the SH3 domain of SH3-domain kinase binding protein 1",\N
11180,"11180","2011-07-20",\N,"Solution structure of the first SH3 domain of KIAA0318 protein",\N
11181,"11181","2011-07-20",\N,"Solution structure of the fourth fn3 domain of KIAA1496 protein",\N
11182,"11182","2011-07-20",\N,"Solution structure of the PDZ domain of human KIAA0340 protein",\N
11183,"11183","2011-07-20",\N,"Solution structure of the FNIII domain of human RIM-binding protein 2",\N
11184,"11184","2011-07-20",\N,"Solution structure of the second SH3 domain of human RIM-binding protein 2",\N
11185,"11185","2011-07-20",\N,"Solution structure of the third SH3 domain of human RIM-binding protein 2",\N
11186,"11186","2011-07-20",\N,"Solution structure of the fifth PDZ domain of InaD-like protein",\N
11187,"11187","2011-07-20",\N,"Solution structure of the 7th PDZ domain of InaD-like protein",\N
11188,"11188","2011-07-20",\N,"Solution structure of the first PDZ domain of InaD-like protein",\N
11189,"11189","2011-07-20",\N,"Solution structure of the second PDZ domain of human InaD-like protein",\N
11190,"11190","2011-07-20",\N,"Solution structure of the third PDZ domain of human InaD-like protein",\N
11191,"11191","2011-07-20",\N,"Solution structure of the eighth PDZ domain of human InaD-like protein",\N
11192,"11192","2011-07-20",\N,"Solution structure of the Ig-like domain(433- 525) of murine myosin-binding protein C, fast-type",\N
11193,"11193","2011-07-20",\N,"Solution structure of the first SH3 domain from human KIAA0418 protein",\N
11194,"11194","2011-07-20",\N,"Solution structure of the fifth SH3 domain from human KIAA0418 protein",\N
11195,"11195","2011-07-20",\N,"Solution structure of the PDZ domain of human Rho guanine nucleotide exchange factor 11",\N
11196,"11196","2011-07-20",\N,"Solution structure of the third SH3 domain from human KIAA1666 protein",\N
11197,"11197","2011-07-20",\N,"Solution structure of the sixth PDZ domain of human InaD-like protein",\N
11198,"11198","2011-07-20",\N,"Solution structure of the third PDZ domain of synapse-associated protein 102",\N
11199,"11199","2011-07-21",\N,"Solution structure of the PDZ domain of Enigma homologue protein",\N
11200,"11200","2011-07-21",\N,"Solution structure of the PDZ domain of Pals1 protein",\N
11201,"11201","2011-07-21",\N,"Solution structure of the fourth PDZ domain of KIAA1095 protein",\N
11202,"11202","2011-07-21",\N,"Solution structure of the PDZ domain of Spinophilin/NeurabinII protein",\N
11203,"11203","2011-07-21",\N,"Solution structure of the core domain of calcyclin binding protein; siah-interacting protein (SIP)",\N
11204,"11204","2011-07-21",\N,"Solution structure of the second PDZ domain of harmonin protein",\N
11205,"11205","2011-07-21",\N,"Solution structure of the first and second zf-C2H2 domain of Zinc finger protein 435",\N
11206,"11206","2011-07-21",\N,"Solution structure of the fourth PDZ domain of Glutamate receptor interacting protein 2",\N
11207,"11207","2011-07-21",\N,"Solution structure of the first PDZ domain of scribble homolog protein (hScrib)",\N
11208,"11208","2011-07-21",\N,"Solution structure of the second fn3 domain of Eph receptor A8 protein",\N
11209,"11209","2011-07-21",\N,"Solution structure of the SH3 domain of Endophilin B1 (Sh3g1b1)",\N
11210,"11210","2011-07-21",\N,"Solution structure of the first PDZ domain of amyloid beta A4 precursor protein-binding family A, member 1",\N
11211,"11211","2011-07-21",\N,"Solution structure of the third ig-like domain of Myosin-dinding protein C, slow-type",\N
11212,"11212","2011-07-21",\N,"Solution structure of the first ig-like domain of Myosin-binding protein C, slow-type",\N
11213,"11213","2011-07-21",\N,"Solution structure of the SH3 domain of Hypothetical protein SH3YL1",\N
11214,"11214","2011-07-21",\N,"Solution structure of the SH3 domain of Fyn-related kinase",\N
11215,"11215","2011-07-21",\N,"Solution structure of the PDZ domain of T-cell lymphoma invasion and metastasis 1 varian",\N
11216,"11216","2011-07-21",\N,"Solution structure of the third PDZ domain of PDZ domain containing protein 1",\N
11217,"11217","2011-07-21",\N,"Solution structure of the first SH3 domain of Stac protein",\N
11218,"11218","2011-07-21",\N,"Solution structure of the CIDE-N domain of human cell death activator CIDE-A",\N
11219,"11219","2011-07-21",\N,"Solution structure of the first SH3 domain of human sorbin and Sh3 domain-containing protein 1",\N
11220,"11220","2011-07-21",\N,"Solution structure of the second SH3 domain of human KIAA0769 protein",\N
11221,"11221","2011-07-21",\N,"Solution structure of the Ig-like domain (615-713) from human Obscurin-like protein 1",\N
11222,"11222","2011-07-21",\N,"Solution structure of the first SH3 domain of human KIAA0769 protein",\N
11223,"11223","2011-08-03",\N,"Solution structure of the Ig-like domain of human Leucine-rich repeat-containing protein 4",\N
11224,"11224","2011-08-03",\N,"Solution structure of the SH3 domain from Phospholipase C, gamma 2",\N
11225,"11225","2011-08-03",\N,"Solution structure of the SH3 domain of human SLIT-ROBO Rho GTPase-activating protein 2",\N
11226,"11226","2011-08-03",\N,"Solution structure of the PDZ domain from Human MAGUK p55 subfamily member 2",\N
11227,"11227","2011-08-03",\N,"Solution structure of the second fn3 domain from human Ephrin type-B receptor 4",\N
11228,"11228","2011-08-03",\N,"Solution structure of the SH3 domain from Rho guanine nucleotide exchange factor 9",\N
11229,"11229","2011-08-03",\N,"Solution structure of the Ig-like domain (714-804) from human Obscurin-like protein 1",\N
11230,"11230","2011-08-03",\N,"Solution structure of the 6th Ig-like domain from human KIAA1556",\N
11231,"11231","2011-08-03",\N,"Solution structure of the PKD domain from KIAA 1837 protein",\N
11232,"11232","2011-08-03",\N,"Solution structure of the PKD domain (329-428) from human KIAA0319",\N
11233,"11233","2011-08-03",\N,"Solution structure of the SH3 domain of human KIAA1783 protein",\N
11234,"11234","2011-08-03",\N,"Solution structure of the RING domain (1-66) from tripartite motif-containing protein 31",\N
11235,"11235","2011-08-03",\N,"Solution structure of the 6th Ig-like domain from human Myosin-binding protein C, fast-type",\N
11236,"11236","2011-08-03",\N,"Solution structure of the fourth Ig-like domain from myosin light chain kinase, smooth muscle",\N
11237,"11237","2011-08-03",\N,"Solution structure of the first and second PHD domain from Myeloid/lymphoid or mixed-lineage leukemia protein 3 homolog",\N
11238,"11238","2011-08-03",\N,"Solution structure of the C2H2-type zinc finger domain (699-729) from zinc finger protein 473",\N
11239,"11239","2011-08-03",\N,"Solution structure of the C2H2-type zinc finger domain (781-813) from zinc finger protein 473",\N
11240,"11240","2011-08-03",\N,"Solution structure of the e3_binding domain of dihydrolipoamide branched chaintransacylase",\N
11242,"11242","2011-08-03",\N,"Solution structure of the first SH3 domain of human vinexin",\N
11244,"11244","2011-08-03",\N,"Solution structure of the first SANT domain from human nuclear receptor corepressor 1",\N
11245,"11245","2011-08-03",\N,"Solution Structure of the murine ubiquitin-like 5 protein from RIKEN cDNA 0610031K06",\N
11246,"11246","2011-08-03",\N,"Solution structure of the FHA domain of mouse Afadin 6",\N
11247,"11247","2011-08-03",\N,"Solution structure of the FHA domain of human ubiquitin ligase protein RNF8",\N
11248,"11248","2011-08-03",\N,"Solution structure of the PDZ domain from mouse LIM domain kinase",\N
11249,"11249","2010-11-29","2011-06-03","Assignment of holo form GrxS14 from Populus trichocarpa",\N
11250,"11250","2011-06-24",\N,"Structure and function of the N-terminal nucleolin binding domain of nuclear valocine containing protein like 2 (NVL2) harboring a nucleolar localization signal.",\N
11251,"11251","2011-08-03",\N,"The solution structure of the C-terminal region of Zinc finger FYVE domain-containing protein 21",\N
11252,"11252","2010-09-28",\N,"Resonance assignments of HRDC domain from Bloom syndrome protein",\N
11253,"11253","2011-08-17",\N,"Solution Structure of the Ubiquitin-like Domain from Mouse Hypothetical 1700011N24Rik Protein",\N
11254,"11254","2011-08-17",\N,"Solution Structure of a N-terminal Ubiquitin-like Domain in Mouse Tubulin-specific Chaperone B",\N
11255,"11255","2011-08-17",\N,"Solution Structure of Anticodon Binding Domain from Nuclear Receptor Coactivator 5 (Human KIAA1637 Protein)",\N
11256,"11256","2011-08-17",\N,"Solution Structure of the N-terminal Ubiquitin-like Domain of Mouse Ubiquitin Specific Protease 14 (USP14)",\N
11257,"11257","2011-08-17",\N,"Solution Structure of Mouse Ubiquitin-like 3 Protein",\N
11258,"11258","2011-08-17",\N,"Solution Structure of Mouse Hypothetical Protein 2900073H19RIK",\N
11259,"11259","2011-08-17",\N,"Solution Structure of CUE domain in the C-terminal of Human Toll-interacting Protein (Tollip)",\N
11260,"11260","2011-08-17",\N,"Solution Structure of UBA domain of Human Ubiquitin Associated Protein 1 (UBAP1)",\N
11261,"11261","2011-08-18",\N,"Solution Structure of the N-terminal Ubiquitin-like Domain in the Human Ubiquilin 3 (UBQLN3)",\N
11262,"11262","2011-08-18",\N,"Solution Structure of the N-terminal Ubiquitin-like Domain in the 4931431F19Rik Protein",\N
11263,"11263","2011-08-18",\N,"Solution Structure of the N-terminal Ubiquitin-like Domain in the Human BAT3 Protein",\N
11264,"11264","2011-08-18",\N,"Solution Structure of Ras-binding Domain in Mouse AF-6 Protein",\N
11265,"11265","2011-08-18",\N,"Solution Structure of the N-terminal Ras-binding Domain (RBD) in Human a-Raf Kinase",\N
11266,"11266","2011-08-18",\N,"Solution Structure of the N-terminal Ubiquitin-like Domain in Human Np95/ICBP90-like Ring Finger Protein (NIRF)",\N
11267,"11267","2011-08-18",\N,"Solution Structure of Human SUMO-2 (SMT3B), a Ubiquitin-like Protein",\N
11268,"11268","2011-08-18",\N,"Solution Structure of the N-terminal Ubiquitin-like Domain in Mouse Ubiquitin-like Protein SB132",\N
11269,"11269","2011-08-18",\N,"Solution Structure of the N-terminal CUE Domain in the Human Mitogen-activated Protein Kinase Kinase Kinase 7 Interacting Protein 2 (MAP3K7IP2)",\N
11270,"11270","2011-08-18",\N,"Solution Structure of the Novel Identified Ubiquitin-like Domain in the Human Hypothetical Protein FLJ35834",\N
11271,"11271","2011-08-18",\N,"Solution Structure of the C-terminal UBA Domain in the Human Ubiquilin 3",\N
11272,"11272","2011-08-18",\N,"Solution Structure of the Novel Identified Ubiquitin-like Domain in the Human COBL-like 1 Protein",\N
11273,"11273","2011-08-18",\N,"Solution Structure of the Novel Identified UBA-like Domain in the N-terminal of Human Fas Associated Factor 1 Protein",\N
11274,"11274","2011-08-18",\N,"Solution Structure of the Novel Identified UBA-like Domain in the N-terminal of Human ETEA Protein",\N
11275,"11275","2011-08-18",\N,"Solution Structure of the RRM Domain in the Human Poly (ADP-ribose) Polymerase Family, Member 10 Variant",\N
11276,"11276","2011-08-18",\N,"Solution Structure of the CUE Domain in the Human CUE Domain Containing Protein 1 (CUEDC1)",\N
11277,"11277","2011-08-18",\N,"Solution Structure of the RA Domain in the Human Link Guanine Nucleotide Exchange Factor II (Link-GEFII)",\N
11278,"11278","2011-08-18",\N,"Solution Structure of the CUE Domain in the Human Activating Signal Cointegrator 1 Complex Subunit 2 (ASCC2)",\N
11279,"11279","2011-08-18",\N,"2DZI/Solution Structure of the N-terminal Ubiquitin-like Domain in Human Ubiquitin-like Protein 4A (GDX)",\N
11280,"11280","2011-08-18",\N,"2DZJ/Solution Structure of the N-terminal Ubiquitin-like Domain in Human Synaptic Glycoprotein SC2",\N
11281,"11281","2011-08-18",\N,"Structure of the UBX domain in Mouse UBX Domain-Containing Protein 2",\N
11282,"11282","2011-08-18",\N,"Solution Structure of the UBA domain in Human Protein FAM100B",\N
11283,"11283","2011-08-18",\N,"Solution Structure of the Ubiquitin-like Domain in Human FAS-associated factor 1 (hFAF1)",\N
11284,"11284","2011-08-18",\N,"Solution structure of the SH3 domain of human hypothetical protein FLJ21522",\N
11285,"11285","2011-08-18",\N,"Solution structure of the SH3 domain of mouse peroxisomal biogenesis factor 13",\N
11286,"11286","2011-08-18",\N,"Solution structure of the BSD domain of human Synapse associated protein 1",\N
11287,"11287","2011-08-18",\N,"Solution structure of the C2H2 type zinc-binding domain of human zinc finger protein 292",\N
11288,"11288","2011-08-18",\N,"Solution structure of the fibronectin type-III domain of human fibronectin type-III domain containing protein 3a",\N
11289,"11289","2011-08-18",\N,"Solution structure of the LIM domain of human Leupaxin",\N
11290,"11290","2011-08-18",\N,"Solution structure of the fibronectin type-III domain of human fibronectin type III domain containing protein 3",\N
11291,"11291","2011-08-18",\N,"Solution structure of the fibronectin type-III domain of mouse myosin-binding protein C, Fast-type homolog",\N
11292,"11292","2011-08-18",\N,"Solution structure of the fibronectin type-III domain of human protein tyrosine phosphatase, receptor type, D isoform 4 variant",\N
11293,"11293","2011-08-19",\N,"Solution structure of the LIM domain of human Cysteine-rich protein 2",\N
11294,"11294","2011-08-19",\N,"Solution structure of the RWD domain of human RWD omain containing protein 2",\N
11295,"11295","2011-08-19",\N,"Solution structure of the RWD domain of human protein C21orf6",\N
11296,"11296","2011-08-19",\N,"Solution structure of the RWD domain of human ring finger protein 25",\N
11297,"11297","2011-08-19",\N,"Solusion structure of the Todor domain of human Lamin-B receptor",\N
11298,"11298","2011-08-19",\N,"Solution structure of the BSD domain of human TFIIH basal transcription factor complex p62 subunit",\N
11299,"11299","2011-08-19",\N,"Solution structure of the SH3 domain of the human Proline-serine-threonine phosphatase-interacting protein 1",\N
11300,"11300","2011-08-19",\N,"Solution structure of the Myb_DNA-binding domain of human Cell division cycle 5-like protein",\N
11301,"11301","2011-08-19",\N,"Solution structure of the Myb_DNA-binding domain of human Cell division cycle 5-like protein",\N
11302,"11302","2011-08-19",\N,"Solution structure of the N-terminal C2H2 type zinc-binding domain of the Zinc finger protein 64, isoforms 1 and 2",\N
11303,"11303","2011-08-19",\N,"An extended conformation of the RWD domain of human Ring finger protein 25",\N
11304,"11304","2011-08-19",\N,"Solution structure of the Fibronectin type-III domain of human Neural cell adhesion molecule 2",\N
11305,"11305","2011-08-19",\N,"Solution Structure of the LIM Domain of the Human Actin Binding LIM Protein 2",\N
11306,"11306","2011-08-19",\N,"Solution Structure of the Ring-H2 Finger Domain of Mouse Deltex Protein 2",\N
11307,"11307","2011-08-19",\N,"Solution Structure of the RING finger Domain of the human UbcM4-interacting Protein 4",\N
11308,"11308","2011-08-19",\N,"Solution structure of the C2H2 zinc finger domain of the protein arginine N-methyltransferase 3 from Mus musculus",\N
11309,"11309","2011-08-19",\N,"Solution structure of the N-terminal zinc finger domain of mouse cell growth regulating nucleolar protein LYAR",\N
11310,"11310","2011-08-19",\N,"Solution structure of the C-terminal domain of mouse phosphoacetylglucosamine mutase (PAGM)",\N
11311,"11311","2011-08-19",\N,"Solution structure of the FAS1 domain of human transforming growth factor-beta induced protein IG-H3",\N
11312,"11312","2011-08-19",\N,"Solution structure of the C2H2 type zinc-binding domain of human zinc finger protein 64, isoforms 1 and 2",\N
11313,"11313","2011-08-19",\N,"Solution structure of the RING domain of the Zinc finger protein 183-like 1",\N
11314,"11314","2011-08-19",\N,"Solution Structure of the RING domain of the Synaptotagmin-like protein 4",\N
11315,"11315","2011-08-19",\N,"Solution structure of the RING domain of the Non-SMC element 1 protein",\N
11316,"11316","2011-08-19",\N,"Solution Structure of the zinc finger domain of Transcriptional repressor CTCF protein",\N
11317,"11317","2011-08-19",\N,"Solution Structure of the RING domain of the Tripartite motif protein 32",\N
11318,"11318","2011-08-19",\N,"Solution Strutcure of the SH3 domain of the Cdc42-interacting protein 4",\N
11319,"11319","2011-08-19",\N,"Solution Structure of the zinc finger BED domain of the zinc finger BED domain containing protein 1",\N
11320,"11320","2011-08-19",\N,"solution structure of the sh3 domain-binding glutamic acid-rich-like protein 2",\N
11321,"11321","2011-08-19",\N,"Solution Structure of the IBR domain of the RING finger protein 31 protein",\N
11322,"11322","2010-12-01",\N,"Solution structure of the SANT domain of human KIAA1915 protein",\N
11323,"11323","2011-08-19",\N,"Solution structure of the MYND domain of the human zinc finger MYND domain-containing protein 10",\N
11324,"11324","2011-08-19",\N,"Solution structure of the thap domain of the human thap domain-containing protein 2",\N
11325,"11325","2011-08-19",\N,"Solution structure of the RING domain of the human cellular modulator of immune recognition protein",\N
11326,"11326","2011-08-19",\N,"Solution structure of the RING domain of the human RING finger protein 146",\N
11327,"11327","2011-08-19",\N,"Solution structure of the B-box domain of the human tripartite motif-containing 63 protein",\N
11328,"11328","2011-08-19",\N,"Solution structure of the B-box domain of the zinc finger FYVE domain-containing protein 19 from Mus musculus",\N
11329,"11329","2011-08-19",\N,"Solution structure of the Bromodomain of human SWI/SNF related matrix associated actin dependent regulator of cromatin subfamily A member 2",\N
11330,"11330","2011-08-19",\N,"Solution structure of the plus-3 domain of human KIAA0252 protein",\N
11331,"11331","2011-08-19",\N,"Solution structure of the B-box domain of the human Midline-2 protein",\N
11332,"11332","2011-08-19",\N,"Solution structure of the RING domain of the human Polycomb group RING finger protein 6",\N
11333,"11333","2011-08-19",\N,"Solution structure of the CHY zinc finger domain of the RING finger and CHY zinc finger domain-containing protein 1 from Mus musculus",\N
11334,"11334","2011-08-19",\N,"Solution structure of the TFIIS domain II of human PHD finger protein 3",\N
11335,"11335","2011-08-19",\N,"Solution Structure of the RING domain of the human Cell growth regulator with RING finger domain 1 protein",\N
11336,"11336","2011-08-19",\N,"Solution Structure of the RING domain of the human ring finger protein 4",\N
11337,"11337","2011-08-19",\N,"Solution structure of the RWD domain of human RWD domain containing protein 3",\N
11338,"11338","2011-08-19",\N,"Solution structure of the RWD domain of human RWD domain containing protein 1",\N
11339,"11339","2011-08-19",\N,"Solution structure of the ring domain of the Baculoviral IAP repeat-containing protein 4 from Homo sapiens",\N
11340,"11340","2011-08-19",\N,"Solution structure of the RING domain of the human TNF receptor-associated factor 6 protein",\N
11341,"11341","2011-08-19",\N,"Solution structure of the RING domain of the human tripartite motif-containing protein 39",\N
11342,"11342","2011-08-19",\N,"Solution Structure of the RING domain of the human RING-box protein 2",\N
11343,"11343","2011-08-19",\N,"Solution structure of the RING domain of the RING finger and CHY zinc finger domain-containing protein 1 from Mus musculus",\N
11344,"11344","2011-08-19",\N,"Solution structure of the RING domain of the human RING finger protein 141",\N
11345,"11345","2011-08-19",\N,"Solution structure of the SWIRM domain of baker's yeast Transcriptional adapter 2",\N
11346,"11346","2011-09-07",\N,"Solution structure of Fn14 CRD domain",\N
11347,"11347","2011-09-07",\N,"Solution structure of the PHD domain in PHD finger protein 21A",\N
11348,"11348","2011-09-07",\N,"Solution structure of the NEUZ domain in KIAA1787 protein",\N
11349,"11349","2011-09-07",\N,"Solution structure of LIM domain in LIM-protein 3",\N
11350,"11350","2011-09-07",\N,"Solution structure of LIM domain in Four and a half LIM domains protein 2",\N
11351,"11351","2011-09-07",\N,"Solution structure of the NEUZ (NHR) domain in Neuralized from Drosophila melanogaster",\N
11352,"11352","2011-09-07",\N,"Solution structure of PHD domain in inhibitor of growth family, member 1-like",\N
11353,"11353","2011-09-07",\N,"Solution structure of PHD domain in inhibitor of growth protein 3 (ING3)",\N
11354,"11354","2011-09-07",\N,"Solution structure of PHD domain in ING1-like protein BAC25079",\N
11355,"11355","2011-09-07",\N,"Solution structure of Splicing Factor Motif in Pre-mRNA splicing factor 18 (hPRP18)",\N
11356,"11356","2011-09-07",\N,"Solution structure of SH3 domain in Rac/Cdc42 guanine nucleotide exchange factor(GEF) 6",\N
11357,"11357","2011-09-07",\N,"Solution structure of WW domain in transcription elongation regulator 1",\N
11358,"11358","2011-01-04",\N,"Assigned chemical shifts of the zf-CW domain with H3 peptide",\N
11359,"11359","2011-01-04",\N,"Assigned chemical shifts of the zf-CW domain with H3 dimethyl K4 peptide",\N
11360,"11360","2011-01-04",\N,"Assigned chemical shifts of the zf-CW domain with H3 trimethyl K4 peptide",\N
11361,"11361","2011-01-04",\N,"Assigned chemical shifts of the zf-CW domain with H4 trimethyl K20 peptide",\N
11362,"11362","2011-01-04",\N,"Assigned chemical shifts of the zf-CW domain in zinc finger CW-type PWWP domain protein 1",\N
11363,"11363","2011-09-07",\N,"Solution structure of zinc finger HIT domain in protein FON",\N
11364,"11364","2011-09-07",\N,"Solution structure of the first SURP domain of human splicing factor SF3a120",\N
11365,"11365","2011-09-07",\N,"Solution structure of the second SURP domain of human splicing factor SF3a120 in complex with a fragment of human splicing factor SF3a60",\N
11366,"11366","2011-09-07",\N,"Assigned chemical shifts of the human spliceosomal protein complex p14-SF3b155",\N
11367,"11367","2011-09-07",\N,"Assigned chemical shifts of the human spliceosomal protein SF3b155",\N
11368,"11368","2011-09-07",\N,"Solution structure of the C2H2 type zinc finger (region 656-688) of human Zinc finger protein 95 homolog",\N
11369,"11369","2011-09-07",\N,"Solution structure of the C2H2 type zinc finger (region 507-539) of human Zinc finger protein 224",\N
11370,"11370","2010-11-30",\N,"Assigned chemical shifts of the second RNA recognition motif (RRM) of TIA-1, C terminal truncated",\N
11371,"11371","2010-11-30",\N,"Assigned chemical shifts of the second RNA recognition motif (RRM) of TIA-1, D131A mutant",\N
11372,"11372","2010-11-30",\N,"Assigned chemical shifts of the second RNA recognition motif (RRM) of TIA-1, K138A mutant",\N
11373,"11373","2010-11-30",\N,"Assigned chemical shifts of the second RNA recognition motif (RRM) of TIA-1, T134A mutant",\N
11374,"11374","2010-11-30",\N,"Assigned chemical shifts of the second RNA recognition motif (RRM) of TIA-1 with RNA (CCCCC)",\N
11375,"11375","2010-11-30",\N,"Assigned chemical shifts of the second RNA recognition motif (RRM) of TIA-1 with RNA (UUUUU)",\N
11376,"11376","2010-11-30",\N,"Assigned chemical shifts of the second RNA recognition motif (RRM) of TIA-1",\N
11377,"11377","2011-09-07",\N,"Solution structure of the first C2H2 type zinc finger domain of Zinc finger protein 278",\N
11378,"11378","2011-09-07",\N,"Solution structure of the third zinc finger domain of Zinc finger protein 278",\N
11379,"11379","2011-09-07",\N,"Solution structure of the secound zinc finger domain of Zinc finger protein 278",\N
11380,"11380","2011-09-07",\N,"Solution structure of the 4th zinc finger domain of Zinc finger protein 278",\N
11381,"11381","2011-09-07",\N,"Solution structure of the first C2H2 type zinc finger domain of Zinc finger protein 32",\N
11382,"11382","2011-09-07",\N,"Solution structure of the secound C2H2 type zinc finger domain of Zinc finger protein 32",\N
11383,"11383","2011-09-07",\N,"Solution structure of the 20th C2H2 type zinc finger domain of Zinc finger protein 268",\N
11384,"11384","2011-09-07",\N,"Solution structure of the 24th C2H2 type zinc finger domain of Zinc finger protein 268",\N
11385,"11385","2011-09-07",\N,"Solution structure of the third C2H2 type zinc finger domain of Zinc finger protein 28 homolog",\N
11386,"11386","2011-09-07",\N,"Solution structure of the 9th C2H2 type zinc finger domain of Zinc finger protein 347",\N
11387,"11387","2011-09-07",\N,"Solution structure of the 16th C2H2 type zinc finger domain of Zinc finger protein 347",\N
11388,"11388","2011-09-07",\N,"Solution structure of the ARID domain of Jarid1b protein",\N
11389,"11389","2011-09-07",\N,"Solution structure of the ARID domain of JARID1D protein",\N
11390,"11390","2011-09-08",\N,"Solution structure of the death domain of Ankyrin-1",\N
11391,"11391","2011-09-08",\N,"Solution structure of the 10th C2H2 type zinc finger domain of Zinc finger protein 268",\N
11392,"11392","2011-09-08",\N,"Solution structure of the 4th C2H2 type zinc finger domain of Zinc finger protein 28 homolog",\N
11393,"11393","2011-09-08",\N,"Solution structure of the 8th C2H2 type zinc finger domain of Zinc finger protein 347",\N
11394,"11394","2011-09-08",\N,"Solution structure of the 17th C2H2 type zinc finger domain of Zinc finger protein 347",\N
11395,"11395","2011-09-08",\N,"Solution structure of the 11th C2H2 type zinc finger domain of Zinc finger protein 224",\N
11396,"11396","2011-09-08",\N,"Solution structure of the 6th C2H2 type zinc finger domain of Zinc finger protein 484",\N
11397,"11397","2011-09-08",\N,"Solution structure of the BACK domain of Kelch repeat and BTB domain-containing protein 4",\N
11398,"11398","2011-09-08",\N,"Solution structure of PDZ domain in protein XP_110852",\N
11399,"11399","2011-09-08",\N,"solution structure of RNA binding domain in PTB-like protein L",\N
11400,"11400","2011-09-08",\N,"Solution Structure of the RNA recognition motif in Arginine/serine-rich splicing factor 10",\N
11401,"11401","2011-09-08",\N,"Solution structure of the phorbol esters/diacylglycerol binding domain of protein kinase C gamma",\N
11402,"11402","2011-09-08",\N,"Solution structure of chromo domain 2 in Chromodomain-helicase-DNA-binding protein 6",\N
11403,"11403","2011-09-08",\N,"Solution structure of Zinc finger domain 7 in Zinc finger protein 32",\N
11404,"11404","2011-09-08",\N,"Solution structure of SH3 domain in Rho-GTPase-activating protein 4",\N
11405,"11405","2011-06-24",\N,"Assigned chemical shifts of RNA binding domain 3",\N
11406,"11406","2011-06-24",\N,"Assigned chemical shifts of RNA binding domain 3 in RNA (CUGCUG)",\N
11407,"11407","2011-06-24",\N,"Assigned chemical shifts of RNA binding domain 3 in RNA (UAUAUA)",\N
11408,"11408","2011-06-24",\N,"Assigned chemical shifts of RNA-binding domain 3 of CUGBP1 in complex with RNA (UG)3",\N
11409,"11409","2011-09-08",\N,"Assigned chemical shifts of RNA binding domain in human Tra2 beta protein in complex with RNA (GAAGAA)",\N
11410,"11410","2011-09-08",\N,"Assigned chemical shifts of RNA binding domain in human Tra2 beta protein in complex with RNA (GACUUCAACAAGUC)",\N
11411,"11411","2011-09-08",\N,"Assigned chemical shifts of RNA binding domain in human Tra2 beta protein in complex with RNA (AAAAAA)",\N
11412,"11412","2011-09-08",\N,"Assigned chemical shifts of RNA binding domain in human Tra2 beta protein in complex with RNA (UCAAU)",\N
11413,"11413","2011-09-08",\N,"Refinement of RNA binding domain in human Tra2 beta protein",\N
11414,"11414","2011-09-08",\N,"Solution structure of C2H2 type Zinc finger domain 345 in Zinc finger protein 278",\N
11415,"11415","2011-09-08",\N,"Solution structure of C2H2 type Zinc finger domain 3 in Zinc finger protein 32",\N
11416,"11416","2011-09-08",\N,"Solution structure of C2H2 type Zinc finger domain 5 in Zinc finger protein 32",\N
11417,"11417","2010-10-08",\N,"Solution structure of the J domain of DnaJ homolog subfamily B member 8",\N
11419,"11419","2011-05-19",\N,"NMR structure of vasoactive intestinal peptide in Methanol",\N
11420,"11420","2011-05-19",\N,"NMR structure of vasoactive intestinal peptide in DPC Micelle",\N
11422,"11422","2011-05-19","2013-02-07","Solution structure of the E. coli ORF135 protein",\N
11423,"11423","2011-06-22",\N,"Solution structure of the C-terminal domain of the FliK",\N
11424,"11424","2011-07-01",\N,"Interplay between phosphatidyl-inositol-phosphates and claudins upon binding to the 1st PDZ domain of zonula ocludens 1",\N
11425,"11425","2011-06-21",\N,"1H, 13C, and 15N resonance assignment of the SPFH domain of human stomatin.",\N
11426,"11426","2012-01-30",\N,"Solution structure of SecDF periplasmic domain P4",\N
11427,"11427","2011-05-19",\N,"NMR assignments of ubiquitin fold domain (UFD) in SUMO-activating enzyme subunit 2 from rice",\N
11428,"11428","2011-09-28",\N,"1H, 15N chemical shift assignments for a disulfide-deficient mutant of the starch-binding domain of glucoamylase",\N
11429,"11429","2012-06-05",\N,"SOLUTION STRUCTURE OF THE N-TERMINAL DOMAIN OF THE HMGB2",\N
11430,"11430","2012-06-05",\N,"SOLUTION STRUCTURE OF THE C-TERMINAL DOMAIN OF THE HMGB2",\N
11431,"11431","2012-06-05",\N,"SOLUTION STRUCTURE OF THE C-TERMINAL DOMAIN OF THE HMGB2 (H22Y)",\N
11434,"11434","2012-02-08",\N,"NMR Chemical Shift Assignments for Ostrich egg white Lysozyme",\N
11435,"11435","2011-06-07",\N,"1H, 13C, and 15N Chemical Shift Assignments for amyloid-beta-(1-40)",\N
11436,"11436","2011-09-01",\N,"NMR Chemical Shift Assignments for E73A mutant of Ostrich egg white Lysozyme",\N
11437,"11437","2011-06-24",\N,"DNA oligmer containing propylene cross-linked cyclic 2' -deoxyuridylate dimer",\N
11438,"11438","2011-06-22",\N,"DNA oligomer containing ethylene cross-linked cyclic 2'-deoxyuridylate dimer",\N
11439,"11439","2012-04-09","2013-03-20","NMR Structure of LC4 transmembrane segment of CCR5",\N
11440,"11440","2011-08-19",\N,"Solution structure of Magnesium-bound form of calmodulin C-domain E104D/E140D mutant",\N
11441,"11441","2011-06-09","2011-07-05","NMR chemical shift of bryum coronatum chitinase",\N
11442,"11442","2011-08-17",\N,"Backbone 1H, 13C and 15N chemical shift assignments of Hd3a (K31A/E57A)",\N
11443,"11443","2011-07-05",\N,"Crystal structure of the UBA domain of p62 and its interaction with ubiquitin",\N
11450,"11450","2012-08-17",\N,"1H, 13C, and 15N Chemical Shift Assignments for Musashi1 RBD1:r(GUAGU) complex",\N
11452,"11452","2012-08-07",\N,"NMR chemical shift assignments for stomagen from Arabidopsis thaliana",\N
11454,"11454","2012-12-06",\N,"NMR Chemical Shift Assignments for QB domain of Sp1",\N
11456,"11456","2012-08-29",\N,"Solution structure of the N-terminal dsRBD from RNA helicase A",\N
11457,"11457","2012-08-29",\N,"Solution structure of the second dsRBD from RNA helicase A",\N
11458,"11458","2012-12-18",\N,"Solution structure of the N-terminal RNA recognition motif of NonO",\N
11459,"11459","2013-04-04",\N,"One-disulfide variant of hen lysozyme: 1SS[6-127]",\N
11460,"11460","2013-04-04",\N,"One-disulfide variant of hen lysozyme: 1SS[30-115]",\N
11461,"11461","2013-04-04",\N,"One-disulfide variant of hen lysozyme: 1SS[64-80]",\N
11462,"11462","2013-04-04",\N,"One-disulfide variant of hen lysozyme: 1SS[76-94]",\N
11463,"11463","2012-12-10","2013-03-26","Solution structure of the bromodomain of human BRPF1 in complex with histone H4K5ac peptide",\N
11466,"11466","2012-11-02",\N,"NMR chemical shift of bryum coronatum chitinase E61A mutant",\N
11467,"11467","2012-03-06",\N,"Family GH19 chitinase from Rye seeds",\N
11468,"11468","2013-01-03",\N,"Solution STRUCTURE OF THE BOMBYX MORI LYSOZYME",\N
11469,"11469","2012-08-13",\N,"Solution structure of the plant homeodomain (PHD) of the E3 SUMO ligase Siz1 from rice",\N
11471,"11471","2012-06-01",\N,"NMR structure of FKBP12-mTOR FRB domain-rapamycin complex structure determined based on PCS",\N
11472,"11472","2013-03-04",\N,"Complex structure of WWE in RNF146 with ATP",\N
11473,"11473","2012-08-13","2012-08-30","Solution structure of the CERT PH domain",\N
11486,"11486","2013-03-12",\N,"Solution structures of the DNA-binding domains of immune-related zinc-finger protein ZFAT",\N
11487,"11487","2013-03-12",\N,"Solution structures of the DNA-binding domains of immune-related zinc-finger protein ZFAT",\N
11488,"11488","2013-03-12",\N,"Solution structures of the DNA-binding domains of immune-related zinc-finger protein ZFAT",\N
11489,"11489","2013-02-11",\N,"RNA aptamer against prion protein in complex with the partial binding peptide",\N
11490,"11490","2014-01-14",\N,"Backbone and side-chain 1H, 15N and 13C resonance assignments of the microtubule-binding domains of yeast cytoplasmic dynein in the high affinity state",\N
11491,"11491","2012-08-06",\N,"Solution structure and siRNA-mediated knockdown analysis of the mitochondrial disease-related protein C12orf65 (ICT2)",\N
11492,"11492","2012-08-06",\N,"Dihydrofolate Reductase from E.coli G67 deletion mutant",\N
11493,"11493","2012-05-02",\N,"NMR chemical shift of Streptomyces sp. N174 chitosanase",\N
11494,"11494","2012-05-02",\N,"NMR chemical shift of E22A mutant of Streptomyces sp. N174 chitosanase",\N
11495,"11495","2014-01-14",\N,"Backbone and side-chain 1H, 15N and 13C resonance assignments of the microtubule-binding domains of yeast cytoplasmic dynein in the low affinity state",\N
11496,"11496","2012-08-27",\N,"Solution structure of the chromodomain of Chp1 in complex with H3K9me3 peptide",\N
11497,"11497","2012-08-27",\N,"Solution structure of the chromodomain of Swi6",\N
11502,"11502","2013-04-01",\N,"Copper(I) loaded form of the first domain of the human copper chaperone for SOD1, CCS",\N
11504,"11504","2013-12-02",\N,"Structure of SPOC domain of the human transcriptional corepressor SHARP",\N
11505,"11505","2013-03-25",\N,"Alternative structure of Ubiquitin",\N
11506,"11506","2013-12-02",\N,"Solution structure of human full-length vaccinia related kinase 1 (VRK1)",\N
11507,"11507","2012-10-29","2013-01-18","Solution structure of IseA, an inhibitor protein of DL-endopeptidases from Bacillus subtilis",\N
11508,"11508","2013-04-08",\N,"Solution structure of the SH2 domain of Csk in complex with a phosphopeptide from Cbp",\N
11513,"11513","2012-11-02",\N,"NMR chemical shift of carbohydrate binding module, C1, derived from GH8 chitosanase/glucanase from Paenibacillus fukuinensis D2",\N
11514,"11514","2012-11-02",\N,"NMR chemical shift of carbohydrate binding module, C2, derived from GH8 chitosanase from Paenibacillus fukuinensis D2",\N
11516,"11516","2012-12-10",\N,"THE SOLUTION STRUCTURE OF THE C-TERMINAL DOMAIN OF HUMAN ACTIVATOR OF 90 KDA HEAT SHOCK PROTEIN ATPASE HOMOLOG 1",\N
11519,"11519","2013-02-15",\N,"The chemical shift assignments of the headpiece subdomain of chicken villin protein under the diluted condition",\N
11520,"11520","2013-02-15",\N,"The chemical shift assignments of the headpiece subdomain of chicken villin protein under the crowded condition",\N
11521,"11521","2013-02-15",\N,"The chemical shift assignments of the headpiece subdomain of chicken villin protein under the crowded condition with the segment B1 of streptococcal protein G",\N
11522,"11522","2013-06-04",\N,"1H, 13C and 15N backbone resonance assignments of the monomeric human M-ficolin fibrinogen-like domain secreted by Brevibacillus choshinensis",\N
11524,"11524","2014-01-02",\N,"NMR Structure of designed protein, AF.2A1, (Ensembles)",\N
11525,"11525","2013-08-05",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for PriC N-terminal domain",\N
11526,"11526","2013-10-04",\N,"Backbone 1H, 13C, and 15N assignments of yeast Ump1, an intrinsically disordered protein operating as proteasome assembly chaperone",\N
11528,"11528","2014-03-03",\N,"STRUCTURE OF METALLO-DNA IN SOLUTION",\N
11532,"11532","2014-03-03",\N,"solution structure of oxidized human HMGB1 A box",\N
11534,"11534","2013-12-23",\N,"Solution structure of the GGQ domain of YaeJ protein from Escherichia coli",\N
11538,"11538","2014-02-14",\N,"Tachyplesin I in the presence of lipopolysaccharide",\N
11539,"11539","2014-02-14",\N,"Tachyplesin I in water",\N
11547,"11547","2014-02-04",\N,"the pure alternative state of ubiquitin",\N
15000,"15000","2006-10-20","2008-07-17","Solution structure of chicken villin headpiece subdomain containing a fluorinated side chain in the core",\N
15001,"15001","2007-06-18","2009-02-19","Structures and chemical shift assignments for the ADD domain of the ATRX protein",\N
15002,"15002","2007-10-09",\N,"Solution structure of the THAP domain from C. elegans C-terminal binding protein (CtBP)",\N
15003,"15003","2008-02-04","2008-07-17","SOLUTION STRUCTURE OF GROUP IV WW DOMAIN: A.NIDULANS PINA",\N
15007,"15007","2008-02-04",\N,"Structural Studies on Plasmodium vivax Merozoite Surface Protein-1",\N
15008,"15008","2007-05-09",\N,"Backbone and Side Chain 1H, 13C and 15N Chemical Shift Assignments for Sporulation Phosphotransferase F Mutant H101A",\N
15009,"15009","2007-05-09",\N,"Backbone and Side Chain 1H, 13C, 15N Chemical Shift Assignments for Sporulation Phosphotransferase F Mutant I90A",\N
15010,"15010","2007-05-09",\N,"Backbone and Side Chain 1H, 13C and 15N Chemical Shift Assignments for Sporulation phosphotransferase F mutant L66A",\N
15011,"15011","2007-05-09",\N,"Backbone and Side Chain 1H, 13C and 15N Chemical Shift Assignments for Sporulation phosphotransferase F mutant Y13A",\N
15012,"15012","2008-05-12",\N,"chemical shift assignment of the protein Atu4866 from Agrobacterium tumefaciens",\N
15013,"15013","2007-05-10",\N,"Chimer between Spc-SH3 and P41",\N
15014,"15014","2007-04-24",\N,"Solution structure of the RING domain from human TRAF6.",\N
15016,"15016","2007-10-09",\N,"Solution structure of the Su(dx) WW4 - Notch peptide complex",\N
15019,"15019","2006-12-06",\N,"NMR assignments for a helical diacylglycerol kinase (DAGK), 40 kDa membrane protein from E. coli",\N
15020,"15020","2007-05-04",\N,"Structure of the N-WASP EVH1 domain in complex with an extended WIP peptide",\N
15021,"15021","2008-06-24",\N,"Structural and Dynamical Analysis of a Four-Alpha-Helix Bundle with Designed Anesthetic Binding Pockets",\N
15023,"15023","2007-02-08",\N,"1H, and 15N Chemical Shift Assignments for the N-terminal domain of Myxococcus xantus CarA protein.",\N
15025,"15025","2008-02-04",\N,"Backbone 1H Chemical Shift Assignments for peptide sMTM7 from subunit a of proton V-ATPase",\N
15026,"15026","2007-10-09","2010-07-16","NMR Structure of the IQ-modified Dodecamer CTCGGC[IQ]GCCATC",\N
15027,"15027","2007-10-09","2010-07-16","NMR Structure of the B-DNA Dodecamer CTCGGCGCCATC",\N
15028,"15028","2008-06-23",\N,"1H, 13C, and 15N Chemical Shift Assignments of Trx-ArsC complex",\N
15031,"15031","2007-05-09",\N,"Solution Structure of alpha-Conotoxin BuIA",\N
15032,"15032","2007-05-09","2008-07-17","Chemical shift assignments of the type 1 pilus subunit FimF",\N
15033,"15033","2007-10-16","2010-07-20","Dimeric solution structure of the cyclic octamer d(CCGTCCGT)",\N
15034,"15034","2007-06-27","2009-09-03","1H,13C and 15N NMR Assignments of the Yellow Fever Envelope Protein Domain III",\N
15035,"15035","2007-02-08",\N,"1H, and 15N Chemical Shift Assignments for the N-terminal domain of Myxococcus xantus CarA protein.",\N
15036,"15036","2007-01-10",\N,"SOLUTION STRUCTURE OF HUMAN BETA-MICROSEMINOPROTEIN",\N
15037,"15037","2007-01-10",\N,"Solution structure of human beta-microseminoprotein",\N
15038,"15038","2007-06-27","2009-09-03","1H, 13C, and 15N resonance assignments of FK506-binding domain of Plasmodium falciparum FKBP35",\N
15039,"15039","2007-10-16",\N,"solution structure of ta0956",\N
15040,"15040","2006-12-18",\N,"DPC micelle-bound NMR structures of Tritrp2",\N
15041,"15041","2006-12-18","2007-10-30","DPC micelle-bound NMR structures of Tritrp3",\N
15042,"15042","2006-12-18","2007-10-30","DPC micelle-bound NMR structures of Tritrp5",\N
15043,"15043","2006-12-18","2007-10-30","DPC micelle-bound NMR structures of Tritrp7",\N
15044,"15044","2006-12-18","2007-10-30","DPC micelle-bound NMR structures of Tritrp8",\N
15045,"15045","2007-05-21",\N,"NMR SOLUTION STRUCTURE OF A MINIMAL TRANSMEMBRANE BETA-BARREL PLATFORM PROTEIN",\N
15046,"15046","2007-06-26","2009-09-03","1H, 13C, and 15N resonance assignments of subunit F of the A1AO ATP synthase from Methanosarcina mazei Go1",\N
15047,"15047","2006-12-11","2007-05-09","Ubiquitin in 8 M Urea",\N
15048,"15048","2007-11-21","2009-09-03","Rub184",\N
15049,"15049","2007-05-09","2008-07-17","Resonance assignment of the first and second KH (hnRNP-K homology) domains of human poly(C)-binding protein-2 (PCBP2)",\N
15050,"15050","2007-10-16",\N,"piscidin solution structure in presence of DPC micelles",\N
15051,"15051","2007-01-10",\N,"DPC micelle-bound NMR structures of Tritrp1",\N
15052,"15052","2007-02-01","2008-10-08","HPRP-173-195-D178N SOLUTION STRUCTURE",\N
15053,"15053","2007-02-01","2008-10-08","HPRP-173-195 SOLUTION STRUCTURE",\N
15054,"15054","2007-02-01","2008-10-08","HPRP180-195 STRUCTURE",\N
15055,"15055","2007-10-16","2008-07-17","Structure for the N-terminus of chromosomal replication initiation protein dnaA from M. genitalium",\N
15056,"15056","2007-10-16",\N,"Antiamoebin-I in methanol solution - rapid exchange between right- and left-handed 3-10-helical conformations",\N
15057,"15057","2008-06-24",\N,"Solution Structrue of C-terminal Bromodomain of Brd4",\N
15058,"15058","2007-10-16",\N,"1H assignment of En-6",\N
15059,"15059","2007-06-26","2009-09-03","1H, 13C, and 15N Chemical Shift Assignments for the muscular LIM protein MLP/CRP3.",\N
15060,"15060","2007-10-16",\N,"NMR structure of the murine DLC2 (deleted in liver cancer -2) SAM (sterile alpha motif) domain",\N
15061,"15061","2007-06-26","2009-09-03","NMR assignment of a KlbA intein precursor from Methanococcus jannaschii",\N
15063,"15063","2007-02-23","2009-06-23","NMR structure of the mouse thiamine triphosphatase","/ftp/pub/bmrb/timedomain/bmr15063"
15064,"15064","2007-02-22","2007-05-18","apo-WT chicken Triosephosphate Isomerase (TIM)",\N
15065,"15065","2007-02-23","2007-05-18","2-PGA-bound WT chicken Triosephosphate Isomerase (TIM)",\N
15066,"15066","2007-02-23","2007-05-18","apo-PGG/GGG chicken Triosephosphate Isomerase (TIM)",\N
15067,"15067","2007-02-23","2007-05-18","2-PGA-bound PGG/GGG chicken Triosephosphate Isomerase (TIM)",\N
15068,"15068","2007-02-01","2008-07-17","Structure-Activity Analysis of Quorum-Sensing Signaling Peptides from Streptococcus mutans",\N
15069,"15069","2007-02-01","2008-07-17","Structure-Activity Analysis of Synthetic Quorum-Sensing Signal Peptides from Streptococcus mutans",\N
15070,"15070","2007-06-26","2009-09-03","NMR Assignments of the apo Corynebacterium diphtheria Heme Oxygenase-G135A",\N
15071,"15071","2007-06-26","2009-09-03","NMR Assignments of the apo Corynebacterium diphtheria Heme Oxygenase",\N
15072,"15072","2007-04-17",\N,"OSCP-NT (1-120) in complex with N-terminal (1-25) alpha subunit from F1-ATPase",\N
15073,"15073","2007-06-26","2009-09-03","NMR assignments of CO-bound ferrous Corynebacterium diphtheria Heme Oxygenase",\N
15074,"15074","2007-05-09","2010-01-08","Assignment of the 1H, 15N and 13C resonances and determination of the 3D- structure of In-Between-RING (IBR) domain of Parkin",\N
15075,"15075","2007-10-17",\N,"Merozoite surface protein 2 (MSP2) of Plasmodium falciparum: expression, structure and amyloid formation of the conserved N-terminal domain",\N
15076,"15076","2007-10-17",\N,"Dynein Light Chain LC8 at pH 5.5",\N
15077,"15077","2007-10-17",\N,"Dynein Light Chain LC8 at pH 5.5, complex with Swa peptide",\N
15078,"15078","2007-10-17",\N,"Dynein Light Chain LC8 at pH 5.5, complex with IC peptide",\N
15079,"15079","2007-02-23","2007-04-24","Solution NMR structure of the ygdR protein from Escherichia coli. Northeast Structural Genomics target ER382A.",\N
15080,"15080","2007-02-02","2008-07-17","U2 snRNA stem I from S. cerevisiae",\N
15081,"15081","2007-02-02","2009-01-30","U2 snRNA stem I from human",\N
15082,"15082","2007-03-08","2008-07-17","HN,CA,CB Chemical shift assignments for apo-Rat intestinal fatty acid binding protein, Clofibric acid-Rat intestinal fatty acid binding protein complex, Fenofibric acid-Rat intestinal fatty acid binding protein complex and Tolfenamic acid-Rat intestinal f",\N
15083,"15083","2007-10-17","2010-07-14","NMR Structure of the Sigma-54 RpoN Domain Bound to the-24 Promoter Element",\N
15084,"15084","2008-02-11","2008-10-03","NMR structure of cl-BABP complexed to chenodeoxycholic acid",\N
15085,"15085","2007-02-09",\N,"Complete Assignment of a hypothetical portein RP4601 (NESG ID: RpT2)from Rhodopseudomonas palustris.",\N
15086,"15086","2007-02-23","2008-07-17","Solution NMR structure of Hypothetical Protein Cgl2762 from Corynebacterium Glutamicum: Northeast Structural Genomics Consortium Target CgR3",\N
15087,"15087","2007-03-05","2008-07-17","SOLUTION STRUCTURE OF THE PABC DOMAIN FROM TRITICUM AEVESTIUM POLY(A)-BINDING PROTEIN",\N
15088,"15088","2007-02-23","2009-06-23","Northeast Structural Genomics Consortium Target ER411","/ftp/pub/bmrb/timedomain/bmr15088"
15089,"15089","2008-09-15","2010-09-28","Solution NMR structure of Q8ZRJ2 from Salmonella typhimurium. Northeast Structural Genomics target StR65.","/ftp/pub/bmrb/timedomain/bmr15089"
15090,"15090","2007-03-06",\N,"Solution NMR Structure of Salmonella typhimurium LT2 Secreted Protein STM0082: Northeast Structural Genomics Consortium Target StR109",\N
15091,"15091","2007-08-22","2009-09-03","Lipid Free Mouse Apolipoprotein-AI(mAI216)NMR Backbone Assignment",\N
15092,"15092","2007-04-24",\N,"1H, 13C, 15N chemical shift assignments for the human E2 ubiquitin conjugating enzyme Ubc13",\N
15093,"15093","2007-06-26","2009-09-03","preB ApoAI backbone assignment",\N
15094,"15094","2007-10-17","2008-07-02","1H, 13C, and 15N Chemical Shift Assignments for CutA1 from E. coli",\N
15095,"15095","2009-09-29","2010-01-26","Solution Structure of a Dodecapeptide from Alpha-Synuclein Bound with Synphilin-1",\N
15097,"15097","2007-08-21",\N,"Dynamics and Calcium-Dependent Actin Bundling by the two Carboxy Terminal Domains of Villin",\N
15098,"15098","2012-08-03",\N,"SOLUTION STRUCTURES OF THE BRK DOMAINS OF THE HUMAN CHROMO HELICASE DOMAIN 7 AND 8, REVEALS STRUCTURAL SIMILARITY WITH GYF DOMAIN SUGGESTING A ROLE IN PROTEIN INTERACTION",\N
15099,"15099","2007-09-12",\N,"Solution structure of CM15 in DPC micelles",\N
15100,"15100","2007-02-23","2009-06-23","NMR structure of E.coli YfgJ protein modelled with two Zn+2 bound. Northeast Structural Genomics Consortium Target ER317.","/ftp/pub/bmrb/timedomain/bmr15100"
15101,"15101","2007-05-21",\N,"Backbone 1H, 15N, and 13C Resonance Assignment and Secondary Structure Prediction of HP0495 from Helicobacter pylori",\N
15102,"15102","2007-10-17",\N,"IKs producing slow voltage-gated potassium channel subunit beta, KCNE1",\N
15103,"15103","2007-10-17",\N,"Structure of NOWA cysteine rich domain 6",\N
15104,"15104","2007-10-17",\N,"Structure of NOWA cysteine rich domain 8",\N
15105,"15105","2008-06-25",\N,"Solution Structure of the first Clip domain in PAP2 (CASP Target)",\N
15106,"15106","2008-06-25",\N,"Solution Structure of the second Clip domain in PAP2 (CASP Target)",\N
15107,"15107","2008-06-25","2008-10-09","NMR structure of D4P/K7G mutant of GPM12",\N
15108,"15108","2007-10-17",\N,"NMR structure of p1 from the infectious bursal disease virus (IBDV) in dodecylphosphocholin (DPC).",\N
15109,"15109","2007-05-21",\N,"Solution structure of the CUL7-CPH domain from Homo Sapiens; Northeast Structural Genomics Consortium target HT1.",\N
15110,"15110","2007-05-04",\N,"Solution structure of V21C/V59C Lymphotactin/XCL1",\N
15111,"15111","2008-07-08","2008-10-09","Solution Structure of the UBA Domain from Cbl-b",\N
15112,"15112","2007-06-26","2010-04-15","Assignment of the reduced Cu,Zn Superoxide Dismutase from Salmonella choleraesuis",\N
15113,"15113","2007-03-06",\N,"Solution Structure of the Rous Sarcoma Virus Nucleocapsid Protein:muPsi RNA Packaging Signal Complex",\N
15114,"15114","2007-03-06",\N,"Solution structure of L8A mutant of HIV-1 myristoylated matrix protein",\N
15115,"15115","2007-10-17",\N,"Solution structure of antimicrobial peptide Arenicin-2 in water",\N
15116,"15116","2007-03-06",\N,"Solution structure of V7R mutant of HIV-1 myristoylated matrix protein",\N
15117,"15117","2008-02-11",\N,"Backbone H, C, N Chemical Shifts for Influenza A NS1 (1-73) Protein Bound to dsRNA",\N
15118,"15118","2007-03-06","2008-07-02","LPS-bound structure of a designed peptide",\N
15120,"15120","2007-10-17","2008-07-02","SOLUTION STRUCTURE OF MATRIX METALLOPROTEINASE 3 (MMP-3) IN THE PRESENCE OF N-ISOBUTYL-N-[4-METHOXYPHENYLSULFONYL]GLYCYL HYDROXAMIC ACID (NNGH)",\N
15121,"15121","2007-06-27","2009-09-03","Backbone 1H, 13C and 15N resonance assignments for the 26kD human deubiquitinating enzyme UCH-L3",\N
15122,"15122","2007-03-06",\N,"Structure and dynamics of surfactin studied by NMR in micellar media",\N
15123,"15123","2007-05-14","2008-07-02","SeV Ntail(443-501)",\N
15124,"15124","2007-05-21",\N,"Discovery and optimization of a natural HIV-1 entry inhibitor targeting the gp41 fusion peptide",\N
15125,"15125","2008-10-27","2008-11-25","N.N.",\N
15126,"15126","2007-10-17",\N,"NMR assignments of the mannitol- specific cryptic phosphotransferase enzyme IIA CmtB from Escherichia coli",\N
15127,"15127","2007-07-16","2008-07-17","Chemical shift and constraint files for the RegB ribonuclease",\N
15128,"15128","2007-08-23","2009-04-29","Solution structure of the RGS domain of human RGS14",\N
15129,"15129","2007-05-21",\N,"Solution structure of the first SH3 domain of human Vinexin and its interaction with the peptides from Vinculin",\N
15130,"15130","2007-03-06","2008-07-02","CA Chemical Shift Assignments for alpha-bungarotoxin (pH6.0)",\N
15131,"15131","2007-06-26","2009-09-03","NMR assignment of an intrinsically disordered protein under physiological conditions: the 18.5 kDa isoform of murine myelin basic protein",\N
15132,"15132","2007-03-29",\N,"The highly cooperative folding of small, naturally occurring proteins is likely the result of natural selection.",\N
15133,"15133","2007-03-27",\N,"Solution NMR structure of protein Uncharacterized BCR, Northeast Structural Genomics Consortium target CgR1",\N
15134,"15134","2008-07-28","2008-09-02","Solution structure of phl p 3, a major allergen from timothy grass pollen",\N
15135,"15135","2008-01-09","2009-09-03","Backbone 1H, 13C, and 15N Chemical Shift Assignments for Endosulfine alpha in the presence of SDS micelles",\N
15136,"15136","2008-01-09","2009-09-03","Backbone 1H, 13C, and 15N Chemical Shift Assignments for Endosulfine alpha",\N
15137,"15137","2007-10-24","2009-02-02","The solution structure of the monomeric species of the C terminal domain of the CA protein of HIV-1",\N
15138,"15138","2007-03-06",\N,"13C and 15N resonance assignments for the major coat protein in Pf1 filamentous bacteriophage",\N
15139,"15139","2007-03-29","2009-06-23","NMR structure of the E.coli protein NirD, Northeast Structural Genomics target ET100","/ftp/pub/bmrb/timedomain/bmr15139"
15140,"15140","2007-10-24","2008-07-02","Proton chemical shifts of mytilin",\N
15141,"15141","2008-06-27",\N,"Chemical shift assignment of TC-1",\N
15142,"15142","2009-10-15",\N,"Solution structure of dynein light chain 2A",\N
15143,"15143","2007-10-30",\N,"1H (NH, HA, HB) Chemical Shift Assignments of the Non-Specific Lipid Transfer Protein (nsLTP1) with post translational modification, isolated from Barley Seeds",\N
15144,"15144","2007-05-10","2011-03-28","Side-chain relaxation in SH3 domain from alpha-spectrin measured at multiple temperatures",\N
15145,"15145","2007-06-05",\N,"1H, Chemical Shift Assignments for neurotensin in HFIP:H20 (80:20), TFE:D20(80:20), and DPC micelles",\N
15148,"15148","2007-06-05",\N,"HMGB1 AB boxes + basic tail backbone assignment",\N
15149,"15149","2007-06-05",\N,"HMGB1 Full Length backbone assignment",\N
15150,"15150","2007-10-24","2008-07-02","Solution Structure and Binding Property of the Domain-swapped Dimer of ZO2PDZ2",\N
15152,"15152","2007-10-24",\N,"Hydrogenase isoenzymes formation protein HypC",\N
15153,"15153","2007-10-24",\N,"Mouse Itch 3rd WW domain complex with the Epstein-Barr virus latent membrane protein 2A derived peptide EEPPPPYED",\N
15154,"15154","2008-02-11",\N,"HtrA1 bound to an optimized peptide: NMR assignment of PDZ domain and ligand resonances",\N
15156,"15156","2007-03-29","2007-09-12","Solid-State Protein Structure Determination with Proton-Detected Triple Resonance 3D Magic-Angle Spinning NMR Spectroscopy: Beta-1 Immunoglobulin Binding Domain of Protein G (GB1)",\N
15157,"15157","2007-06-06",\N,"NMR structure of the UGUU tetraloop of Duck Epsilon apical stem loop of the Hepatitis B virus",\N
15158,"15158","2008-05-06",\N,"Solution structure of the adhesion protein Bd37 from Babesia divergens",\N
15159,"15159","2007-10-24","2010-04-26","Mouse Itch 3rd domain phosphorilated in T30",\N
15160,"15160","2007-03-29","2010-12-13","Solution Structure of the Ubiquitin-Binding Zinc Finger (UBZ) Domain of the Human DNA Y-Polymerase Eta",\N
15161,"15161","2007-10-24",\N,"The MYND domain from human AML1-ETO",\N
15162,"15162","2007-06-20","2008-07-02","Backbone Chemical Shift Assignments of Cholera Toxin Enzymatic Domain (1-167)",\N
15163,"15163","2008-06-27",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for LARG PDZ domain in complex with C-terminal octa-peptide of Plexin B1",\N
15164,"15164","2007-10-24",\N,"Backbone chemical shifts assignment of the soluble N-terminal region of the ATP7A",\N
15166,"15166","2008-02-07",\N,"Pac1-Rshort N-terminal EC domain Pacap(6-38) complex",\N
15167,"15167","2007-04-11","2009-06-23","NMR Structure of E. Coli YehR Protein. Northeast Structural Genomics Target ER538.","/ftp/pub/bmrb/timedomain/bmr15167"
15168,"15168","2008-06-27",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for LARG PDZ domain",\N
15169,"15169","2008-02-11","2008-07-02","The Trp-cage: Optimizing the Stability of a Globular Miniprotein",\N
15170,"15170","2007-06-06","2008-07-02","Backbone assignments of DNA methyltransferase M.HhaI",\N
15171,"15171","2007-06-06",\N,"H1 chemical shift assignment of putative membrane-anchoring domain of alMGS (S65-L87)",\N
15172,"15172","2007-09-27",\N,"1H, 13C and 15N chemical shift assignments for hypothetical protein TA0095 from Thermoplasma acidophilum",\N
15173,"15173","2007-10-24",\N,"The MYND domain from human AML1-ETO fused to a SMRT peptide through a TEV cleavable linker",\N
15174,"15174","2007-10-24","2010-04-21","1H, alpha-13C Chemical Shift Assignments for [L-Phe44]iota-RXIA",\N
15175,"15175","2007-10-24","2010-04-21","proton and alpha-carbon chemical shift of [D-Phe44]iota-RXIA",\N
15176,"15176","2007-10-26","2008-07-30","Intrinsically unstructured proteins provide the specificity for protein phosphatase 1 regulation.",\N
15177,"15177","2007-08-22","2009-09-03","Resonance assignments of the metal sensor CzrA in the apo-, Zn2- and DNA-bound (42 kDa) states",\N
15178,"15178","2007-03-30","2009-04-29","Backbone, C' and CB 13C, 15N and 1H chemical shift assignments for the RGS domain of the human Regulator of G-protein Signalling 3(RGS3)protein",\N
15179,"15179","2007-10-26",\N,"Intrinsically unstructured proteins provide the specificity for protein phosphatase 1 regulation.",\N
15180,"15180","2007-10-26",\N,"Intrinsically unstructured proteins provide the specificity for protein phosphatase 1 regulation.",\N
15183,"15183","2007-10-05","2011-03-29","Backbone and side-chain methyl order parameters and effective correlation times for calmodulin in complex with CaMKKalpha peptide",\N
15184,"15184","2007-10-05","2011-03-29","backbone and side chain methly order parameters and correlation times for calmodulin in complex with the eNOS peptide",\N
15185,"15185","2007-10-05","2011-03-29","backbone and side chain methly order parameters and correlation times for calmodulin in complex with the eNOS peptide",\N
15186,"15186","2007-10-05","2011-03-29","backbone and side chain methly order parameters and correlation times for calmodulin in complex with the smMLCK peptide",\N
15187,"15187","2007-10-05","2011-03-29","Backbone and side-chain methyl order parameters and effective correlation times for calmodulin in complex with Phosphodiesterase1A peptide",\N
15188,"15188","2007-10-05","2011-03-29","backbone and side chain methly order parameters and correlation times for calcium-saturated calmodulin",\N
15189,"15189","2008-06-27",\N,"Solution structure of the N-terminal extracellular domain of the lymphocyte receptor CD5 (CD5 domain 1)",\N
15190,"15190","2009-06-15",\N,"Solution Structure of Protein HP0495 from H. pylori; Northeast structural genomics consortium target PT2; Ontario Centre for Structural Proteomics target HP0488",\N
15191,"15191","2007-10-05","2009-02-03","backbone and sidechain order parameters for CaM-nNOSp",\N
15192,"15192","2007-09-12","2008-07-17","NMR Solution Structure, Stability, and Interaction of the Recombinant Bovine Fibrinogen alphaC-Domain Fragment",\N
15193,"15193","2007-08-22","2010-04-16","1H, 13C, and 15N NMR resonance assignments of Sec95Cys MsrB1 protein",\N
15194,"15194","2007-08-23","2009-09-03","1H, 13C and 15N resonance assignment of truncated SUMO from Trypanosoma brucei",\N
15195,"15195","2007-06-06",\N,"Solution Structure of an M-1 Conotoxin with a novel disulfide linkage",\N
15196,"15196","2008-05-06",\N,"NMR structure of the HIV-2 nucleocapsid protein",\N
15197,"15197","2007-04-11","2010-04-15","1H, 15N, and 13C chemical shift assignments for CaBP1",\N
15198,"15198","2007-04-19",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for all-Ala-HEWL",\N
15199,"15199","2007-06-06","2009-09-03","Backbone 1H, 13C, and 15N Chemical Shift Assignments for the PDZ2 PDZ3 tandemdomain of PTP-BL",\N
15200,"15200","2007-08-23","2009-08-13","NMR assignment of the apo-form of a Desulfovibrio gigas protein containing a novel Mo-Cu cluster",\N
15201,"15201","2007-04-26",\N,"Sequence-specific resonance assignments for OmpX in 8 M urea aqueous solution",\N
15202,"15202","2007-08-23","2009-09-03","Rub184b",\N
15203,"15203","2007-05-04","2009-06-22","NMR Structure of Clostridium Perfringens Protein CPE0013. Northeast Structural Genomics Target CpR31.","/ftp/pub/bmrb/timedomain/bmr15203"
15204,"15204","2007-08-23","2009-09-03","Backbone assignment of human IgG1 CH3 domain",\N
15206,"15206","2007-10-24",\N,"Differences in the electrostatic surfaces of the type III secretion needle proteins",\N
15207,"15207","2007-08-23","2009-09-03","1H, 13C and 15N resonance assignments of YajG",\N
15208,"15208","2008-05-06","2009-02-04","Embryonic Neural Inducing Factor Churchill is not a DNA-Binding Zinc Finger Protein: Solution Structure Reveals a Solvent-Exposed Beta-Sheet and Zinc Binuclear Cluster",\N
15209,"15209","2007-10-24",\N,"Structure of the hDLG/SAP97 PDZ2 in complex with HPV-18 papillomavirus E6 peptide",\N
15210,"15210","2007-06-05",\N,"NMR Structure of 50S Ribosomal Protein L14e from Sulfolobus Solfataricus; Northeast Structural Genomics Consortium Target SSR105.",\N
15211,"15211","2007-06-05",\N,"Solution NMR structure of protein , Northeastprotein yxeF Structural Genomics Consortium target Sr500a",\N
15212,"15212","2008-01-28","2009-08-13","1H, 13C, and 15N Chemical Shift Assignments for the first Nterminal domain, RRM1, of hnRNP H",\N
15213,"15213","2008-02-11","2010-07-19","Assignments of {lambda}-IntCB bound to a DNA half-site",\N
15214,"15214","2007-09-12","2008-09-04","MxiHCdelta5 backbone assignment",\N
15215,"15215","2007-10-29",\N,"Solution structure of the alternative conformation of XCL1/Lymphotactin",\N
15216,"15216",\N,\N,"Solution structure and resonance assignment of the N-terminal EVH1 domain from the human Spred2 protein (Sprouty-related protein with EVH1 domain isoform 2)",\N
15217,"15217","2007-05-02","2009-06-22","NMR SOLUTION STRUCTURE OF YKVR PROTEIN FROM BACILLUS SUBTILIS: NORTHEAST STRUCTURAL GENOMICS CONSORTIUM TARGET SR358","/ftp/pub/bmrb/timedomain/bmr15217"
15218,"15218","2008-02-20",\N,"1H and 13C Chemical shifts for the ATWLPPR peptide.",\N
15219,"15219","2008-02-20",\N,"Backbone 1H, 15N and 13C chemical shift assingments for human retinoid X receptor ligand-binding domain in complex with 9-cis retinoic acid and a glucocorticoid receptor interacting protein-1 peptide",\N
15221,"15221","2012-08-03",\N,"Solution structure of Tc32 toxin from the scorpion Tityus cambridgei",\N
15222,"15222","2007-05-18","2008-07-02","PV-3C",\N
15223,"15223","2008-02-20","2010-07-16","Duplex DNA containing an abasic site with an opposite G (alpha anomer) in 5'-G_AC-3' (10 structure ensemble and averaged structure)",\N
15224,"15224","2008-02-20","2010-07-15","Duplex DNA containing an abasic site with an opposite G (beta anomer) in 5'-G_AC-3' (10 structure ensemble and averaged structure)",\N
15225,"15225","2007-10-29","2010-09-16","1H, 13C, and 15N resonance assignments of domain 2 of non-structural protein 5A (NS5A) of hepatitis C virus",\N
15226,"15226","2009-11-20",\N,"High resolution Solid state NMR structure of Kaliotoxin bound to Potassium channel",\N
15227,"15227","2008-02-20","2010-07-16","Duplex DNA containing an abasic site with an opposite T (alpha anomer) in 5'-G_AC-3' (10 structure ensemble and averaged structure)",\N
15228,"15228","2008-02-20","2010-07-16","Duplex DNA containing an abasic site with an opposite T (beta anomer) in 5'-G_AC-3' (10 structure ensemble and averaged structure)",\N
15229,"15229","2008-02-20",\N,"ATOMIC STRUCTURE OF TRANSLATION INITIATION FACTOR aIF2 beta-SUBUNIT FROM ARCHAEBACTERIA SULFOLOBUS SOLFATARICUS: HIGH RESOLUTION NMR IN SOLUTION",\N
15230,"15230","2007-08-22","2011-03-29","1H, 13C and 15N resonance assignments for the small GTPase RalB in its active conformation",\N
15231,"15231","2008-02-20","2009-02-04","ErbB2TM",\N
15232,"15232","2007-10-29",\N,"proline-free mutant of SNase V8",\N
15233,"15233","2007-05-18","2009-08-12","1H, 15N backbone chemical shift assignment of the G130V mutant of the C terminal domain of human frataxin",\N
15234,"15234","2007-05-18","2009-08-12","1H, 15N backbone chemical shift assignment of D122Y mutant of the C terminal domain of human frataxin",\N
15235,"15235","2007-05-18","2009-08-12","1H, 15N backbone chemical shift assignment of the W155R mutant of the C terminal domain of human frataxin",\N
15236,"15236","2007-05-18","2009-08-12","1H, 15N backbone chemical shift assignemnt of the G26K,D27S,D31A triple mutant of the protein CyaY",\N
15237,"15237","2007-05-18","2009-08-12","1H, 15N chemical shift backbone assignment of the D31K mutant of the protein CyaY",\N
15238,"15238","2008-02-20","2010-07-16","Duplex DNA containing an abasic site with an opposite dC (alpha anomer) in 5'-G_AC-3' (10 structure ensemble and averaged structure)",\N
15239,"15239","2008-02-20","2010-07-16","Duplex DNA containing an abasic site with an opposite dC (beta anomer) in 5'-G_AC-3' (10 structure ensemble and averaged structure)",\N
15240,"15240","2007-08-28","2008-07-02","Solution structure of the ERCC1 central domain",\N
15241,"15241","2007-10-29",\N,"1H Chemical shift assignments for [Nle15] gastrin-17 in the presence of DPC micelles.",\N
15242,"15242","2007-06-13","2008-07-02","FHA domain of NIPP1",\N
15243,"15243","2007-10-29","2008-07-02","1H, 15N, 13C chemical shifts of human translationally controlled tumor protein",\N
15244,"15244","2007-05-22","2009-08-12","1H, 15N chemical shift backbone assignment of the E19K,D22K mutant of the protein CyaY",\N
15245,"15245","2007-05-14","2008-07-02","NMR SOLUTION STRUCTURE OF THE VILLIN HEADPIECE MUTANT G34L",\N
15246,"15246","2009-10-09",\N,"chemical shift assignments of PA4090 from Pseudomonas aeruginosa",\N
15247,"15247","2007-08-22","2009-09-03","1H, 13C and 15N resonance assignments of the Escherichia coli YaeT POTRA domain",\N
15248,"15248","2008-01-28","2009-09-03","Main chain NMR assignments of SBT70 in its prodomain-bound state",\N
15249,"15249","2007-09-17","2009-12-11","Sequence-Specific 1H, 13C and 15N Resonance Assignments of the Cyclic Nucleotide Binding Domain from a Cyclic Nucleotide-Gated Potassium Channel in Complex with cAMP",\N
15250,"15250","2008-01-28","2009-09-03","Main chain NMR assignments of SBT70",\N
15252,"15252","2007-10-29","2008-07-02","Solution Structure of T4 Bacteriophage Helicase Uvsw.1",\N
15253,"15253","2008-08-25","2009-02-10","NMR assignments of the binary hvDHFR1:folate complex",\N
15254,"15254","2008-02-20",\N,"Backbone Dynamics of Intramolecular Complex",\N
15255,"15255","2008-02-20",\N,"DtxR SH3",\N
15256,"15256","2007-10-29","2007-11-02","Antheraea polyphemus pheromone-binding protein 1: structure and assignments at pH 4.5.",\N
15257,"15257","2007-09-12","2011-07-01","Structural basis of RsmA/CsrA RNA recognition: Structure of RsmE bound to the Shine-Dalgarno sequence of hcnA mRNA",\N
15258,"15258","2007-06-19","2009-06-22","NMR solution structure of Vibrio parahaemolyticus VP2129 homodimer. Northeast Structural Genomics target VpR61.","/ftp/pub/bmrb/timedomain/bmr15258"
15259,"15259","2008-02-21","2008-07-02","LactococcinGa in DPC and TFE",\N
15261,"15261","2008-02-21","2008-07-02","LactococcinGb in DPC and TFE",\N
15263,"15263","2008-02-21","2008-07-02","1H, 13C, and 15N Chemical Shift Assignments for NAB2 N-terminal domain",\N
15264,"15264","2007-10-29","2008-07-02","Complete backbone 15N, 13C, and 1H resonance assignments for the N-terminal domain of AhpF","/ftp/pub/bmrb/timedomain/bmr15264"
15265,"15265","2007-07-18",\N,"solution structure of NESG target SsR10, Orf c02003 protein","/ftp/pub/bmrb/timedomain/bmr15265"
15266,"15266","2007-09-17","2009-09-03","1H, 13C, and 15N Backbone Resonance Assignments of the Carboxyl Terminal Domain of Connexin40",\N
15267,"15267","2007-10-29","2008-07-02","NMR structure of the anticoccidial peptide PW2 in DPC micelles",\N
15268,"15268","2008-06-12","2008-07-02","Structure and Dynamics of Human Apolipoprotein C-III",\N
15269,"15269","2007-07-05",\N,"Complete resonance assignments and solution structure calcualtion of ATC2521 (NESG ID: AtT6) from Agrobacterium tumeraciens",\N
15270,"15270","2007-07-17",\N,"Solution structure of RPA3114, a SEC-C motif containing protein from Rhodopseudomonas palustris; Northeast Structural Genomics Consortium target RpT5 / Ontario Center for Structural Proteomics target RP3097",\N
15271,"15271","2007-12-19",\N,"Solution structure of the Somatomedin B domain from vitronectin produced in Pichia pastoris",\N
15272,"15272","2008-06-12",\N,"The NMR solution structure of a pH sensitive,D-amino acid containing conopeptide, mr12 .",\N
15273,"15273","2008-06-12",\N,"A L-amino acid mutant of a D-amino acid containing conopeptide",\N
15274,"15274","2008-10-28","2008-11-21","NMR chemical shift assignments for Arf-binding domain of Hdm2",\N
15275,"15275","2008-07-15","2008-09-12","Soution Structure of Af54 M-domain",\N
15276,"15276","2007-09-17","2009-08-13","1H, 13C and 15N resonance assignment of 6aJL2(R25G), a highly fibrillogenic lamdaVI light chain variable domain.",\N
15277,"15277","2007-07-05","2008-07-03","Full Length Leader Protease of Foot and Mouth Disease Virus C51A Mutant",\N
15278,"15278","2007-07-06","2008-07-03","Leader Protease",\N
15279,"15279","2007-10-16","2008-07-03","Structure of the EH-domain of EHD1",\N
15280,"15280","2007-07-18","2009-08-13","1H, 13C and 15N resonance assignment of the oxidized form (Cys67-Cys70) of the N-terminal domain of PilB from Neisseria meningitidis",\N
15281,"15281","2007-08-16","2010-09-28","Solution NMR structure of CC0527 from Caulobacter crescentus. Northeast Structural Genomics target CcR55.","/ftp/pub/bmrb/timedomain/bmr15281"
15282,"15282","2009-02-06","2009-04-17","Backbone 1H Chemical Shift Assignments for N-Me-Phe5",\N
15283,"15283","2007-08-22","2009-08-13","13C and 15N Chemical Shift Assignments and Secondary Structure of the B3 Immunoglobulin-Binding Domain of Streptococcal Protein G (GB3) by Magic-Angle Spinning Solid-State NMR Spectroscopy",\N
15284,"15284","2009-02-06","2009-04-17","Backbone 1H Chemical Shift Assignments for N-Me-Leu8",\N
15285,"15285","2009-02-06","2009-04-17","Backbone 1H Chemical Shift Assignments for N-Me-Lys11",\N
15286,"15286","2012-08-03",\N,"NMR structure of Bungatoxin from Bungarus Candidus (Malayan Krait venom)",\N
15287,"15287","2009-02-06","2009-04-17","Backbone 1H Chemical Shift Assignments for N-Me-Phe12",\N
15288,"15288","2008-02-20",\N,"NMR solution structure of Bacillus subtilis YobA 21-120: Northeast Structural Genomics Consortium target SR547",\N
15289,"15289","2008-02-21","2012-10-31","1H, 15N chemical shift assignment of the THAP domain 1-81 from human THAP1 protein",\N
15290,"15290","2007-07-02","2008-07-03","Solution structure of Saccharomyces cerevisiae conserved oligomeric Golgi subunit 2 protein (Cog2p)",\N
15291,"15291","2009-02-09","2009-04-17","Backbone 1H Chemical Shift Assignments for N-Me-Gly13",\N
15292,"15292","2009-02-09","2009-04-24","Backbone 1H Chemical Shift Assignments for N-Me-Ser14",\N
15293,"15293","2009-02-09","2009-04-24","Backbone 1H Chemical Shift Assignments for N-Me-Leu8/N-Me-Ser14",\N
15294,"15294","2009-02-09","2009-04-24","Backbone 1H Chemical Shift Assignments for N-Me-Val1/N-Me-Leu8/N-Me-Ser14",\N
15295,"15295","2007-08-15","2008-07-03","Solution structure At3g28950.1 from Arabidopsis thaliana",\N
15296,"15296","2008-06-25",\N,"Chemical assignments of Ca-S100A1 bound to RyRP12",\N
15298,"15298","2007-08-08","2008-07-03","Beta-synuclein",\N
15299,"15299","2008-07-28",\N,"AgTx2-MTX Toxin",\N
15300,"15300","2008-02-21",\N,"1H, 15N, 13C chemical shift assignment of the THAP domain 1-90 from human THAP1 protein",\N
15301,"15301","2008-06-12","2010-12-14","Solution model of crosslinked complex of cytochrome c and adrenodoxin",\N
15302,"15302","2008-08-15",\N,"a novel lectin-like peptide from Odorrana grahami",\N
15303,"15303","2007-08-08","2009-09-03","1H, 15N, 13C resonance assignments for bb' domains of human protein disulfide isomerase (PDI)",\N
15304,"15304","2008-02-28",\N,"NMR strcuture determination of the periplasmic domain of ExbD from E.coli",\N
15305,"15305","2008-02-28",\N,"1H Chemical Shift Assignments for Cardiotoxin A3 from Naja Atra at Neutral pH and temperature of 318K",\N
15306,"15306","2008-02-28",\N,"Solution Structure of the C2 domain of human Smurf2",\N
15309,"15309","2008-02-28",\N,"1H Chemical Shift Assignments for Cardiotoxin A5 from Naja Atra at Neutral pH and temperature of 318K",\N
15312,"15312","2008-02-28",\N,"Solution structure of NusB from Aquifex Aeolicus",\N
15313,"15313","2007-08-22","2010-04-15","1H, 15N and 13C backbone and side chain chemical shifts of human ASC (apoptosis-associated speck-like protein containing a CARD domain)",\N
15314,"15314","2009-10-14",\N,"Solution structure of the DNA binding domain of a nucleoid-associated protein, H-NS, from the phytopathogen Xylella fastidiosa.",\N
15315,"15315","2008-02-29",\N,"Resonance assignments for the discoidin domain of DDR2.",\N
15316,"15316","2009-08-12",\N,"Electrostatic contributions to the stability of the GCN4 leucine zipper structure.",\N
15317,"15317","2007-08-15","2009-06-22","NMR Solution Structure of Colwellia psychrerythraea protein CPS_2611. Northeast Structural Genomics target CsR4.","/ftp/pub/bmrb/timedomain/bmr15317"
15318,"15318","2008-06-12",\N,"Antibacterial Peptide from Eggshell Matrix: Structure and Self-assembly of a - defensin Like Peptide from the Chinese Soft-shelled Turtle Eggshell",\N
15319,"15319","2008-06-12",\N,"NMR SOLUTION STRUCTURE OF THE ANTICODON OF E.coli TRNA-VAL3 WITH NO MODIFICATIONS",\N
15320,"15320","2007-08-15",\N,"Solution structure of UPF0350 protein VC_2471: Northeast Structural Genomics Target VcR36",\N
15322,"15322","2008-02-29",\N,"1H, 13C, and 15N Chemical Shift Assignments for Chemotaxis Protein CheW",\N
15323,"15323","2008-02-29",\N,"Solution structure of Manduca sexta moricin",\N
15324,"15324","2009-10-09",\N,"A novel domain-swapped solution NMR structure of protein RPA2121 from Rhodopseudomonas palustris",\N
15325,"15325","2007-07-24","2014-01-28","C-terminal domain of ORF1p from mouse LINE-1",\N
15326,"15326","2007-09-17","2009-09-03","Backbone 13C, HN and 15N assignments for human chemerin",\N
15327,"15327","2007-07-26",\N,"Chemical Shift Assignments for E. coli protein YqcC: Northeast Structural Genomics Consortium target ER225",\N
15329,"15329","2007-07-19",\N,"Solution NMR structure of Tubulin polymerization-promoting protein family member 3 from Homo sapiens. Northeast Structural Genomics target HR387.",\N
15330,"15330","2009-10-12","2010-02-16","Caenopore-5 -Pro cis conformer",\N
15331,"15331","2007-07-26","2008-07-03","NMR SOLUTION STRUCTURE OF THE ANTICODON OF E.coli TRNA-VAL3 WITH 2 MODIFICATIONS (cmo5U34 M6A37)",\N
15332,"15332","2007-10-29","2008-09-12","Solution sturcture of human MEKK3 PB1 domain cis isomer",\N
15333,"15333","2007-07-30","2008-12-12","Resonance Assignment of the human Pirh2 RING domain; Northeast Structural Genomics Consortium Target HT2B",\N
15334,"15334","2012-08-03","2013-08-12","Solution Structure of the Beryllofluoride-Activated NtrC4 Receiver Domain Dimer",\N
15335,"15335","2007-07-20","2009-06-22","Structure of Staphylococcus saprophyticus CHAP domain protein. Northeast Structural Genomics Target SyR11.","/ftp/pub/bmrb/timedomain/bmr15335"
15336,"15336","2007-11-21",\N,"1H, 13C and 15N Backbone Resonance Assignments of the Nonphosphorylated CFTR Regulatory Region",\N
15338,"15338","2007-08-02","2009-06-22","NMR Structure of Protein YfgJ from Salmonella Typhimurium. Northeast Structural Genomics Target StR86.","/ftp/pub/bmrb/timedomain/bmr15338"
15339,"15339","2007-07-27","2009-06-22","Solution NMR Structure of Ribosome Modulation Factor VP1593 from Vibrio parahaemolyticus. Northeast Structural Genomics Target VpR55","/ftp/pub/bmrb/timedomain/bmr15339"
15340,"15340","2007-11-21",\N,"1H, 13C, and 15N Backbone Assignments and 13C Aliphatic Sidechain Assignments for PKA Phosphorylated CFTR Regulatory Region",\N
15341,"15341","2007-07-23","2009-06-22","Solution Structure of Q5LLS5 from Silicibacter pomeroyi. Northeast Structural Genomics Consortium target SiR90.","/ftp/pub/bmrb/timedomain/bmr15341"
15342,"15342","2007-07-30","2008-07-03","NMR SOLUTION STRUCTURE OF THE ANTICODON OF E.coli TRNA-VAL3 WITH 1 MODIFICATION (cmo5U34)",\N
15343,"15343","2007-07-23","2007-08-07","Solution NMR Structure of CAPER RRM2 Domain. Northeast Structural Genomics Target HR4730A.",\N
15344,"15344","2008-02-21",\N,"The solution structure of the protein coded by gene RHOS4_12090 of R. sphaeroides. Northeast structural genomics target RhR5",\N
15345,"15345","2008-08-06","2008-10-20","Solution structure of Blo t 5",\N
15346,"15346","2007-07-25",\N,"NMR chemical shift assignments for E. coli YejL protein: target ER309 of the Northeast Structural Genomics Consortium",\N
15347,"15347","2007-07-25","2008-09-25","Chemical Shift Assignments for protein NE0084 from Nitrosomonas europea: Northeast Structural Genomics Target NeT6",\N
15348,"15348","2007-12-10","2009-08-13","Solution structure of the Bright/ARID domain from the human JARID1C protein.",\N
15349,"15349","2008-02-29","2008-07-03","Solution structure of second SH3 domain of adaptor Nck",\N
15350,"15350","2007-07-31","2010-08-25","Northeast Structural Genomics Target SR478","/ftp/pub/bmrb/timedomain/bmr15350"
15351,"15351","2008-02-29","2008-07-03","Solution structure of first SH3 domain of adaptor Nck",\N
15352,"15352","2007-08-29",\N,"NMR Structure of protein Q6N9A4_RHOPA:Northeast Structural Genomics Consortium Target RpT8",\N
15353,"15353","2007-08-10",\N,"Solution NMR Structure of Bordetella bronchiseptica protein BB2007: Northeast Structural Genomics Consortium Target BoR54",\N
15354,"15354","2007-08-29",\N,"NMR Structure of protein Q60C73_METCA:Northeast Structural Genomics Consortium target McR1",\N
15355,"15355","2008-02-29",\N,"solution structure of human MEKK3 PB1 domain",\N
15356,"15356","2007-07-24",\N,"Solution NMR Structure of Human Myeloid Differentiation Primary Response (MyD88). Northeast Structural Genomics target HR2869A.",\N
15357,"15357","2009-11-20","2010-04-15","the solution structure of SNase complex",\N
15358,"15358","2009-10-12","2010-02-16","structure of caenopore-5 (99 Pro trans)",\N
15359,"15359","2008-06-25",\N,"Solution structure of arenicin-1",\N
15360,"15360","2008-02-29","2010-07-15","Solution Structures of a DNA Dodecamer Duplex",\N
15361,"15361","2008-03-13","2010-04-26","Solution Structure of MMP20 complexed with NNGH",\N
15362,"15362","2007-07-27","2008-07-03","NMR SOLUTION STRUCTURE OF THE ANTICODON OF E.coli TRNA-VAL3 WITH 1 MODIFICATION (M6A37)",\N
15363,"15363","2008-06-25",\N,"A D-amino acid containing conopeptide, marmophine, from Conus marmoreus",\N
15364,"15364","2008-06-18",\N,"Solution Structure of Human Immunodificiency Virus Type-2 Nucleocapsid Protein",\N
15366,"15366","2008-01-28","2009-09-03","Human eRF1 C-domain",\N
15367,"15367","2008-03-13","2008-07-03","RgIA, a Novel Conotoxin that Blocks the nAChR",\N
15368,"15368","2008-03-13","2008-07-03","RgIA, a Novel Conotoxin that Blocks the nAChR",\N
15369,"15369","2007-10-16","2009-09-03","Maize Ribosome-Inactivating protein (MOD)",\N
15370,"15370","2009-04-24","2010-11-17","solution structure of the atypical PDZ-like domain of synbindin",\N
15371,"15371","2008-08-18",\N,"antimicrobial resistance protein",\N
15372,"15372","2008-06-25","2008-07-03","Solution Structure of the Tick Carboxypeptidase Inhibitor",\N
15373,"15373","2008-03-13",\N,"The prokaryotic Cys2His2 zinc finger adopts a novel fold as revealed by the NMR structure of A. tumefaciens Ros DNA binding domain",\N
15374,"15374","2009-06-29","2010-03-24","Zinc substitued Rubredoxin from Desulfovibrio Vulgaris",\N
15375,"15375","2009-06-29","2010-02-03","Nickel substitued Rubredoxin from Desulfovibrio Vulgaris",\N
15376,"15376","2007-09-04","2010-07-16","SOLUTION STRUCTURE OF A DNA DUPLEX CONTAINING THE UNIVERSAL BASE 5-NITROINDOLE-3-CARBOXAMIDE",\N
15377,"15377","2008-03-13",\N,"Solution structure of human DESR1",\N
15378,"15378","2008-03-13","2008-07-03","NMR structure of the S. aureus VraR DNA binding domain",\N
15379,"15379","2007-09-12","2008-07-03","Sup35 NM",\N
15380,"15380","2007-12-21",\N,"Crystal Polymorphism of GB1 Examined by Solid-State NMR Spectroscopy and X-ray Diffraction",\N
15381,"15381","2007-08-16",\N,"Solution structure of the E. coli Tat proofreading chaperone protein NapD",\N
15382,"15382","2008-03-13",\N,"Nuclear Magnetic Resonance Studies on Huwentoxin-XI from the Chinese Bird Spider Ornithoctonus huwena",\N
15383,"15383","2007-09-17","2009-08-13","1H, 13C, and 15N Chemical Shift Assignments for the N-domain of Bacillus subtilis ClpC",\N
15384,"15384","2008-03-13","2008-07-03","Four-Alpha-Helix Bundle with Designed Anesthetic Binding Pockets II: Halothane Effects on Structure and Dynamics",\N
15385,"15385","2007-08-15",\N,"Solution structure of F104W cardiac troponin C",\N
15386,"15386","2007-08-13","2011-05-19","Solution NMR structure of PefI protein from Salmonella typhimurium. Northeast Structural Genomics target StR82.","/ftp/pub/bmrb/timedomain/bmr15386"
15388,"15388","2008-03-13",\N,"Solution Structure of F153W cardiac troponin C",\N
15389,"15389","2008-06-18",\N,"solution structure of hiv-1 gp41 fusion domain bound to DPC micelle",\N
15390,"15390","2008-06-18",\N,"Influenza Hemagglutinin Fusion Domain Mutant F9A",\N
15391,"15391","2008-03-13",\N,"Tetrameric structure of KIA7 peptide",\N
15392,"15392","2008-03-13",\N,"Tetrameric structure of KIA7F peptide",\N
15393,"15393","2008-07-29","2012-10-31","Structure of Chz1 Complexed with H2A.Z-H2B and Eviction of Nucleosomal H2A-H2B",\N
15394,"15394","2010-11-15",\N,"NMR structure of rabbit prion protein mutation S173N",\N
15395,"15395","2008-03-13","2009-02-05","SOLUTION STRUCTURE OF MATRIX METALLOPROTEINASE 3 (MMP-3) IN THE PRESENCE OF N-hydroxy-2-[N-(2-hydroxyethyl)biphenyl-4-sulfonamide] hydroxamic acid (MLC88)",\N
15396,"15396","2008-03-13","2009-02-05","SOLUTION STRUCTURE OF MATRIX METALLOPROTEINASE 3 (MMP-3) IN THE PRESENCE OF 3-4'-CYANOBYPHENYL-4-YLOXY)-N-HDYDROXYPROPIONAMIDE (MMP-3 INHIBITOR VII)",\N
15397,"15397","2008-04-04",\N,"NH, NN, C, CA and CB chemical shift assignment of the transcriptional activation domain 1 of the nuclear hormone receptor coactivator ACTR in the free state",\N
15398,"15398","2008-04-04",\N,"NH, NN, C and CA chemical shift assignment of the nuclear coactivator binding domain of CBP in the free state",\N
15399,"15399","2010-10-19",\N,"NMR structure of rabbit prion protein mutation I214V",\N
15400,"15400","2007-08-13","2010-04-21","Backbone and side chain chemical shift assignments of the F153-to-5-flurotryptophan mutant of human cardiac troponin C",\N
15401,"15401","2011-05-03",\N,"Calcium binding protein in the free form",\N
15402,"15402","2011-05-03",\N,"Calcium binding protein in the calcium-binding form",\N
15403,"15403","2007-09-24","2009-08-13","Simian Foamy Virus (mac) protease structure",\N
15404,"15404","2007-08-13","2008-07-03","Backbone and sidechain 1H, 13C, and 15N Chemical Shift Assignments for H. capsulatum CBP",\N
15405,"15405","2008-03-13",\N,"The NMR Solution Structure of Recombinant RGD-hirudin",\N
15406,"15406","2008-06-26",\N,"Solution structure of E.coli PapI",\N
15407,"15407","2007-10-16","2008-07-03","Third SH3 domain of CD2AP",\N
15408,"15408","2008-08-18","2009-02-05","NMR-detected conformational exchange observed in a computationally designed variant of protein Gb1",\N
15409,"15409","2008-03-14","2008-04-08","Backbone 1H, 13C, and 15N Chemical Shift Assignments for the cytoplasmic domain of the T cell receptor zeta chain",\N
15410,"15410","2008-03-14","2008-04-08","Backbone 1H, 13C, and 15N Chemical Shift Assignments for human ubiquitin",\N
15411,"15411","2008-01-17","2009-09-02","NMR structure of the talin C-terminal actin binding site",\N
15412,"15412","2007-12-10","2009-09-02","Backbone 1H, 13C, and 15N Chemical Shift Assignments for Snu13p",\N
15413,"15413","2008-08-18",\N,"High resolution NMR structure of YW12D in the presence of Lipopolysaccharide (LPS)",\N
15415,"15415","2008-10-29",\N,"Solution structure of Sso6901 from Sulfolobus solfataricus P2",\N
15417,"15417","2007-09-18","2009-07-23","Solution Structure of the Frameshift-Inducing RNA Stem-Loop in SIV","/ftp/pub/bmrb/timedomain/bmr15417"
15418,"15418","2008-10-29",\N,"NMR structure of the S100A6 dimer in complex with a binding fragment of the Siah-1 interacting protein",\N
15419,"15419","2007-08-13",\N,"Solution Structure of protein RPA3401, Northeast Structural Genomics Consortium Target RpT7, Ontario Center for Structural Proteomics Target RP3384",\N
15420,"15420","2009-10-12","2014-05-20","1H and 15N Chemical Shift Assignments of Recombinant Margatoxin",\N
15421,"15421","2009-10-12","2014-05-20","1H and 15N Chemical Shift Assignments of Recombinant Agitoxin2",\N
15422,"15422","2007-10-03","2008-07-03","Partial chemical shift assignments of KChIP4a in its Ca2+- and Mg2+-loaded form",\N
15423,"15423","2009-10-20",\N,"Backbone and sidechain 1H, 13C, and 15N Chemical Shift Assignments for FimA",\N
15424,"15424","2007-08-16","2009-08-13","NMR Assignment of Cdc42(T35A), and Active Switch I mutant of Cdc42",\N
15425,"15425","2007-10-03","2008-07-03","Partial chemical shift assignments of the N-terminal deletion mutant KChIP4a(Delta1-42) in its Ca2+- and Mg2+-loaded form",\N
15426,"15426","2008-03-14",\N,"Solution NMR structure of OmpG",\N
15427,"15427","2008-03-14",\N,"Chemical shift assignments of the F104-to-5-flurotryptophan mutant of cardiac troponin C",\N
15429,"15429","2008-03-14",\N,"Solution-state NMR structures of apo-LFABP (Liver Fatty Acid-Binding Protein)",\N
15430,"15430","2007-08-20","2009-06-18","The chemical shift assignment of gamma subunit of phosphodiesterase","/ftp/pub/bmrb/timedomain/bmr15430"
15431,"15431","2007-11-16","2009-09-03","NMR assignment of the periplasmic oxidoreductase DsbH from Chlamydia",\N
15433,"15433","2008-06-18",\N,"Solution-State Structures of Oleate-Liganded LFABP, Protein Only",\N
15434,"15434","2008-06-18",\N,"Solution-State Structures of Oleate-Liganded LFABP, Major Form of 1:2 Protein-Ligand Complex",\N
15435,"15435","2008-03-13","2008-07-03","alpha-RgIA, a Novel Conotoxin That Blocks the alpha9alpha10 nAChR",\N
15436,"15436","2008-03-13","2008-07-03","alpha-RgIA, a Novel Conotoxin That Blocks the alpha9alpha10 nAChR",\N
15437,"15437","2008-01-28","2009-08-13","Assignment, structure, and dynamics of de novo designed protein S836",\N
15438,"15438","2008-06-26",\N,"Solution structure of IPI*",\N
15439,"15439","2008-06-26","2009-02-05","URN1 FF domain yeast",\N
15440,"15440","2007-08-27","2009-08-13","1H, 13C and 15N resonance assignments of the C-terminal domain of HasB from Serratia marcescens",\N
15441,"15441","2008-05-02",\N,"Backbone chemical shift assignments of dynein intermediate chain IC74 residues 84-143",\N
15442,"15442","2008-06-26",\N,"Multienzyme Docking in Hybrid Megasynthetases",\N
15443,"15443","2007-11-07","2009-02-11","Structural Study of Ac-Phe-[Orn-Pro-dCha-Trp-Arg], a Potent C5a Receptor Antagonist, by NMR",\N
15444,"15444","2008-08-27","2008-10-21","solution structure of DNA binding domain of ngTRF1",\N
15445,"15445","2008-06-26","2008-09-29","15N relaxation and H/D exchange analysis of 15.5K free in solution",\N
15446,"15446","2008-01-30","2009-09-03","2cxxc, YgiT",\N
15447,"15447","2007-10-08","2008-10-17","8F19F1 module pair from Fibronectin",\N
15448,"15448","2007-10-01",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for ClpS from Xanthomonas axonopodis pv citri",\N
15449,"15449","2008-01-28",\N,"Type I rat fatty acid synthase acyl carrier protein (ACP) domain",\N
15450,"15450","2008-06-26",\N,"ThrA3-DKP-insulin",\N
15451,"15451","2008-07-28","2011-03-29","GABPa OST domain",\N
15452,"15452","2008-01-28","2009-08-13","Backbone and sidechain 1H, 15N and 13C assignments of the human G-actin binding protein profilin II",\N
15453,"15453","2008-06-25",\N,"FBP28WW2 domain in complex with the PPLIPPPP peptide",\N
15454,"15454","2008-06-25",\N,"allo-ThrA3 DKP-insulin",\N
15455,"15455","2008-06-25","2010-04-21","AbaA3-DKP-insulin",\N
15456,"15456","2007-09-17","2009-06-18","NMR Solution Structure of homodimer protein SO_2176 from Shewanella oneidensis. Northeast Structural Genomics Consortium Target SoR77.","/ftp/pub/bmrb/timedomain/bmr15456"
15457,"15457","2009-03-09","2010-07-26","NMR Structure of the Talin Rod domain, 1655-1822",\N
15458,"15458","2010-02-18",\N,"NMR Structure of the F0 domain (residues 1-85) of the Talin FERM domain",\N
15459,"15459","2008-06-25",\N,"TolR",\N
15460,"15460","2008-10-31","2009-02-11","High resolution structure of AK12 in the presence of Lipopolysaccharide (LPS)",\N
15461,"15461","2008-06-25","2012-11-08","NMR resonance assignment of the Ccc2ab protein",\N
15462,"15462","2007-10-16","2009-06-18","Solution NMR Structure of HI0947 from Haemophilus influenzae, Northeast Structural Genomics Consortium Target IR123","/ftp/pub/bmrb/timedomain/bmr15462"
15463,"15463","2008-07-08",\N,"Spatial Structure and Hydrophobic Organization Determine Membrane Activity of Latarcins, Spider Antimicrobial Peptides",\N
15464,"15464","2008-06-25",\N,"NMR STRUCTURE OF HUMAN INSULIN MONOMER IN 35% CD3CN ZINC FREE, 50 STRUCTURES",\N
15465,"15465","2009-10-12",\N,"SOLUTION STRUCTURE OF THE N-TERMINAL DOMAIN OF PH1500",\N
15466,"15466","2008-06-25","2008-10-22","STRUCTURE CHARACTERISATION OF PINA WW DOMAIN AND COMPARISON WITH OTHER GROUP IV WW DOMAINS, PIN1 AND ESS1",\N
15467,"15467","2008-06-25",\N,"Backbone 1H, 15N, and 13C assignments for beta phosphoglucomutase in a complex with glucose-6-phosphate and AlF4-",\N
15468,"15468","2007-10-19","2010-01-06","Solution NMR structure of protein NE1242 from N. europaea. Northeast Structural Genomics Target NeT4",\N
15469,"15469","2008-02-05","2009-08-13","NMR assignment of the domain 513-651 from the SARS-CoV nonstructural protein nsp3",\N
15470,"15470","2009-12-21","2010-05-18","Resonance assignment of the Calmodulin-Munc13-1 peptide complex",\N
15471,"15471","2007-10-12","2008-07-03","NMR Structure of Peptidyl-tRNA hydrolase domain protein from Pseudomonas syringae pv. tomato:Northeast Structural Genomics Consortium Target PsR211",\N
15473,"15473","2007-09-19","2009-08-13","Backbone 1H, 13C, and 15N Chemical Shift Assignments for 8M Urea Denatured State of dSUMO-3(dSMT3)",\N
15474,"15474","2008-11-20",\N,"1H, 15N and 13C assignment and relaxation parameters of the denatured state of Azotobacter vinelandii apoflavodoxin",\N
15475,"15475","2008-08-18","2008-09-19","1H, 13C, and 15N chemical shift assignments of the C-terminal domain of the protein YuaF from Bacillus subtilis",\N
15476,"15476","2007-09-21","2009-06-18","Solution NMR structure of the folded N-terminal fragment of UPF0291 protein ynzC from Bacillus subtilis. Northeast Structural Genomics target SR384-1-46.","/ftp/pub/bmrb/timedomain/bmr15476"
15477,"15477","2009-10-12","2009-10-14","Solution structure of the extracellular domain of Prod1, a protein implicated in proximodistal identity during amphibian limb regeneration",\N
15478,"15478","2008-06-25","2008-07-29","1H and 15N resonance assignment of M7, a computationally-designed artificial protein",\N
15479,"15479","2008-06-25",\N,"1H, 13C and 15N Resonance Assignment for the transmembrane and cytoplasmic domains of human CD4",\N
15480,"15480","2007-10-15","2008-07-03","1H assignments of W60G mutant of human beta2-microglobulin",\N
15481,"15481","2007-09-27",\N,"15N and 1HN assignments of the EVH1 domain of human HOMER3A",\N
15482,"15482","2007-10-02","2009-06-17","Solution NMR Structure of R. sphaeroides protein RSP_1027: Northeast Structural Genomics Consortium Target RhR95.","/ftp/pub/bmrb/timedomain/bmr15482"
15483,"15483","2010-08-16","2010-08-24","SQAPI",\N
15485,"15485","2008-06-26",\N,"Segmental isotope labeling of Npl3",\N
15486,"15486","2008-03-12",\N,"Complete Chemical Shift Assignments and XPLOR restraints for YmoA",\N
15487,"15487","2008-06-26",\N,"Segmental Isotope Labeling of Npl3p",\N
15488,"15488","2008-03-31","2009-08-13","Backbone 1H, 15N, 13CO and 13CA resonance assignment of ABL kinase domain in complex with imatinib",\N
15489,"15489","2008-07-29","2009-02-05","Chemical shift assignments of paenibacillin -- a novel lantibiotic with N-terminal acetylation",\N
15490,"15490","2009-06-10","2009-08-21","Solution Structure of E coli NusG carboxyterminal domain",\N
15491,"15491","2007-10-03","2009-06-17","Solution NMR structure of uncharacterized protein Q5E7H1 from Vibrio fischeri. Northeast Structural Genomics target VfR117.","/ftp/pub/bmrb/timedomain/bmr15491"
15492,"15492","2008-01-25","2009-08-13","Backbone chemical shift assignment of a glutamate receptor ligand binding domain in complexes with five partial agonists",\N
15493,"15493","2008-01-25","2009-08-13","Backbone chemical shift assignment of a glutamate receptor ligand binding domain in complexes with five partial agonists",\N
15494,"15494","2008-01-25","2009-08-13","Backbone chemical shift assignment of a glutamate receptor ligand binding domain in complexes with five partial agonists",\N
15495,"15495","2008-01-25","2009-08-13","Backbone chemical shift assignment of a glutamate receptor ligand binding domain in complexes with five partial agonists",\N
15496,"15496","2008-01-25","2009-08-13","Backbone chemical shift assignment of a glutamate receptor ligand binding domain in complexes with five partial agonists",\N
15497,"15497","2008-10-31",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for MxiD in complex with MxiM",\N
15498,"15498","2008-01-17","2009-08-13","Backbone and side-chain 1H, 13C and 15N resonance assignments for the E2 conjugating enzyme, UbcH7",\N
15499,"15499","2008-03-13","2008-07-03","Solution Structure of human NEMO zinc finger",\N
15500,"15500","2008-03-13","2008-07-03","Solution Structure of the EDA-ID-related C417F mutant of human NEMO zinc finger",\N
15501,"15501","2008-01-28",\N,"Backbone assignment of human Proliferating Cell Nuclear Antigen.",\N
15502,"15502","2008-02-11",\N,"Mapping intramolecular interactions between domains in HMGB1 using a tail-truncation approach",\N
15503,"15503","2008-10-31","2009-02-05","Backbone 1H, 13C, and 15N Chemical Shift Assignments for MxiM(28-142)",\N
15504,"15504","2008-10-31","2009-02-05","Structural characterization of the type III pilotin-secretin interaction in Shigella flexneri by NMR spectroscopy",\N
15505,"15505","2008-06-26",\N,"CypB",\N
15506,"15506","2008-06-26","2008-07-29","Backbone 1H, 13C, and 15N Chemical Shift Assignments for the intrinsically disordered translocation domain of colicin N",\N
15507,"15507","2008-06-26",\N,"Chemical Shift Assignments for Legionella pneumophila Mip bound to rapamycin",\N
15508,"15508","2007-10-12","2008-07-03","Chemical shift values for the innermost lipoyl domain of E. coli PDH complex",\N
15509,"15509","2007-11-19",\N,"NMR Solution Structure of PARC CPH Domain. NESG Target HR3443B/SGC-Toronto",\N
15510,"15510","2008-11-14","2009-02-11","N-terminal SH3 domain of human Nckalpha",\N
15511,"15511","2008-06-26","2008-07-03","1H,13C and 15N chemical shift assignments for stereo-array isotope labelled (SAIL) C-terminal dimerization domain of SARS coronavirus nucleocapsid protein",\N
15512,"15512","2008-03-31","2009-08-21","1H, 13C, and 15N NMR chemical shift assignments of the palladin Ig3 domain",\N
15513,"15513","2008-07-29",\N,"1H, 13C and 15N Resonance Assignemnt of HIV-1 VpU cytoplasmic domain",\N
15514,"15514","2008-01-28","2009-08-13","Assignment of backbone 1H, 13C and 15N resonances of human IgG1 Fc (51.4 kDa)",\N
15515,"15515","2008-06-26",\N,"NMR STRUCTURAL STUDIES OF THE ANTIBIOTIC LIPOPEPTIDE DAPTOMYCIN IN DHPC MICELLES",\N
15517,"15517","2008-06-26",\N,"1H, 13C, and 15N Chemical Shift Assignments for ca-free rat alpha-parvalbumin",\N
15518,"15518","2008-01-11",\N,"1H, 15N, 13CO, 13Calpha and 13Cbeta Chemical Shift Assignments of Human Peroxisome Proliferator-Activated Receptor Gamma Ligand-Binding Domain Bound to GW1929",\N
15519,"15519","2007-11-15","2009-08-21","Backbone chemical shift assigment of chicken osteopontin",\N
15520,"15520","2007-10-16",\N,"SOLUTION STRUCTURE OF ENGRAILED HOMEODOMAIN L16A MUTANT",\N
15521,"15521","2008-06-27",\N,"Backbone Dynamics from 15N NMR Relaxation Measurements of the Rat Thyroid Transcription Factor 1 Homeodomain",\N
15522,"15522","2007-10-17",\N,"Solution structure of pUL89(580-600) from Human Cytomegalovirus at pH 6.8.",\N
15524,"15524","2008-10-14","2009-08-13","1H and 15N Resonance assignments for the human RLIP76 Ral binding domain",\N
15525,"15525","2008-10-14","2009-08-13","1H, 13C and 15N Resonance assignments for the human RLIP76 Ral binding domain and RalB in complex",\N
15527,"15527","2009-06-10","2010-07-16","1H, 13C, and 31P Chemical Shift Assignments for 14-mer Base Pair Non-self Complementary DNA Duplex ( Mbp1_14) which Contains the Consensus Binding Site of the Yeast Transcription Factor Mbp-1",\N
15528,"15528","2007-10-19","2009-06-16","Solution structure of the protease-resistent domain of Xenopus ePABP2","/ftp/pub/bmrb/timedomain/bmr15528"
15529,"15529","2007-10-31","2008-07-03","Back bone chemical shifts of B. subtillis protein YkuJ, Northeast Structural Genomics Consortium Target SR360.",\N
15530,"15530","2008-06-27",\N,"Solution structure of Mj0056",\N
15531,"15531","2007-12-10","2009-08-13","1H 13C and 15N chemical shift for human Granulocyte Macrophage Colony-Stimulating Factor",\N
15532,"15532","2008-02-14",\N,"Structure of the Wilms Tumor Suppressor Protein Zinc Finger Domain Bound to DNA",\N
15533,"15533","2008-02-14","2010-07-19","Structure of the Wilms' Tumor Suppressor Protein Zinc Finger Domain Bound to DNA",\N
15534,"15534","2008-07-15","2008-10-24","Solution Structure of the UBA domain from c-Cbl",\N
15535,"15535","2008-11-03",\N,"Solution NMR structures of two designed proteins with 88% sequence identity but different fold and function",\N
15536,"15536","2008-02-22","2011-03-29","Solution structure of Engrailed homeodomain WT",\N
15537,"15537","2008-11-03",\N,"Solution NMR structures of two designed proteins with 88% sequence identity but different fold and function",\N
15538,"15538","2007-12-18","2009-05-27","Structure of a high affinity anti-NFkB RNA aptamer",\N
15539,"15539","2008-01-17","2009-08-21","Backbone 1H, 13C, and 15N NMR assignments for the Cyanothece 51142 protein A1KYE3 - a protein in the DUF683 family associated with nitrogen fixation.",\N
15540,"15540","2008-01-17","2009-08-13","1H, 15N, 13C Assignments of the C-terminal chromatin binding domain of the 43kDa subunit of chloroplast signal recognition particle",\N
15541,"15541","2008-08-18","2008-10-24","NMR study of the interaction of HscB with apo-IscU",\N
15542,"15542","2007-11-09","2009-06-16","SOLUTION NMR STRUCTURE OF UNCHARACTERIZED LIPOPROTEIN yajI FROM Escherichia coli: NORTHEAST STRUCTURAL GENOMICS TARGET ER540","/ftp/pub/bmrb/timedomain/bmr15542"
15543,"15543","2008-11-03",\N,"Solution conformation of RNA-bound NELF-E RRM",\N
15544,"15544","2008-08-19",\N,"Solution structure of designed peptide YW12D in the presence of SDS micelle",\N
15545,"15545","2008-01-17","2009-08-13","1H 13C and 15N chemical shift for the human FLN29",\N
15546,"15546","2008-06-27",\N,"Chemical Shift Assignment of the Transmembrane Helices of DsbB by 3D Magic Angle Spinning NMR",\N
15547,"15547","2008-11-03",\N,"Solution structure of ubiquitin domain N-terminal to S27a ribosome subunit from Giardia lamblia",\N
15548,"15548","2007-12-11","2008-07-07","Backbone assignment of stefin B monomer",\N
15549,"15549","2012-08-03",\N,"Solution Structure of Human C6orf115 Protein",\N
15550,"15550","2009-10-15",\N,"Solution structure of hPCIF1 WW domain",\N
15551,"15551","2008-01-09","2012-11-08","Backbone 1H and 15N Chemical Shift Assignments for Dok1 PTB domain",\N
15552,"15552","2008-01-09","2008-07-07","Beta3 Integrin Cytoplasmic Tail 1H and 15N Chemical Shift Assignments",\N
15553,"15553","2008-04-21","2008-07-07","1H, 13C and 15N resonance assignments from the Gal_lectin domain of mouse Latrophilin-1 GPCR",\N
15554,"15554","2008-01-10","2009-08-21","Structure and Chemical Shift Assignment for the Eps15EH2-Stonin2 complex",\N
15555,"15555","2009-05-18","2009-09-09","NMR structure of human Serine protease inhibitor Kazal type II (SPINK2)",\N
15557,"15557","2009-11-20",\N,"1H, 13C, and 15N Chemical Shift Assignment for actin depolymerizing and dynamics regulatory protein from Leishmania donovani",\N
15558,"15558","2014-03-04",\N,"1H, 13C and 15N resonance assignments of C2 domain of milk fat globule-EGF-factor 8-L",\N
15559,"15559","2009-05-14","2009-05-27","NS4A(40-69)",\N
15560,"15560","2008-06-05","2009-08-13","1H, 13C, and 15N NMR assignments of an engineered intein based on Mycobacterium tuberculosis RecA",\N
15561,"15561","2008-03-17",\N,"NMR resonance assignments for Ca2+-bound DREAM",\N
15562,"15562","2009-06-17","2011-03-29","Solution Structure of S. cerevisiae PDCD5-like Protein Ymr074cp",\N
15563,"15563","2009-06-29","2009-07-20","Backbone 1H, 13C and 15N chemical shift assignment of N-terminal end (1-85) of human SRC",\N
15564,"15564","2007-12-27","2008-07-07","GFT NMR based resonance assignment of membrane proteins: application to subunit c of E. coli F1F0 ATP synthase in LPPG micelles",\N
15565,"15565","2007-12-06","2009-09-09","Human Neuroglobin HelixF",\N
15566,"15566","2008-07-15","2008-07-29","POLYMERASE LAMBDA BRCT DOMAIN",\N
15567,"15567","2009-05-28",\N,"Structure of the second PDZ domain of NHERF-1",\N
15568,"15568","2007-12-11","2009-06-16","Solution NMR Structure of uncharacterized Lipoprotein B from Nitrosomona europaea. Northeast Structural Genomics Target NeR45A.","/ftp/pub/bmrb/timedomain/bmr15568"
15569,"15569","2008-06-27",\N,"SOLUTION STRUCTURE OF MSIN3A PAH1 DOMAIN",\N
15570,"15570","2008-06-27",\N,"SOLUTION STRUCTURE OF THE MSIN3A PAH1-SAP25 SID COMPLEX",\N
15571,"15571","2008-05-29",\N,"NMR STRUCTURE OF RNA DUPLEX",\N
15572,"15572","2008-05-29",\N,"NMR STRUCTURE OF RNA DUPLEX CONTAINING SINGLE ADENOSINE BULGE",\N
15573,"15573","2007-12-11","2009-07-23","SOLUTION STRUCTURE OF 50S RIBOSOMAL PROTEIN LX FROM Methanobacterium thermoautotrophicum, NORTHEAST STRUCTURAL GENOMICS CONSORTIUM (NESG) TARGET TR80","/ftp/pub/bmrb/timedomain/bmr15573"
15574,"15574","2008-06-27",\N,"NMR solution structure of KP-TerB, a tellurite resistance protein from Klebsiella pneumoniae",\N
15575,"15575","2009-07-15","2009-09-09","Solution Structure of the Tandem WW Domains of FBP21",\N
15576,"15576","2007-12-11",\N,"Ubiquitin-like domain of NFATC2IP. Northeast Structural Genomics Consortium Target hr5627.",\N
15577,"15577","2008-10-14","2009-08-13","C Repressor",\N
15578,"15578","2008-06-27",\N,"Evidence of reciprocical reorientation of the catalytic and hemopexin-like domains of full-length MMP-12",\N
15579,"15579","2008-06-04","2008-11-04","NS2(1-27)",\N
15580,"15580","2008-09-05","2008-10-24","NS4A(1-21)",\N
15581,"15581","2008-03-31","2009-08-13","N-terminal domain of Mason-Pfizer monkey virus capsid protein, CA 1-140",\N
15582,"15582","2008-09-05","2008-10-24","NS3(10-24)",\N
15583,"15583","2008-10-31","2009-02-20","Solution structure of N-terminal Fowlicidin-1 in the presence of LPS",\N
15584,"15584","2008-01-18",\N,"NMR STRUCTURE OF PUTATIVE-tRNA HYDROLASE DOMAIN FROM SALMONELLA TYPHIMURIUM: NORTH EAST STRUCTURAL GENOMICS CONSORTIUM TARGET STR220",\N
15585,"15585","2009-04-23",\N,"Solution structure of protein ATU1810 from Agrobacterium tumefaciens; Northeast Structural Genomics Target AtR23; Ontario Center for Structural Proteomics Target ATC1776",\N
15586,"15586","2008-03-13","2008-07-07","alpha-RgIA, a Novel Conotoxin that Blocks the nAChR",\N
15587,"15587","2008-03-31","2009-08-13","1H, 13C and 15N resonance assignment of Urm1 from Trypanosoma.brucei",\N
15589,"15589","2008-06-30",\N,"Backbone H, N and CA Chemical Shift Assignments for ApoMb(1-77) in Complex with DnaK Binding Domain",\N
15590,"15590","2008-05-29",\N,"Merozoite surface protein 2 in 10 mM HOAc",\N
15591,"15591","2008-01-02","2008-07-07","NMR structure of the ubiquitin associated (UBA) domain of p62 (SQSTM1). RDC refined",\N
15592,"15592","2008-01-16","2009-02-05","NMR structure of the ubiquitin associated (UBA) domain of p62 (SQSTM1) in complex with ubiquitin. RDC refined",\N
15593,"15593","2008-01-23","2009-06-16","Solution structure of human protein C6orf130, a putative macro domain","/ftp/pub/bmrb/timedomain/bmr15593"
15594,"15594","2008-02-11","2008-03-12","Rapid Measurement of Pseudocontact Shifts in Paramagnetic Proteins by GFT NMR Spectroscopy",\N
15595,"15595","2008-01-15",\N,"A novel solution NMR structure of protein yst0336 from Saccharomyces/Northest Structural Genomics Consortium Target YT51/Ontario Center for Structural Proteomics",\N
15596,"15596","2008-01-22","2008-07-07","NMR Solution structure of Human MIP-3alpha/CCL20",\N
15597,"15597","2008-06-05","2009-08-21","glutathione peroxidase-type tryparedoxin peroxidase, oxidized form",\N
15598,"15598","2008-06-05","2009-08-21","glutathione peroxidase-type tryparedoxin peroxidase, reduced form",\N
15599,"15599","2008-11-14","2009-02-20","1H, 13C and 15N Assignments of Human Phosphohistidine Phosphatase 1 (PHPT1)",\N
15601,"15601","2008-06-05","2010-04-15","Chemical shift assignments for Atra-PBP1",\N
15602,"15602","2008-05-05","2008-07-07","1H, 13C and 15N chemical shift assignments of human PARP-1 domain C",\N
15603,"15603","2008-03-04","2009-06-16","SOLUTION NMR STRUCTURE OF LIPOPROTEIN SPR FROM ESCHERICHIA COLI K12. NORTHEAST STRUCTURAL GENOMICS TARGET ER541-37-162","/ftp/pub/bmrb/timedomain/bmr15603"
15604,"15604","2008-03-07",\N,"Solution NMR structure of Ssl0352 protein from Synechocystis sp. - Northeast Structural Genomics Consortium target SgR42",\N
15605,"15605","2008-01-18",\N,"HIV-1 gp41 Membrane Proximal Ectodomain Region peptide in DPC micelle",\N
15606,"15606","2008-07-29","2008-10-24","SOCS box elonginBC ternary complex",\N
15607,"15607","2008-11-25",\N,"Putative 32 kDa myrosinase binding protein At3g16450.1 from Arabidopsis",\N
15608,"15608","2008-02-13",\N,"NMR STRUCTURE OF PROTEIN VPA0419 FROM VIBRIO PARAHAEMOLYTICUS: NORTHEAST STRUCTURAL GENOMICS TARGET VPR68.",\N
15609,"15609","2008-01-25",\N,"solution structure of 50S ribosomal protein L28 from Thermotoga maritima: Northeast Structural Genomics consortium target VR97",\N
15610,"15610","2008-01-28","2009-06-15","Solution NMR Structure of BH09830 from Bartonella henselae Modeled with One Zn+2 Bound, Northeast Structural Genomics Consortium Target BnR55.","/ftp/pub/bmrb/timedomain/bmr15610"
15611,"15611","2008-03-07",\N,"Solution NMR structure of Nitrite reductase [NAD(P)H] small subunit from Erwinia carotovora, Northeast Structural Genomics Consortium target EwR120.",\N
15612,"15612","2008-06-26",\N,"Extended Polypeptide Linkers Establish the Spatial Architecture of a Pyruvate Dehydrogenase",\N
15613,"15613","2008-06-26","2010-07-20","SOLUTION STRUCTURE OF THE BIS-C2-2-NAPHTHYLPYRROLO[2,1-c][1,4]BENZODIAZEPINE (DA046) DNA ADDUCT: THE MOLECULAR BASIS FOR DNA HELIX STABILIZATION.",\N
15614,"15614","2009-11-03",\N,"Solution structure of the complex between E.coli NusA-AR2 and RNAP-aCTD",\N
15615,"15615","2010-02-18","2010-07-26","NMR Structure of the F0F1 double domain (residues 1-202) of the Talin FERM domain",\N
15616,"15616","2010-02-18",\N,"NMR Structure of the F1 domain (residues 86-202) of the Talin FERM domain",\N
15617,"15617","2008-01-24","2011-05-31","Northeast Structural Genomics Consortium Target YG1 (Alg13), Chemical Shift Assignments",\N
15618,"15618","2008-01-30","2009-02-20","NMR ASSIGNMENT OF THE DOMAIN 527-651 OF THE SARS-COV NONSTRUCTURAL PROTEIN NSP3",\N
15620,"15620","2008-06-27",\N,"Cam-HrTH-II",\N
15621,"15621","2008-06-27",\N,"Cam-HrTH-I",\N
15622,"15622","2008-09-19","2008-10-24","Solution structure of an antilipopolysaccharide factor from shrimp",\N
15623,"15623","2008-03-31","2010-04-15","1H, 13C, and 15N Chemical Shift Assignments for Ca2+-bound CaBP1",\N
15624,"15624","2009-10-15",\N,"Structure of Calmodulin complexed with the Calmodulin Binding Domain of Calcineurin",\N
15625,"15625","2008-09-19","2010-07-26","NMR Structure of the VBS3 domain (residues 1815-1973) of Talin",\N
15626,"15626","2008-06-30","2008-07-07","backbone assignment of yeast (Saccharomyces cerevisiae) ARF1 ,non-myristoylated, GDP-bound",\N
15627,"15627","2008-04-22","2009-08-13","1H, 13C and 15N resonance assignment of the C103S mutant of the N-terminal domain of DsbD from Neisseria meningitidis",\N
15628,"15628","2009-04-01","2009-07-15","Solution structure of S. aureus PrsA-PPIase",\N
15629,"15629","2008-06-27",\N,"Conformation A configuration delta 7 and 8 and Conformation B Configuration lambda 4 of the Metal-Bound Pyoverdine PvdI, a siderophore of Pseudomonas aeruginosa",\N
15632,"15632","2014-03-05",\N,"Solution structure of C-terminal effector domain of putative two-component-system response regulator involved in copper resistance from Klebsiella pneumoniae",\N
15633,"15633","2008-11-06",\N,"Structure of a locked SDF1 dimer",\N
15634,"15634","2012-07-19",\N,"Solution Structure of Putative Ferrous Iron Transport Protein C (FeoC) of Klebsiella pneumoniae",\N
15635,"15635","2008-11-06",\N,"Structure of SDF1 in complex with the CXCR4 N-terminus containing a sulfotyrosine at postition 21",\N
15636,"15636","2008-11-06",\N,"Structure of SDF1 in complex with the CXCR4 N-terminus containing no sulfotyrosines",\N
15637,"15637","2008-11-06",\N,"Structure of SDF1 in complex with the CXCR4 N-terminus containing sulfotyrosines at postitions 7, 12 and 21",\N
15638,"15638","2008-06-05","2009-08-13","Backbone 1H, 15N and 13C assignment of Rv1567c, an integral membrane protein from Mycobacterium tuberculosis",\N
15639,"15639","2008-05-28",\N,"1H-NMR Chemical shifts and vicinal coupling constants (3JHNHa) for 17-residue peptide corresponding to the segment within ice nucleation protein of X. campestris pv. campestris",\N
15640,"15640","2008-05-28","2009-02-05","1H-NMR Chemical shifts and vicinal coupling constants (3JHNHa) for 17-residue peptide corresponding to the segment within ice nucleation protein of X. campestris pv. campestris",\N
15641,"15641","2008-05-28",\N,"1H-NMR Chemical shifts and vicinal coupling constants (3JHNHa) for 24-residue peptide corresponding to the segment within ice nucleation protein of Erwinia uredovora, Erwinia herbicola",\N
15642,"15642","2009-06-10","2009-08-27","Solution structure of the aminoterminal domain of E. coli NusG",\N
15643,"15643","2008-06-05","2009-08-13","Backbone chemical shift assignments for ketopantoate reductase (KPR) from E. coli",\N
15644,"15644","2008-07-29",\N,"1H, 15N and 13C chemical shift assignments for Rds3 protein",\N
15645,"15645","2009-10-14",\N,"NMR STRUCTURE OF A MUTANT COLICIN E7 IMMUNITY PROTEIN IM7 WITH AN EXTENDED HELIX III",\N
15646,"15646","2008-02-05","2008-07-07","NMR analysis of the closed conformation of syntaxin-1",\N
15647,"15647","2008-08-22","2008-10-27","1H chemical shift and NMR structure of Herpes simplex virus type 1 (HSV-1)fusion peptide gH626-644",\N
15648,"15648","2008-08-22","2008-10-27","1H chemical shift and NMR structure of Herpes simplex virus type 1 (HSV-1)fusion peptide R642S gH626-644",\N
15649,"15649","2008-08-22","2008-10-27","1H chemical shift and NMR structure of Herpes simplex virus type 1 (HSV-1)fusion peptide L627S gH626-644 mutation L(627)S",\N
15650,"15650","2009-10-20",\N,"Solution structure of CaM complexed to DRP1p",\N
15651,"15651","2008-11-04","2009-02-20","NMR structure of the transmembrane domain of the Outer Membrane Protein A from Klebsiella pneumoniae in DHPC micelles.",\N
15652,"15652","2008-02-07","2009-06-15","Solution NMR structure of the uncharacterized protein from Rhodospirillum rubrum gene locus Rru_A0810. Northeast Structural Genomics Target RrR43.","/ftp/pub/bmrb/timedomain/bmr15652"
15653,"15653","2008-05-28","2009-08-13","Backbone 1H, 13C, and 15N NMR Assignments of the Tail Domain of Vinculin",\N
15654,"15654","2009-02-09","2009-06-02","NMR Chemical Shift Assignments of Insulin-like Growth Factor-I (IGF-I)",\N
15655,"15655","2008-05-22","2010-12-15","Solution structure of CopK, a periplasmic protein involved in copper resistance in Cupriavidus metallidurans CH34",\N
15656,"15656","2008-09-12","2009-08-13","Apical Stem Loop Duck HBV",\N
15658,"15658","2008-09-11","2008-11-25","The actinorhodin holo acyl carrier protein from S. coelicolor",\N
15659,"15659","2008-09-11","2008-11-25","The actinorhodin apo acyl carrier protein from S. coelicolor",\N
15660,"15660","2008-06-05","2010-04-09","NMR assignment of the arenaviral protein Z from Lassa fever virus",\N
15661,"15661","2009-05-07",\N,"Solution NMR Structure of protein hp1203 from Helicobacter pylori 26695",\N
15662,"15662","2008-02-22","2009-08-13","1H, 13C, and 15N resonance assignments of murine amelogenin, an essential enamel biomineralization protein.",\N
15663,"15663","2008-04-14","2009-08-13","Almost Complete Chemical Shift Assignments for a new calcium binding protein, EhCaM",\N
15664,"15664","2009-06-10",\N,"1H, 13C, and 15N chemical shift assignments of the C-terminal domain of the protein YqiJ from Escherichia coli",\N
15665,"15665","2008-06-27",\N,"CONFIRMATIONAL ANALYSIS OF THE BROAD-SPECTRUM ANTIBACTERIAL PEPTIDE, RANTUERIN-2CSA: IDENTIFICATION OF A FULL LENGTH HELIX-TURN-HELIX MOTIF",\N
15666,"15666","2009-10-13","2009-11-10","Mutant Collision E7 protein IM7 with an extended helix III in M Urea",\N
15667,"15667","2008-10-31","2009-02-20","Solution structure of Fowlicidin-1 (LK19) in the presence of LPS",\N
15669,"15669","2008-05-30","2009-09-03","Sequence-specific 1H, 13C and 15N resonance assignments of the GRP1 PH domain",\N
15670,"15670","2008-08-22",\N,"Solution structure of the free TAF3 PHD domain",\N
15671,"15671","2008-08-22","2010-12-22","Solution structure of the TAF3 PHD domain in complex with a H3K4me3 peptide",\N
15672,"15672","2008-06-27",\N,"MMLV p12-CA(NTD)",\N
15673,"15673","2008-06-27",\N,"NMR solution structure of PisI",\N
15674,"15674","2008-03-05",\N,"Solution NMR structure of the chromobox protein homolog 7",\N
15676,"15676","2009-11-30",\N,"NMR Studies of a Pathogenic Mutant (D178N) of the Human Prion Protein",\N
15677,"15677","2008-11-10","2010-04-15","Solubilization of transmembrane proteins in water: structural studies of a water-soluble analogue of the potassium channel KcsA",\N
15678,"15678","2008-03-17","2011-05-20","Chemical Shift assignment of SeR13 from Staphylococcus Epidermidis, North East Structural Genomics Consortium Target SeR13",\N
15679,"15679","2009-10-13","2014-05-20","3D NMR structure of domain cC0 of cardiac myosin bonding protein C (MyBP-C)",\N
15680,"15680","2008-06-05","2009-08-13","Sequence-specific 1H, 13C and 15N backbone resonance assignments of the 34kDa catalytic domain of human PTPN7",\N
15681,"15681","2008-07-08","2010-01-06","CPAP PN2-3 module",\N
15682,"15682","2008-10-03","2009-08-13","Backbone 1H, 13C, and 15N Chemical Shift Assignments for Epidermal Growth Factor-like 2 domain from Microneme Protein 6 (Toxoplasma gondii)",\N
15683,"15683","2008-03-19","2009-06-15","Solution NMR Structure of the folded C-terminal fragment of YiaD from Escherichia coli, Northeast Structural Genomics Consortium Target ER553.","/ftp/pub/bmrb/timedomain/bmr15683"
15684,"15684","2009-03-17","2009-08-13","rat lipocalin 2",\N
15685,"15685","2008-10-03","2009-09-08","Backbone and side chain 1H, 13C, and 15N Chemical Shift Assignments for the complex of Epidermal Growth Factor-like 2 domain from Microneme Protein 6 (Toxoplasma gondii) with the Galectin-like domain of Microneme protein 1",\N
15687,"15687","2012-08-14",\N,"Automated NMR Structure of the TA0895 by FAPSY",\N
15688,"15688","2012-08-14",\N,"Automated NMR Structure of the TA0956 by FAPSY",\N
15689,"15689","2009-05-12",\N,"Automated NMR Structure of the UBB by FAPSY",\N
15690,"15690","2009-06-10","2009-08-27","The solution structure of the complex between MNK1 and HAH1 mediated by Cu(I)",\N
15691,"15691","2008-06-27",\N,"Structure of the DBD domain of E. coli antitoxin RelB",\N
15692,"15692","2008-10-15","2012-10-31","Backbone assignment of MIC1-CT from Toxoplasma gondii in complex with EGF3 from TgMIC6",\N
15693,"15693","2008-09-22","2009-02-20","Solution structure of Human Pax8 Paired Box Domain",\N
15694,"15694","2008-07-08","2009-09-03","Apple Domains 1 and 2 from Toxoplasma gondii microneme protein 4",\N
15695,"15695","2008-03-28",\N,"Solution NMR structure of the chromobox protein homolog 4",\N
15697,"15697","2009-10-13",\N,"Mutational and Structural Analysis of Stem-loop IIId of the Hepatitis C Virus and GB Virus B Internal Ribosome Entry Sites",\N
15698,"15698","2010-02-01","2010-03-24","Solution Structure of the Apo C terminal domain of Lethocerus troponin C isoform F1",\N
15700,"15700","2009-04-03",\N,"solution struture of human N-terminal domain of pirh2/Northeast Structure Genomics Consortium (NESG) target HT2A",\N
15701,"15701","2008-04-07","2009-02-20","solution struture of human C-terminal domain of pirh2/Northeast Structural Genomics Consortium (NESG) target HT2C",\N
15702,"15702","2009-10-12",\N,"Solution NMR Structure of Bordatella pertussis protein BP2786, a Mth938-like domain: Northeast Structural Genomics Consortium target BeR31",\N
15703,"15703","2008-11-10","2009-02-10","Soluble form of human earliest activation antigen of leukocytes CD69",\N
15704,"15704","2008-08-28","2008-11-25","Ca2+-S100A1-RyRP12",\N
15705,"15705","2008-06-30",\N,"Pseudo Contact shifts and RDCs of Galectin-3 with C-terminal LBT tagged at a proton frequency of 600MHz.",\N
15706,"15706","2008-08-08","2009-08-13","Backbone Chemical Shift Assignments for DPF inhibited Mature Subtilisin E",\N
15707,"15707","2008-09-16","2008-12-16","NMR solution structure of the split PH domain from Phospholipase C gamma 2",\N
15708,"15708","2008-09-11","2008-12-16","Structure of the N-terminal domain of the Y4 receptor in SDS and DPC micelles",\N
15710,"15710","2008-08-28",\N,"Structural Basis of PxxDY Motif Recognition in SH3 Binding",\N
15711,"15711","2009-10-01","2009-11-05","Backbone chemical shift assignements for monomeric apoSOD1",\N
15712,"15712","2009-10-01","2009-11-05","Backbone chemical shift assignements for monomeric apoSOD1 - variant A4V",\N
15713,"15713","2009-10-01","2009-11-05","Backbone chemical shift assignements for monomeric apoSOD1 - variant G85R",\N
15714,"15714","2009-10-01","2009-11-05","Backbone chemical shift assignements for monomeric apoSOD1 - variant D90A",\N
15715,"15715","2008-10-15","2009-08-13","NMR Assignments of Methionine Sulfoxide Reductase B2 from Homo sapiens",\N
15716,"15716","2008-08-08","2009-08-13","1H, 15N, 13C resonance assignment of the AlgE6R1 subunit from the Azotobacter vinelandii Mannuronan C5-epimerase",\N
15717,"15717","2008-09-12","2011-11-23","SOLUTION STRUCTURE OF A CYANOBACTERIAL PHYTOCHROME GAF DOMAIN IN THE RED LIGHT-ABSORBING GROUND STATE",\N
15718,"15718","2008-06-30",\N,"Solution Structure of the inner DysF domain of human myoferlin",\N
15719,"15719","2008-05-05","2011-05-20","Assignment of the central region (131-28) of human h1 calponin",\N
15720,"15720","2008-06-03","2009-06-15","Solution structure of Arabidopsis thaliana protein At1g70830, a member of the major latex protein family","/ftp/pub/bmrb/timedomain/bmr15720"
15721,"15721","2008-04-17","2009-02-10","Solution structure of protein ATU1203 from AGROBACTERIUM TUMEFACIENS. NORTHEAST STRUCTURAL GENOMICS CONSORTIUM (NESG) target ATT10, Ontario Center for Structural Proteomics target ATC1183",\N
15722,"15722","2008-08-08","2009-08-13","1H, 13C and 15N Resonance Assignments of Ca2+ bound collagen-binding domain derived from a clostridial collagenase",\N
15723,"15723","2008-04-18","2010-04-19","NMR assignment of the nonstructural protein nsp3(1066-1181) from SARS-CoV",\N
15724,"15724","2008-04-22","2010-03-24","3J coupling constants related to the phi-torsions in oxidised Flavodoxin from Desulfovibrio vulgaris (Hildenborough)",\N
15725,"15725","2008-04-22","2008-04-29","3J coupling constants related to the chi1-torsions in oxidised Flavodoxin from Desulfovibrio vulgaris (Hildenborough)",\N
15726,"15726","2008-11-11","2009-08-14","Backbone 1H, 13C, and 15N Chemical Shift Assignments for La NTD",\N
15727,"15727","2008-11-11","2009-08-14","Full 1H, 13C, and 15N Chemical Shift Assignments for La NTD complexed with 5'UUUU RNA",\N
15728,"15728","2008-09-02","2008-12-16","NMR structures of dimeric transmembrane domain of the receptor tyrosine kinase EphA1 in lipid bicelles at pH 4.3",\N
15729,"15729","2008-07-15",\N,"Solution Structure of Tick Carboxypeptidase Inhibitor at pH 3.5",\N
15730,"15730","2008-07-15",\N,"Solution structure of the folded domain of intermediate IIIa of Tick Carboxypeptidase Inhibitor",\N
15731,"15731","2008-07-15",\N,"Solution structure of the folded domain of intermediate IIIb of Tick Carboxypeptidase Inhibitor",\N
15732,"15732","2009-03-03","2009-08-21","1H, 13C, and 15N backbone resonance assignments of the bright domain of the histone demethylase JARID 1B",\N
15733,"15733","2012-07-19",\N,"Solution structure of Lamin B Receptor Tudor domain",\N
15734,"15734","2008-08-28",\N,"Solution Structure of cGMP-binding GAF domain of Phosphodiesterase 5",\N
15735,"15735","2009-01-23",\N,"truncated AcrA from Campylobacter jejuni for glycosylation studies",\N
15736,"15736","2009-10-12",\N,"Full length human frataxin",\N
15737,"15737","2009-01-23",\N,"Solution structure of an N-glycosylated protein using in vitro glycosylation",\N
15738,"15738","2014-03-05",\N,"Carbon storage regulator from Helicobacter pylori",\N
15739,"15739","2008-11-25","2009-02-23","Hydramacin-1: Structure and antibacterial activity of a peptide from the basal metazoan Hydra",\N
15740,"15740","2008-11-11","2009-02-23","Structure ensemble Backbone and side-chain 1H, 13C, and 15N Chemical Shift Assignments, 1H-15N RDCs and 1H-1H nOe restraints for protein K7 from the Vaccinia virus",\N
15741,"15741","2008-10-14","2009-08-14","1H, 15N and 13C resonance assignment of imidazole glycerol phosphate (IGP) synthase protein HisF from Thermotoga maritima",\N
15742,"15742","2008-07-30","2008-12-16","CsmA",\N
15743,"15743","2008-09-12","2010-04-16","Sequence specific 1H, 13C and 15N resonance assignment of Hahellin from Hahella chejuensis, a putative member of the bg-crystallin superfamily",\N
15744,"15744","2008-10-15","2009-09-02","Backbone assignment of lipid-free human apolipoprotein E (apoE)",\N
15745,"15745","2008-09-25",\N,"Solution structure of stem-loop alpha; of the hepatitis B virus post-transcriptional regulatory element",\N
15746,"15746","2009-11-11",\N,"Bpp3783_115-220",\N
15747,"15747","2008-05-29","2008-08-07","Structural and Functional Characterization of TM IX of the NHE1 Isoform of the Na+/H+ Exchanger",\N
15748,"15748","2009-09-29","2009-11-11","D,L-Peptide Foldamers: A Beta-Hairpin/Beta-Helical Structure in Methanol",\N
15749,"15749","2009-09-29","2009-11-11","D,L-Peptide Foldamers: A Curved Structure in PBS",\N
15750,"15750","2008-05-12","2009-06-15","Solution NMR structure of the folded 79 residue fragment of Lin0334 fromListeria innocua. Northeast Structural Genomics Consortium target LkR15.","/ftp/pub/bmrb/timedomain/bmr15750"
15751,"15751","2008-11-12","2009-02-23","SYNTHESIS, STRUCTURE AND ACTIVITIES OF AN ORAL MUCOSAL ALPHA-DEFENSIN FROM RHESUS MACAQUE",\N
15752,"15752","2008-11-12",\N,"Structure of a Glycosylphosphatidylinositol-anchored Domain from a Trypanosome Variant Surface Glycoprotein",\N
15753,"15753","2008-11-12",\N,"Structure of a Glycosylphosphatidylinositol-anchored Domain from a Trypanosome Variant Surface Glycoprotein",\N
15755,"15755","2009-11-20","2010-01-25","NMR Solution structure of the C-terminal domain (T94-Y172) of the human centrin 2 in complex with a repeat sequence of human Sfi1 (R641-T660)",\N
15756,"15756","2009-04-15","2009-06-02","1H, 13C and 15N backbone chemical shift assignments of the 2FNI-3FNI module pair from human fibronectin",\N
15757,"15757","2009-05-14","2009-11-11","1H, 13C and 15N assignment for eosinophil cationic protein",\N
15758,"15758","2009-04-15","2009-06-02","1H, 13C and 15N backbone chemical shift assignments of the 4FNI-5FNI module pair from human fibronectin",\N
15759,"15759","2009-04-15","2009-06-02","1H, 13C and 15N backbone chemical shift assignments of the 3FNIII module from human fibronectin",\N
15760,"15760","2008-11-12",\N,"Solution structure of a cytoskeletal protein complex",\N
15761,"15761","2008-07-28","2009-02-23","Chemical shift assignments for JHP0511 (HP0564) from Helicobacter pylori.",\N
15762,"15762","2008-05-09",\N,"NMR Structure of Protein yiiS from Shigella flexneri: Northeast Structural Genomics Consortium Target SfR90",\N
15763,"15763","2009-02-09",\N,"The solution structure of human Mia40",\N
15764,"15764","2008-06-30",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for Ca2+-Binding Domain 1 of the Na+/Ca2+ Exchanger in the Absence of Ca2+",\N
15765,"15765","2008-11-12","2009-02-23","Solution Structure of a Tetrahaem Cytochrome from Shewanella Frigidimarina",\N
15766,"15766","2008-06-30",\N,"human calpastatin Domain 1",\N
15767,"15767","2008-11-03","2009-02-23","Backbone Resonance Assignments of the N-terminal half of hepatitis core protein",\N
15768,"15768","2009-04-03",\N,"Backbone Resonance Assignments of the N-terminal half of hepatitis core protein",\N
15769,"15769","2008-09-12","2009-08-14","1H,13C, and 15N resonance assignment of the ubiquitin like domain (UBL) of Dsk2p.",\N
15770,"15770","2009-01-15","2009-08-21","1H, 13C and 15N chemical shifts for the Myxococcus xanthus CarS1 antirepressor protein",\N
15773,"15773","2008-07-30","2009-02-23","Analysis of Site-specific Histidine Protonation in Human Prolactin",\N
15774,"15774","2008-12-30","2009-02-24","Rv1761c",\N
15775,"15775","2008-08-19","2009-02-24","Backbone chemical shift assignment for the transmembrane and C-terminal domains of amyloid precursor protein (APP C99)",\N
15776,"15776","2008-11-14",\N,"Pfu Rpp21 structure and assignments",\N
15777,"15777","2009-05-22",\N,"Solution Structure of IG-Like Domain 23 from Human Filamin A",\N
15778,"15778","2009-04-03","2009-04-30","Structure of the tyrosine-O-sulfated C5a receptor N-terminus in complex with the immune evasive protein CHIPS.",\N
15779,"15779","2009-10-14",\N,"Backbone 1H, 13C and 15N assignments for ginkbilobin-2 with C-terminal His6-tag",\N
15780,"15780","2008-09-02","2014-05-20","NMR structure of adenosine bulged RNA duplex with C:G-A triple",\N
15781,"15781","2008-09-02","2014-05-20","NMR structure of uridine bulged RNA duplex",\N
15782,"15782","2008-09-12","2009-08-14","1H, 13C and 15N chemical shifts of the sylvatic Dengue 1 Envelope Protein Domain III, strain P72-1244",\N
15783,"15783","2009-10-12","2014-05-20","acidic fibroblast growth factor solution structure in the FGF-1-C2A binary complex: key component in the fibroblast growthfactor non-classical pathway",\N
15784,"15784","2008-11-25",\N,"1H, 13C, and 15N Chemical Shift Assignments for NikA(1-51)",\N
15785,"15785","2009-10-12","2014-05-20","C2A domain of synaptototagmin I solution structure in the FGF-1-C2A binary complex: key component in the fibroblast growthfactor non-classical pathway",\N
15786,"15786","2008-09-12","2009-08-14","1H,13C and 15N NMR assignments of duck HBV primer loop of the epsilon encapsidation signal",\N
15787,"15787","2009-01-28","2009-08-14","1H and 15N chemical shift assignments for HINT1 protein",\N
15788,"15788","2008-07-15","2009-02-24","X-ray crystallographic and Solution State NMR Spectroscopic Investigations of NADP+ Binding to Ferredoxin-NADP Reductase (FPR) from Pseudomonas aeruginosa",\N
15789,"15789","2008-08-28",\N,"Chemical shift assignments for human MCFD2",\N
15790,"15790","2008-07-29","2009-02-24","NMR STRUCTURE OF THE N-TERMINAL COILED COIL DOMAIN OF THE ANDES HANTAVIRUS NUCLEOCAPSID PROTEIN",\N
15791,"15791","2008-08-08",\N,"Solution NMR Structure of UPF0339 Protein SO3888 from Shewanella Oneidensis. Northeast Structural Genomics Consortium Target SoR190",\N
15792,"15792","2008-07-28",\N,"talin-F2F3",\N
15793,"15793","2008-11-14","2009-02-24","CopR Repressor Structure",\N
15795,"15795","2008-07-24","2009-05-04","NMR structure of the c-terminal domain of a multiprotein bridging factor 1 (MBF1) of Trichoderma reesei",\N
15796,"15796","2008-11-14","2009-02-24","E2-c-Cbl recognition is necessary but not sufficient for ubiquitination activity",\N
15797,"15797","2008-07-29","2009-09-02","Solution structure of Tpx in the reduced state",\N
15798,"15798","2008-07-29","2009-09-02","Solution structure of Tpx in the oxidized state",\N
15799,"15799","2009-04-02",\N,"HIV-1 Gag p6 C-terminal",\N
15800,"15800","2008-10-03","2009-08-19","Backbone and side-chain 1H, 13C, and 15N Chemical Shift Assignments for Human Galectin-1",\N
15801,"15801","2009-02-09","2009-03-23","ArsR DNA Binding Domain",\N
15802,"15802","2008-07-29","2009-09-02","1H, 13C, and 15N resonance assignments of a RNA binding protein GSP13 from Bacillus subtilis",\N
15803,"15803","2008-11-05","2009-08-19","RalB in complex with its effector RLIP76",\N
15804,"15804","2008-06-23",\N,"Solution NMR Structure of M. thermoautotrophicum protein MTH_1000, Northeast Structural Genomics Consortium Target TR8",\N
15805,"15805","2009-10-12",\N,"NMR structure of protein PF0246 from Pyrococcus furiosus: target PfR75 from the Northeast Structural Genomics Consortium",\N
15806,"15806","2008-11-14","2008-12-03","1H and 15N Chemical Shift Assignments and Experimental NMR Restraints for the Neurotrypsin Kringle Domain",\N
15807,"15807","2008-11-14","2009-05-04","The Solution Structure of gpV, the Major Tail Protein from Bacteriophage Lambda",\N
15808,"15808","2008-10-03","2009-08-19","Assignment of the 1H, 13C and 15N resonance of the Calponin Homology-2 domain of alpha-actinin-4",\N
15809,"15809","2009-03-12",\N,"myristoylated yeast ARF1, GDP bound",\N
15810,"15810","2009-04-23",\N,"Solution structure of uncharacterized protein PA1076 from Pseudomonas aeruginosa. Northeast Structural Genomics Consortium (NESG) target PaT3, Ontario Center for Structural Proteomics target PA1076.",\N
15811,"15811","2009-04-23",\N,"Solution structure of 30S ribosomal protein S27A from Thermoplasma acidophilum",\N
15812,"15812","2008-08-08",\N,"NMR Structure of FeoA-like protein from Clostridium acetobutylicum: Northeast Structural Genomics Consortium Target CaR178",\N
15813,"15813","2008-11-25","2009-08-21","1H, 13C and 15N resonance assignments of the ribosome binding domain of E. coli Trigger Factor",\N
15814,"15814","2009-01-06","2009-08-21","1H, 13C and 15N resonance assignments of the domain 5 of ABP-120 from Dictyostelium in native and 8M urea-denatured states.",\N
15816,"15816","2008-07-03",\N,"Solution NMR Structure of Allochromatium vinosum DsrR: Northeast Structural Genomics Consortium Target OP5",\N
15817,"15817","2009-02-03",\N,"Type III antifreeze protein isoform HPLC-12",\N
15818,"15818","2009-02-03",\N,"Type III antifreeze protein isoform HPLC-12",\N
15819,"15819","2008-08-08",\N,"Solution NMR Structure of the replication Factor A Related Protein from Methanobacterium thermoautotrophicum. Northeast Structural Genomics Target TR91A.","/ftp/pub/bmrb/timedomain/bmr15819"
15820,"15820","2009-02-13",\N,"RRM1 of hnRNPLL",\N
15821,"15821","2008-07-15","2009-06-11","Structure of uncharacterized protein MJ1198 from Methanocaldococcus jannaschii. Northeast Structural Genomics Target MjR117B","/ftp/pub/bmrb/timedomain/bmr15821"
15822,"15822","2008-08-21","2009-06-11","NMR solution structure of A3DK08 protein from Clostridium thermocellum: Northeast Structural Genomics Consortium Target CmR9","/ftp/pub/bmrb/timedomain/bmr15822"
15823,"15823","2008-08-08",\N,"Solution NMR structure of protein Atu0742 from Agrobacterium Tumefaciens. Northeast Structural Genomics Consortium (NESG0) target AtT8. Ontario Center for Structural Proteomics target ATC0727.",\N
15824,"15824","2008-09-12","2009-02-24","Bank Vole Prion Protein (121-231)",\N
15825,"15825","2008-07-14","2009-06-11","Solution NMR Structure of Putative Lipoprotein from Pseudomonas syringae Gene Locus PSPTO2350. Northeast Structural Genomics Target PsR76A.","/ftp/pub/bmrb/timedomain/bmr15825"
15826,"15826","2009-01-15","2009-08-21","1H, 13C and 15N assignment of the Yellow Fluorescent Protein (YFP) Venus",\N
15827,"15827","2009-06-15",\N,"Solution structure of antimicrobial peptide MSI-594, derived from Magainin-2 and Malittin, in the presence of LPS.",\N
15828,"15828","2008-08-20",\N,"NMR Structure for PF0385",\N
15829,"15829","2009-05-07","2009-06-11","SOLUTION NMR STRUCTURE OF SAG0934 from Streptococcus agalactiae. NORTHEAST STRUCTURAL GENOMICS TARGET SaR32[1-108].","/ftp/pub/bmrb/timedomain/bmr15829"
15830,"15830","2009-02-13",\N,"chemical shift assignments and heteronuclear NOE of the N-terminal domain of the human Y1-receptor",\N
15831,"15831","2009-02-13",\N,"chemical shift assignments and heteronuclear NOE of the N-terminal domain of the human Y2-receptor",\N
15832,"15832","2009-02-13",\N,"chemical shift assignments and heteronuclear NOE of the N-terminal domain of the human Y5-receptor",\N
15833,"15833","2008-08-22","2009-06-10","NMR CHEMICAL SHIFT ASSIGNMENTS OF PUTATIVE UNCHARACTERIZED PROTEIN. FROM METHANOCALDOCOCCUS JANNASCHII, NORTHEAST STRUCTURAL GENOMICS CONSORTIUM (NESG) TARGET GsR195","/ftp/pub/bmrb/timedomain/bmr15833"
15834,"15834","2008-07-24",\N,"Solution NMR structure of FeoA protein from Chlorobium tepidum. Northeast Structural Genomics Consortium target CtR121",\N
15835,"15835","2008-08-19",\N,"Solution NMR structure of protein encoded by gene BPP1335 from Bordetella parapertussis: Northeast Structural Genomics Target BpR195",\N
15836,"15836","2008-08-19",\N,"Solution NMR structure of protein encoded by MTH693 from Methanobacterium thermoautotrophicum: Northeast Structural Genomics Consortium target tt824a",\N
15837,"15837","2008-08-22","2009-06-10","NMR CHEMICAL SHIFT ASSIGNMENTS OF IRON(II) TRANSPORT PROTEIN A FROM CLOSTRIDIUM THERMOCELLUM , NORTHEAST STRUCTURAL GENOMICS CONSORTIUM (NESG) TARGET VR131","/ftp/pub/bmrb/timedomain/bmr15837"
15839,"15839","2008-08-19",\N,"Solution structure of protein yiiF from Shigella flexneri serotype 5b (strain 8401) . Northeast Structural Genomics Consortium target sft1",\N
15840,"15840","2008-07-24","2009-02-11","Chemical Shift assignment of RhR2 from Rodobacter Sphaeroides, North east Structural Genomics Consortium Target SeR13",\N
15841,"15841","2008-08-19",\N,"Solution NMR Structure of Protein FeoA from Clostridium thermocellum, Northeast Structural Genomics Consortium Target CmR17",\N
15843,"15843","2009-02-11",\N,"Solution NMR Structure of the N-Terminal Domain of Protein ECA1580 from Erwinia carotovora, Northeast Structural Genomics Consortium Target EwR156A",\N
15844,"15844","2008-08-25","2010-08-18","NMR Solution Structure of a Thiamine Biosynthesis Protein from Geobacter Metallireducens: Northeast Structural Genomics Consortium Target GmR137","/ftp/pub/bmrb/timedomain/bmr15844"
15845,"15845","2008-09-12","2009-02-26","Mouse Prion Protein (121-231) with Mutation S170N",\N
15846,"15846","2008-08-25","2009-06-09","NMR solution Structure of Membrane associated protein from Bacillus cereus: Northeast Structural Genomics Consortium Target: BcR97A","/ftp/pub/bmrb/timedomain/bmr15846"
15847,"15847","2008-09-19",\N,"Solution NMR Structure of XF2673 from Xylella fastidiosa. Northeast Structural Genomics Consortium Target XfR39",\N
15848,"15848","2008-09-19",\N,"Solution NMR Structure of Putative N-Acetyl Transferase YhhK from E. coli Bound to Coenzyme A: Northeast Structural Genomics Consortium Target ET106",\N
15849,"15849","2008-09-03","2009-07-23","SOLUTION NMR STRUCTURE OF the second OB-fold domain of replication protein A from Methanococcus maripaludis. NORTHEAST STRUCTURAL GENOMICS TARGET MrR110B.","/ftp/pub/bmrb/timedomain/bmr15849"
15850,"15850","2008-10-13",\N,"Solution NMR Structure of Putative Lipoprotein from Bacillus cereus Ordered Locus BC_2438. Northeast Structural Genomics Target BcR103A.",\N
15851,"15851","2008-10-14","2009-02-26","NMR structure of calcium-loaded STIM1 EF-SAM",\N
15852,"15852","2009-04-04","2009-04-27","Solution structure of CaM complexed to DAPk peptide",\N
15853,"15853","2008-08-07",\N,"Local and global structure of the monomeric subunit of the potassium channel KcsA probed by NMR",\N
15854,"15854","2008-11-17",\N,"NMR solution structure of the supramolecular adduct between a liver cytosolic bile acid binding protein and a bile acid-based Gd(III)-chelate",\N
15855,"15855","2008-07-07","2010-04-16","NMR assignment of human Growth Arrest and DNA Damage alpha protein (Gadd45a)",\N
15856,"15856","2009-10-13",\N,"NMR solution structure of the d3'-hairpin including the exon binding site 1 (EBS1) of the group II intron Sc.ai5(gamma)",\N
15857,"15857","2009-10-13",\N,"NMR solution structure of the d3'-hairpin including EBS1 together with IBS1 of the group II intron Sc.ai5(gamma)",\N
15858,"15858","2009-10-12",\N,"NMR solution structure of the exon/intron binding site 1 (EBS1/IBS1) of the group II intron Sc.ai5(gamma)",\N
15859,"15859","2009-10-13",\N,"NMR solution structure of the d3'-stem closed by a GAAA tetraloop of the group II intron Sc.ai5(gamma)",\N
15860,"15860","2009-10-12","2010-07-16","NMR solution structure of modified DNA containing imidazole nucleosides at acidic, neutral and basic pH",\N
15863,"15863","2008-09-24",\N,"Solution structure of EAS D15 truncation mutant",\N
15864,"15864","2009-05-18","2009-06-10","Solution structure of 1-112 fragment of human programmed cell death 5 protein",\N
15865,"15865","2008-11-17","2009-02-27","Detailed Structural Characterization of Unbound Protein Phosphatase 1 Inhibitors",\N
15866,"15866","2008-10-08",\N,"CIN85 Sh3-C domain in complex with ubiquitin",\N
15867,"15867","2008-11-19","2009-08-20","1H, 13C and 15N resonance assignment of 9.7 M urea-denatured GED of dynamin",\N
15868,"15868","2008-07-24","2009-02-11","1H, 13C and 15N resonance assignment of guanidine-denatured GED of dynamin",\N
15869,"15869","2008-10-15","2009-08-19","NMR Assignments of HIV-2 TAR RNA",\N
15870,"15870","2009-07-10",\N,"The domain features of the peripheral stalk subunit H of the methanogenic A1AO ATP synthase and the NMR solution structure of H1-47",\N
15871,"15871","2009-10-20","2010-03-26","Solution Structure of XACb0070 from Xanthonomas axonopodis pv citri",\N
15873,"15873","2009-09-03","2009-11-11","Solution Structure of Human Supervillin Headpiece",\N
15874,"15874","2009-09-03","2009-11-11","Solution Structure of Human Supervillin Headpiece, Minimized Average",\N
15875,"15875","2009-05-29","2009-07-01","Backbone Chemical Shift Assignments and Relaxation Data for S. pombe Aps1d2-19",\N
15876,"15876","2008-10-08","2009-02-27","Human LL-37 Structure",\N
15877,"15877","2008-11-26","2009-02-27","LC3 p62 complex structure",\N
15878,"15878","2008-08-13",\N,"Yersinia pseudotuberculosis type III secretion effector YopE.",\N
15879,"15879","2009-03-12","2010-04-22","Protein folding on a highly rugged landscape: Experimental observation of glassy dynamics and structural frustration",\N
15880,"15880","2009-02-13",\N,"Structure of Rab11-FIP2 C-terminal Coiled-coil Domain",\N
15881,"15881","2008-11-17","2009-08-21","NMR assignment of Prespore Specific Antigen - a cell surface adhesion glycoprotein from Dictyostelium discoideum",\N
15882,"15882","2008-10-01",\N,"1H, 15N, 13C backbone assignment of the SPF45 UHM domain",\N
15883,"15883","2008-09-19","2008-10-15","Backbone and 13C and 1H assignments for acid unfolded state and urea unfolded state of CTL9",\N
15884,"15884","2008-09-19","2008-10-15","Backbone 1H, 13C, and 15N Chemical Shift Assignments for CTL9 native state at pH 3.8",\N
15885,"15885","2008-10-15","2008-12-04","Backbone assignment of the UHM domain of Puf60 in the free form",\N
15887,"15887","2008-10-15","2009-08-19","1H, 15N chemical shifts of the UHM domain of Puf60 in complex with U2AF65(85-112)",\N
15888,"15888","2008-10-15","2009-08-19","1H, 15N chemical shifts of the UHM domain of Puf60 in complex with SF1(1-25)",\N
15889,"15889","2008-10-15","2009-08-19","1H, 15N chemical shifts of the UHM domain of Puf60 in complex with SF3b155(194-229)",\N
15890,"15890","2008-10-15","2009-08-19","1H, 15N chemical shifts of the UHM domain of Puf60 in complex with SF3b155(317-357)",\N
15891,"15891","2008-10-15","2009-08-19","1H, 15N chemical shifts of the UHM domain of Puf60 in complex with Prp16(201-238)",\N
15892,"15892","2009-04-22","2009-05-18","Backbone 1HN and 15N Assignments for Native Human alpha-Lactalbumin",\N
15893,"15893","2008-10-10",\N,"Mechanism of metal delivery to the CuA center in terminal oxidases from bacteria: a redox m nage- -trois",\N
15894,"15894","2008-11-14",\N,"Mechanism of metal delivery to the CuA center in terminal oxidases from bacteria: a redox m nage- -trois",\N
15895,"15895","2008-11-14",\N,"Solution structures of apo form PCuA (cis conformation of the peptide bond involving the nitrogen of P14)",\N
15896,"15896","2008-11-14",\N,"Solution structures of copper loaded form PCuA (trans conformation of the peptide bond involving the nitrogen of P14)",\N
15897,"15897","2008-11-14",\N,"Solution structures of copper loaded form PCuA (cis conformation of the peptide bond involving the nitrogen of P14)",\N
15898,"15898","2009-05-18","2010-07-19","H1, C13, 31P chemical shifts of dGCGAAAGC",\N
15899,"15899","2008-11-19",\N,"1H, 13C and 15N backbone chemical shift assignments of the C-terminal CH domain of human alpha-parvin",\N
15900,"15900","2009-12-11","2010-03-22","MMP23, a metalloprotease with a toxin-like potassium channel blocking domain and immunomodulatory role with relevance in prostate cancer",\N
15901,"15901","2009-06-24","2009-11-11","Backbone 1H, 13C, and 15N Chemical Shift Assignments for D+PHS, a hyperstable variant of SNase, at pH 4.66",\N
15902,"15902","2008-08-13","2009-06-09","Solution NMR structure of the OB domain of Ta0387 from Thermoplasma acidophilum. Northeast Structural Genomics Consortium target TaR80b.","/ftp/pub/bmrb/timedomain/bmr15902"
15903,"15903","2014-03-05",\N,"1H, 15N and 13C backbone and side chain resonance assignment of Rv0008c, an integral membrane protein from Mycobacterium tuberculosis",\N
15904,"15904","2008-11-19","2009-01-29","1J coupling constants related to the Ca carbons in oxidised Flavodoxin from Desulfovibrio vulgaris (Hildenborough)",\N
15905,"15905","2008-11-19","2009-01-29","1J coupling constants related to the Ca carbons in Ribonuclease T1 from Aspergillus oryzae",\N
15906,"15906","2008-11-19","2009-01-29","1J coupling constants related to the Ca carbons in human Frataxin C-terminal domain (90-210)",\N
15907,"15907","2008-11-19","2009-01-29","1J coupling constants related to the Ca carbons in human Ubiquitin",\N
15908,"15908","2008-11-19","2009-01-29","1J coupling constants related to the Ca carbons in Xylanase from Bacillus agaradhaerens",\N
15909,"15909","2008-11-19","2009-01-29","1J coupling constants related to the Ca carbons in DFPase from Loligo vulgaris",\N
15910,"15910","2009-05-19",\N,"NMR solution structure of the Bacillus subtilis ClpC N-domain",\N
15911,"15911","2008-10-02","2009-05-06","NMR backbone assignments of the periplasmic loop P2 of the MalF subunit of the maltose ATP binding cassette transporter",\N
15912,"15912","2009-05-18",\N,"Solution Structure of the binary complex between the SH3 and SH2 domain of interleukin-2 tyrosine kinase",\N
15913,"15913","2008-08-14","2009-02-27","Solution Structure of the IsdC NEAT domain bound to Zinc Protoporphyrin",\N
15914,"15914","2008-11-19","2009-02-27","Backbone 1H, 13C and 15N Chemical Shift Assignments for Binder of Arl2 (BART)",\N
15915,"15915","2008-09-30","2009-06-10","NMR structure of the human tRNALys3 bound to the HIV genome Loop I",\N
15916,"15916","2010-09-24",\N,"Solution NMR structure of protein ATU0232 from AGROBACTERIUM TUMEFACIENS. Northeast Structural Genomics Consortium (NESG) target AtT3. Ontario Center for Structural Proteomics target ATC0223.",\N
15917,"15917","2012-03-13",\N,"TEM-1 BETA-LACTAMASE VARIANT ALLOSTERICALLY REGULATED BY KANAMYCIN",\N
15918,"15918","2009-03-23","2009-08-20","Backbone 1H, 13C, and 15N Chemical Shift Assignments for M-crystallin (calcium bound form) in presence of 4 M Gdn-Hcl",\N
15919,"15919","2009-02-16","2012-05-17","NMR structure of a complex formed by the C-terminal domain of human RAP74 and a phosphorylated peptide from the central domain of the FCP1",\N
15921,"15921","2008-08-19","2009-02-27","1H, 13C and 15N assignment of a double transmembrane domain from human Y4 receptor, a G-protein coupled receptor",\N
15922,"15922","2010-01-11","2010-03-22","Solution structure of the PPIL1 bound to a fragment of SKIP",\N
15923,"15923","2008-10-28","2009-02-27","Ca2+-S100B",\N
15924,"15924","2009-01-15","2009-08-21","Filamin A Ig-like domains 16-17",\N
15925,"15925","2009-01-15","2009-08-21","Filamin A Ig-like domains 18-19",\N
15926,"15926","2009-04-04","2009-05-06","N-terminal domain of the Bacillus subtilis helicase-loading protein DnaI",\N
15927,"15927","2008-11-17","2009-08-20","1H, 13C, 15N NMR resonance assignments of the actinoporin Sticholysin I",\N
15928,"15928","2009-02-13","2009-02-27","Human ARNT C-Terminal PAS Domain, 3 Residue IB slip",\N
15930,"15930","2012-01-04",\N,"Sequence-specific 1H, 15N, and 13C resonance assignments and relaxation parameters for the whole region 4 of Escherichia coli RNA polymerase sigma70 subunit in 10% TFE",\N
15931,"15931","2009-09-03",\N,"Deletions in a surface loop divert the folding of a protein domain into a metastable dimeric form",\N
15932,"15932","2009-03-11","2009-03-23","Solution Structure of the Catalytic Domain of Procaspase-8",\N
15933,"15933","2010-05-06",\N,"NOGO66 in DPC.",\N
15934,"15934","2009-03-23","2009-08-20","Backbone 1H, 13C, and 15N Chemical Shift Assignments for M-crystallin (calcium bound form) in presence of 6 M Gdn-Hcl",\N
15935,"15935","2009-10-22",\N,"Pfu RPP29d17-RPP21V14 complex",\N
15936,"15936","2009-11-20",\N,"Sequence-specific 1H, 15N, resonance assignments of nine 1H-{15N} HSQC spectras for the whole region 4 of Escherichia coli RNA polymerase sigma70 subunit recorded at TFE concentrations increasing in the range of 0-30%",\N
15937,"15937","2010-01-22",\N,"Solution structure of the equine infectious anemia virus p9 gag protein",\N
15938,"15938","2009-04-29","2009-05-27","p190-A RhoGAP FF1 domain",\N
15939,"15939","2009-02-16","2009-03-27","Solution Structure of FOXO3a Forkhead domain",\N
15940,"15940","2009-03-20","2009-04-29","Association of subunit d (Vma6p) and E (Vma4p) with G (Vma10p) and the NMR solution structure of subunit G (G1-59) of the Saccharomyces cerevisiae V1VO ATPase",\N
15941,"15941","2009-10-13","2011-05-20","Solution structure of a zinc-binding methionine sulfoxide reductase",\N
15942,"15942","2012-07-19",\N,"1H, 13C and 15N assignments for rrm2 domain of PABP1",\N
15943,"15943","2009-04-23",\N,"Solution NMR Structure of protein of unknown function yegP from E. coli. Ontario Center for Structural Proteomics target EC0640_1_123 Northeast Structural Genomics Consortium Target ET102.",\N
15944,"15944","2009-03-12",\N,"Structural Basis for the Regulation of p53 Function by p300",\N
15945,"15945","2008-10-13","2009-03-03","MDM2 N-terminal domain",\N
15946,"15946","2009-04-04","2009-06-02","Solution structure of a paralog-specific Mena binder by NMR",\N
15948,"15948","2009-01-16","2010-04-20","1H, 13C, and 15N Chemical Shift Assignments for the RING finger of the E3 ubiquitin ligase Arkadia (RNF111)",\N
15949,"15949","2009-01-15","2009-08-20","1H, 15N, 13C Resonance Assignments of the Reduced and Active Form of Human Protein Tyrosine Phosphatase, PRL-1",\N
15950,"15950","2009-04-02","2009-04-29","solution structure of E.Coli SlyD",\N
15951,"15951","2009-05-29","2010-10-06","HCV p7 tm2",\N
15952,"15952","2009-03-17",\N,"S100A13-C2A",\N
15953,"15953","2008-09-30","2009-03-03","H55K mutant of LC8 at pH 6.7 from Drosophila Melanogaster",\N
15954,"15954","2009-01-06","2009-08-20","human eIF5A",\N
15955,"15955","2009-01-28","2010-01-25","Green Proteorhodopsin",\N
15956,"15956","2009-02-10",\N,"NMR structure analysis of a BMP receptor",\N
15957,"15957","2009-04-02",\N,"Solution structure of the HIV-1 p6 C-terminal domain",\N
15958,"15958","2009-06-02","2009-06-17","NMR Structure of Shq1p N-terminal domain",\N
15959,"15959","2008-10-03","2009-03-03","Backbone 1H and 15N Chemical Shift Assignments for the Phosphotyrosine Binding Domain of Insulin Receptor Substrate 1 in the Apo and Phosphopeptide Bound Forms",\N
15960,"15960","2011-06-01",\N,"Solution structure of human acidic fibroblast growth factor in complex with anti-angiogenic drug inositol hexaphosphate (IP6)",\N
15961,"15961","2009-03-03","2009-08-21","Backbone and Side chain 1H, 13C, and 15N Chemical Shift Assignments for Microneme protein 2 Associated protein",\N
15962,"15962","2009-01-20",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for the heme bound form of Truncated HasAp.",\N
15963,"15963","2009-01-20",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for the heme bound form of Full-Length HasAp.",\N
15964,"15964","2009-04-22","2009-05-26","Solution structure of Oxidised ERp18",\N
15965,"15965","2009-04-02","2009-05-18","Structural Transitions of the N Terminus of a Short Non-Muscle Tropomyosin upon Binding to the C Terminus in Solution",\N
15966,"15966","2008-12-12",\N,"Solution NMR structure of integral membrane protein DsbB",\N
15967,"15967","2009-06-11","2009-07-01","Structural characterization of IscU and its interaction with HscB",\N
15968,"15968","2008-11-05","2009-03-04","Backbone chemical shift assignments for the UBA domain of Swa2p",\N
15969,"15969","2009-02-16","2009-03-23","Heteronuclear NMR assignments for the dimeric human hepatitis B virus core protein under capsid dissociating conditions",\N
15970,"15970","2009-03-18",\N,"SOLUTION STRUCTURE OF THE LSM DOMAIN OF DROSOPHILA MELANOGASTER TRAL (TRAILER HITCH)",\N
15971,"15971","2009-03-18",\N,"SOLUTION STRUCTURE OF THE LSM DOMAIN OF DROSOPHILA MELANOGASTER TRAL (TRAILER HITCH)",\N
15972,"15972","2009-01-15","2009-08-21","1H, 13C and 15N resonance assignments of the PDZ of MAST205 in complex with the C-terminal tail from the rabies virus glycoprotein",\N
15973,"15973","2008-11-11","2009-03-04","HGF-binding peptide-10",\N
15974,"15974","2009-07-17","2009-11-16","Chemical shifts of the b-b'-x region of human protein disulfide isomerase",\N
15975,"15975","2009-12-14","2010-01-25","Sequence-specific 1H, 15N, and 13C resonance assignments and relaxation parameters for the whole region 4 of Escherichia coli RNA polymerase sigma70 subunit in 30% TFE",\N
15977,"15977","2008-11-25","2009-08-20","Backbone and side chain 1H, 13C and 15N chemical shifts for the C-terminal domain of CdnL from Myxococcus xanthus",\N
15978,"15978","2009-02-09",\N,"Lipopolysaccharide Bound Structures of the Active Fragments of Fowlicidin-1, a Cathelicidin Family of Antimicrobial and Antiendotoxic Peptide from Chicken, Determined by Transferred Nuclear Overhauser Effect Spectroscopy",\N
15979,"15979","2009-02-09",\N,"Lipopolysaccharide Bound Structures of the Active Fragments of Fowlicidin-1, a Cathelicidin Family of Antimicrobial and Antiendotoxic Peptide from Chicken, Determined by Transferred Nuclear Overhauser Effect Spectroscopy",\N
15980,"15980","2009-02-09",\N,"Lipopolysaccharide Bound Structures of the Active Fragments of Fowlicidin-1, a Cathelicidin Family of Antimicrobial and Antiendotoxic Peptide from Chicken, Determined by Transferred Nuclear Overhauser Effect Spectroscopy",\N
15981,"15981","2009-02-09",\N,"Solution NMR Structure of Cgi121 from Methanococcus jannaschii. Northeast Structural Genomics Consortium Target MJ0187",\N
15983,"15983","2009-04-02",\N,"NMR SOLUTION STRUCTURE FOR ShK-192: A POTENT KV1.3-SPECIFIC IMMUNOSUPPRESSIVE POLYPEPTIDE",\N
15986,"15986","2009-02-18",\N,"Chemical Shift Assignments of the Fibronectin 8-9FnI Domain Pair in Complex with a Type-I Collagen Peptide",\N
15987,"15987","2009-10-16","2009-11-17","NMR structure of plasmid copy control protein ORF56 from sulfolobus islandicus",\N
15988,"15988","2009-02-09",\N,"NULL",\N
15989,"15989","2009-04-04","2010-04-15","Solution NMR structure of the R2R3 DNA binding domain of Myb1 protein from protozoan parasite Trichomonas vaginalis",\N
15990,"15990","2009-05-29","2009-06-17","Structure of the Core Binding Domain of sigma54",\N
15991,"15991","2009-05-29","2009-06-17","Structure of the Core Binding Domain of sigma54",\N
15992,"15992","2012-07-19",\N,"Solution structure of Vm24 synthetic scorpion toxin.",\N
15993,"15993","2009-04-03",\N,"1H-15N Backbone Chemical shifts Of the C-terminal part of the Phosphoprotein (XD) of Measle Virus",\N
15994,"15994","2009-04-03",\N,"1H-15N Backbone Chemical shifts Of the C-terminal part of the Phosphoprotein (XD) of Measle Virus in complex with C-terminal Part of the Nucleoprotein (Ntail)",\N
15995,"15995","2009-05-18","2009-06-11","Structure of TM1_TM2 in LPPG micelles",\N
15996,"15996","2009-01-15","2009-08-20","1H, 15N and 13C resonance assignment of the pair of Factor-I like modules of the complement protein C7",\N
15997,"15997","2010-05-06","2010-09-16","NMR STRUCTURE OF DIMERIZATION DOMAIN OF HUMAN RIBOSOMAL PROTEIN P2",\N
15998,"15998","2009-07-17","2009-11-17","Chemical shifts of the b'-x region of human protein disulfide isomerase",\N
15999,"15999","2008-12-03","2009-07-23","Solution NMR structure of HTH_XRE family transcriptional regulator BT_p548217 from Bacteroides thetaiotaomicron. Northeast Structural Genomics Consortium Target BtR244.","/ftp/pub/bmrb/timedomain/bmr15999"
16000,"16000","2010-05-06","2010-09-08","Solution structure of the nucleocapsid-binding domain of the measles virus phosphoprotein",\N
16001,"16001","2008-11-07","2009-08-27","SOLUTION STRUCTURE OF DNA BINDING DOMAIN OF E. COLI ARAC",\N
16002,"16002","2009-04-04",\N,"cytoskeletal complex",\N
16003,"16003","2008-12-03",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for brain abundant protein 1 (BASP1)",\N
16005,"16005","2010-05-06",\N,"EphA2 dimeric structure in the lipidic bicelle at pH 5.0",\N
16006,"16006","2009-04-14","2011-05-20","NMR structure of the protein TM1112",\N
16007,"16007","2009-04-14","2011-05-20","NMR structure of the protein TM1367",\N
16008,"16008","2008-12-04","2014-05-20","Solution structure of the SARS-unique domain-C from the nonstructural protein 3 (nsp3) of the severe acute respiratory syndrome coronavirus",\N
16009,"16009","2009-01-15","2009-08-20","NMR resonance assignment of DnaE intein from Nostoc punctiforme",\N
16010,"16010","2010-10-18",\N,"How do Proteins Form Amyloid? Insight from the NMR Spectroscopic Characterization of 13C, 15N-labeled Ribonuclease A in 40% Acetic Acid",\N
16011,"16011","2010-10-18",\N,"NMR Spectroscopic Characterization of 13C, 15N-labeled Ribonuclease A in urea 8M",\N
16012,"16012","2009-05-20","2009-06-10","Solution NMR structure of BNIP3 transmembrane peptide dimer in detergent micelles",\N
16014,"16014","2009-02-16","2009-04-29","Structure of protein complex",\N
16015,"16015","2009-02-16","2009-04-29","Structure of protein complex",\N
16016,"16016","2012-07-19",\N,"NMR structure of TM0212 at 40 C",\N
16018,"16018","2009-04-14",\N,"Solution Structure of Hirsutellin A from Hirsutella thompsonii",\N
16019,"16019","2012-05-31",\N,"NMR Structure of the protein TM1081",\N
16020,"16020","2009-02-04","2010-02-04","Magic-Angle-Spinning Solid-State NMR Structure of Influenza A M2 Transmembrane Domain",\N
16021,"16021","2009-01-28","2009-08-20","NMR assignments of juvenile hormone binding protein in complex with JH III",\N
16022,"16022","2012-07-19",\N,"Tetramer of KIA7W peptide",\N
16023,"16023","2012-07-19",\N,"Tetramer of KIA7H peptide",\N
16024,"16024","2010-07-27","2010-09-16","NMR structrure of gallium subsituted ferredoxin",\N
16025,"16025","2009-04-14",\N,"Solution structure of the beta-E domain of wheat Ec-1 metallothionein",\N
16026,"16026","2009-04-17","2009-05-19","ENHANCING THE ACTIVITY OF INSULIN BY STEREOSPECIFIC UNFOLDING",\N
16027,"16027","2009-04-17","2009-05-19","ENHANCING THE ACTIVITY OF INSULIN BY STEREOSPECIFIC UNFOLDING",\N
16028,"16028","2012-07-19",\N,"NMR structure of delta-toxin from Staphylococcus aureus in CD3OH",\N
16029,"16029","2009-03-05",\N,"Solution NMR structure of ubiquitin-like domain of Arabidopsis thaliana protein At2g32350. Northeast Structural Genomics Consortium target AR3433A",\N
16030,"16030","2009-03-05",\N,"Solution structure of protein BPP2914 from Bordetella parapertussis. Northeast Structural Genomics Consortium target BpR206",\N
16031,"16031","2009-01-20","2009-03-04","Nav1.5 C-terminal EF-Hand Domain",\N
16032,"16032","2009-01-20","2009-03-04","Nav1.2 C-terminal EF-Hand Domain",\N
16033,"16033","2009-06-24","2009-11-17","Solution structure and dynamics of S100A5 in the apo states",\N
16034,"16034","2009-06-24","2009-11-17","Solution structure and dynamics of S100A5 in the Ca2+ -bound states",\N
16035,"16035","2009-07-22","2009-11-17","Sequence-specific 1H, 13C and 15N backbone resonance assignments of BamC, a component of the outer membrane protein assembly machinery in Escherichia coli",\N
16037,"16037","2009-03-31","2009-05-06","BlrP1 BLUF",\N
16038,"16038","2009-04-29",\N,"NMR Structure of the phosphorylated form of OdhI, pOdhI.",\N
16039,"16039","2009-04-29",\N,"NMR structure of the unphosphorylated form of OdhI, OdhI.",\N
16040,"16040","2009-11-02","2010-04-26","Solution structure of onconase C87A/C104A",\N
16041,"16041","2009-03-23","2009-04-29","FLNCCPGCCMEP_ReAsH_motif",\N
16042,"16042","2009-03-11","2009-08-20","human brain-type fatty acid binding protein (hb-FABP",\N
16043,"16043","2009-07-22","2009-11-17","The solution structure of Bacillus subtilis SR211 by NMR spectroscopy",\N
16044,"16044","2009-04-16","2009-08-20","N-terminal backbone assignment of the polyoma virus large T antigen",\N
16045,"16045","2009-02-09","2009-03-04","1H, 13C, and 15N Chemical Shift Assignments for the C-terminal EF-Hand domain of human cardiac sodium channel NaV1.5",\N
16046,"16046","2009-03-11","2009-08-20","human brain-type fatty acid binding protein (hb-FABP bound to docosahexaenoic acid (DHA))",\N
16047,"16047","2009-03-11","2009-08-20","human brain-type fatty acid binding protein (hb-FABP bound to elaidic acid",\N
16048,"16048","2009-03-11","2009-08-20","human brain-type fatty acid binding protein (hb-FABP bound to oleic acid (OLA))",\N
16049,"16049","2009-03-11","2009-08-20","human brain-type fatty acid binding protein (hb-FABP bound to linoleic acid (LNA))",\N
16050,"16050","2009-04-04","2009-05-22","Ca-S100A1 interacting with TRTK12",\N
16051,"16051","2011-02-24",\N,"Solution NMR structure of the OB domain (residues 67-166) of MM0293 from Methanosarcina mazei. Northeast Structural Genomics Consortium target MaR214a.","/ftp/pub/bmrb/timedomain/bmr16051"
16052,"16052","2009-03-23","2013-07-26","Assignment of 1HN, 13C, and 15N chemical shift resonances for the STAS domain of Rv1739c, a putative sulfate transporter of Mycobacterium tuberculosis",\N
16053,"16053","2009-03-20",\N,"Attachment of an NMR-invisible solubility enhancement tag (INSET) using a sortase-mediated protein ligation method",\N
16054,"16054","2009-04-16","2010-07-19","Dimeric solution structure of the DNA loop d(TGCTTCGT)",\N
16055,"16055","2009-04-17","2010-07-19","Dimeric solution structure of the cyclic octamer d(pCGCTCCGT)",\N
16056,"16056","2009-01-21","2009-04-22","STRUCTURAL AND FUNCTIONAL ANALYSIS OF TM XI OF THE NHE1 ISOFORM OF THE NA+/H+ EXCHANGER",\N
16057,"16057","2009-05-20","2009-06-02","NMR structure of protein gp15 of bacteriophage SPP1",\N
16058,"16058","2009-02-09","2009-04-30","SOLUTION STRUCTURE OF THE FACTOR H BINDING PROTEIN",\N
16059,"16059","2009-01-15","2009-08-20","Paramecium bursaria Chlorella virus 1 (PBCV1) DNA ligase (holo form)",\N
16060,"16060","2009-05-20","2009-07-13","Loop 3 of Short Neurotoxin II is an Additional Interaction Site with Membrane-Bound Nicotinic Acetylcholine Receptor as Detected by Solid-State NMR Spectroscopy",\N
16061,"16061","2009-04-14","2009-08-20","Solution Structure of HybE from Escherichia coli",\N
16062,"16062","2009-07-23",\N,"NMR solution structure of the pheromone En-1 of Euplotes nobilii at -1.5 C",\N
16063,"16063","2009-04-16",\N,"Solution structure of ILK/PINCH complex",\N
16064,"16064","2009-05-07","2009-06-09","Solution NMR structure of Bacteroides fragilis protein BF1650. Northeast Structural Genomics Consortium target BfR218","/ftp/pub/bmrb/timedomain/bmr16064"
16065,"16065","2009-04-22","2009-05-19","Structure of E. coli toxin RelE(R81A/R83A)mutant in complex with antitoxin RelBc (K47-L79) peptide",\N
16066,"16066","2009-04-22","2009-05-19","Structure of E. coli toxin RelE(R81A/R83A) mutant in the free state",\N
16067,"16067","2009-04-22","2009-05-19","Backbone assignment of RelB antitoxin C-terminal peptide (RelBc) in the RelE-free state",\N
16068,"16068","2009-05-20","2009-06-02","gp16",\N
16069,"16069","2009-02-04","2009-11-17","Resonance assignments for PilZ from Xanthomonas citri",\N
16070,"16070","2009-03-03",\N,"Apo Pin1 WW Domain",\N
16071,"16071","2009-06-26","2009-08-27","Mouse prion protein fragment 90-231 at pH 7.0",\N
16072,"16072","2009-02-17","2009-06-05","Solution NMR structure of SSP0047 from Staphylococcus saprophyticus. Northeast Structural Genomics Consortium Target SyR6.","/ftp/pub/bmrb/timedomain/bmr16072"
16073,"16073","2009-09-04",\N,"Solution structure of cycloviolacin O2",\N
16074,"16074","2009-09-04",\N,"Solution structure of micelle-bound kalata B2",\N
16075,"16075","2009-06-26","2009-08-27","Mouse prion protein fragment mPrP[M129V](91-231) at pH 7.0",\N
16076,"16076","2009-06-26","2009-08-27","Mouse prion protein fragment mPrP[P102L](91-231) at pH 7.0",\N
16077,"16077","2009-06-26","2009-08-27","Mouse prion protein fragment mPrP[P105L](91-231) at pH 7.0",\N
16078,"16078","2009-06-26","2009-08-27","Mouse prion protein fragment mPrP[A117V](90-231) at pH 7.0",\N
16079,"16079","2009-06-26","2009-08-27","Mouse prion protein fragment mPrP[A113V,A115V,A118V](90-231) at pH 7.0",\N
16080,"16080","2009-06-26","2009-08-27","Mouse prion protein fragment mPrP[K119I,H111I](90-231) at pH 7.0",\N
16082,"16082","2010-01-07","2014-05-20","solution structure of FAPP1 PH domain",\N
16083,"16083","2009-01-13",\N,"Northeast Structural Genomics Consortium (NESG), target MrR121A",\N
16084,"16084","2009-01-09","2009-06-09","SOLUTION STRUCTURE OF TETRATRICOPEPTIDE REPEAT DOMAIN PROTEIN SRU_0103 FROM SALINIBACTER RUBER, NORTHEAST STRUCTURAL GENOMICS CONSORTIUM (NESG) TARGET SrR115C","/ftp/pub/bmrb/timedomain/bmr16084"
16085,"16085","2009-04-16","2009-08-20","1H, 13C, 15N Chemical Shift Assignment for Saccharomyces cerevisiae Acyl Carrier Protein.",\N
16087,"16087","2009-05-29",\N,"Solution structure of the antifungal protein PAF from Penicillium chrysogenum",\N
16088,"16088","2009-03-06",\N,"Apo Pin1 WW Domain",\N
16089,"16089","2010-09-24",\N,"Solution NMR structure of ribosomal protein sso0164 from Sulfolobus solfataricus. NortheastStructural Genomics Consortium (NESG) target SsT4",\N
16090,"16090","2009-04-22","2009-05-19","NMR Structure of a Monomeric Folding Intermediate Reveals the Structural Basis for Rapid Assembly of an Evolutionary Optimized Trimerization Module",\N
16091,"16091","2009-02-17","2009-06-05","SOLUTION STRUCTURE OF 30S RIBOSOMAL PROTEIN S8E; FROM Methanothermobacter thermautotrophicus, NORTHEASTSTRUCTURAL GENOMICS CONSORTIUM (NESG) TARGET TR71D","/ftp/pub/bmrb/timedomain/bmr16091"
16093,"16093","2009-03-05","2009-06-05","Solution structure of protein SRU_2040 from Salinibacter ruber (strain DSM 13855). Northeast Structural Genomics Consortium target SrR106","/ftp/pub/bmrb/timedomain/bmr16093"
16094,"16094","2009-06-26","2009-09-02","solution structure of anntoxin",\N
16096,"16096","2009-05-07","2012-04-26","SOLUTION NMR STRUCTURE OF THE OB-FOLD DOMAIN OF HEME CHAPERONE CCME FROM DESULFOVIBRIO VULGARIS. NORTHEAST STRUCTURAL GENOMICS TARGET DVR115G.","/ftp/pub/bmrb/timedomain/bmr16096"
16097,"16097","2009-03-05",\N,"NMR solution structure of an uncharacterized protein from Chlorobium tepidum. Northeast Structural Genomics target CtR107","/ftp/pub/bmrb/timedomain/bmr16097"
16098,"16098","2009-04-17","2009-05-06","Solution structure of Apo-form YjaB from Escherichia coli",\N
16099,"16099","2010-09-17",\N,"Solution NMR Structure of KAZAL-1 domain from Human Follistatin-related protein 3 (FSTL-3). Northeast Structural Genomics Target HR6186A.","/ftp/pub/bmrb/timedomain/bmr16099"
16100,"16100","2009-02-19",\N,"Solution NMR Structure of the C-Terminal Domain of Protein DR_A0006 from Deinococcus radiodurans, Northeast Structural Genomics Consortium Target DrR147D","/ftp/pub/bmrb/timedomain/bmr16100"
16101,"16101","2009-02-19","2009-06-05","NMR solution Structure of O64736 protein from Arabidopsis thaliana:Northeast Structural Genomics Consortium MEGA Target AR3445A","/ftp/pub/bmrb/timedomain/bmr16101"
16102,"16102","2009-02-19","2009-06-05","Solution NMR Structure of the Integrase-Like Domain from Bacillus cereus Ordered Locus BC_1272. Northeast Structural Genomics Target BcR268F","/ftp/pub/bmrb/timedomain/bmr16102"
16103,"16103","2009-04-22",\N,"1H, 13C, and 15N chemical shift assignments for murine FAIM-CTD",\N
16104,"16104","2009-03-17","2009-04-30","THE DYNAMIC ALPHA-HELIX STRUCTURE OF MICELLE-BOUND HUMAN AMYLIN.",\N
16105,"16105","2009-03-17","2009-04-30","THE DYNAMIC ALPHA-HELIX STRUCTURE OF MICELLE-BOUND HUMAN AMYLIN.",\N
16107,"16107","2009-03-02",\N,"Solution NMR structure of F5/8 type C-terminal domain of a putative chitobiase from Bacteroides thetaiotaomicron. Northeast Structural Genomics Consortium target BtR324B",\N
16108,"16108","2009-03-10","2009-08-20","Backbone and side-chain assignment of the lipidated and non-lipidated forms of the meningococcal outer membrane protein LP2086",\N
16109,"16109","2009-05-26",\N,"Solution Structure of human ubiquitin-like domain of Herpud2_9_85, Northeast Structural Genomics Consortium (NESG) target HT53A",\N
16110,"16110","2009-06-25","2009-08-07","Solution structure of the conserved C-terminal dimerization domain of Borealin",\N
16111,"16111","2009-03-17","2010-04-15","Sequence-specific 1H, 15N and 13C resonance assignments of Art v 1: a proline-rich allergen of Artemisia vulgaris pollen",\N
16112,"16112","2009-05-29","2009-06-24","Solution structure of a K+-channel voltage-sensor paddle motif",\N
16113,"16113","2009-03-02","2009-07-23","H, 13C, and 15N Chemical Shift Assignments of Protein yppE from Bacillus subtilis. Northeast Structural Genomics Consortium Target SR213","/ftp/pub/bmrb/timedomain/bmr16113"
16114,"16114","2010-02-11","2010-03-05","Solution structure of a Ubiquitin/UIM fusion protein",\N
16115,"16115","2011-06-01",\N,"Solution Structure of an SH3-like Domain from p80-Coilin",\N
16116,"16116","2010-01-12","2010-01-25","NMR structures of GA95 and GB95, two designed proteins with 95% sequence identity but different folds and functions",\N
16117,"16117","2010-01-12","2011-08-30","NMR structures of GA95 and GB95, two designed proteins with 95% sequence identity but different folds and functions",\N
16118,"16118","2009-03-05","2009-07-17","Solution structure of PFE0790c, a putative bolA-like protein from the protozoan parasite Plasmodium falciparum: A Structural Genomics Center for Infectious Disease (SSGCID) community request.",\N
16119,"16119","2010-01-11","2010-02-23","Structure of the human Shwachman-Bodian-Diamond syndrome protein, SBDS",\N
16120,"16120","2009-04-14","2009-08-20","Sequence-specific 1H, 13C, and 15N resonance assignment of the Autophagy-related Protein Atg 8",\N
16121,"16121","2009-05-20","2009-06-17","Structure of Archaeal L14e Ribosomal Protein from Sulfolobus sulfataricus",\N
16122,"16122","2009-04-17","2009-05-27","HCV NS4B(227-254)",\N
16123,"16123","2012-08-07",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for d+PHS/V66K SNase",\N
16124,"16124","2009-05-07","2009-08-20","Solution structure of RppH from Escherichia coli",\N
16126,"16126","2009-07-08","2009-08-07","Solution structure of HypA protein",\N
16127,"16127","2009-02-23","2009-04-30","Solution Structure of the SAP30 zinc finger motif",\N
16129,"16129","2009-05-06","2009-05-22","The NMR structure of the TC10 and Cdc42 interacting domain of CIP4",\N
16130,"16130","2009-03-30","2009-05-06","Backbone 1H, 13C, and 15N Chemical Shift Assignments for colicinN Tdomain residues 40-76 in complex with unlabbeled TolAIII",\N
16131,"16131","2009-03-30","2009-05-06","Backbone 1H, 13C, and 15N Chemical Shift Assignments for the Colicin N Tdomain residues 40-76",\N
16133,"16133","2009-04-22","2009-05-06","Backbone 1H, 13C, and 15N Chemical Shift Assignments for TolAIII residues 296-421",\N
16134,"16134","2009-04-17","2009-05-06","Backbone 1H, 13C, and 15N Chemical Shift Assignments for tolaIII residues296-421in complex with unlabelled colicin N Tdomain",\N
16135,"16135","2009-04-14","2010-04-16","Sequence-specific 1H, 15N, and 13C resonance assignments of the 23.7 kDa homodimeric toxin CcdB from Vibrio fischeri.",\N
16136,"16136","2011-07-08","2011-07-18","NMR assignment of jerdostatin from Trimeresurus jerdonii",\N
16137,"16137","2009-10-20",\N,"NMR structure of the first SAM domain from AIDA1",\N
16138,"16138","2012-08-07",\N,"NMR solution structure of metal-modified DNA",\N
16139,"16139","2012-08-07",\N,"NMR solution structure of the CASKIN SH3 domain",\N
16140,"16140","2010-01-11","2010-05-20","[Sec13,Sec14]-kappa-hexatoxin-Hv1c",\N
16141,"16141","2012-08-07",\N,"NMR solution structure of the HACS1 SH3 domain",\N
16142,"16142","2009-06-25",\N,"Structure of SDF-1/CXCL12",\N
16143,"16143","2009-06-25",\N,"Structure of SDF-1/CXCL12",\N
16144,"16144","2009-01-30","2009-11-17","Backbone and side chain 1H, 13C, and 15N NMR assignments for the organic hydroperoxide resistance protein (Ohr) from Burkholderia pseudomallei, Seattle Structural Genomics Center for Infectious Disease (SSGCID) target BupsA.00074",\N
16145,"16145","2009-06-25",\N,"Structure of SDF-1/CXCL12",\N
16146,"16146","2009-11-23","2010-05-20","Backbone resonance assignment of Staphylococcal Enterotoxin H",\N
16147,"16147","2009-05-13","2009-11-17","NMR assignments of oxidised thioredoxin from Plasmodium falciparum",\N
16148,"16148","2009-06-25","2009-08-10","NMR structure of Plantaricin K in DPC-micelles",\N
16149,"16149","2009-06-25","2009-08-10","Plantaricin K in TFE",\N
16150,"16150","2012-08-07","2014-05-20","NMR assignment of jerdostatin mutant R24K from Trimeresurus jerdonii",\N
16151,"16151","2012-08-07","2014-05-20","NMR assignment of jerdostatin from Trimeresurus jerdonii, with deletion of two residues (N45 G46) from the C-terminal end",\N
16152,"16152","2012-08-07","2014-05-20","NMR assignment of jerdostatin mutant R24K from Trimeresurus jerdonii, with deletion of two residues (N45 G46) from the end C-terminal",\N
16153,"16153","2009-06-26","2009-09-02","Structure of the transcription repressor SvtR08 (gp08) from the hyperthermophilic archaeal virus SIRV1",\N
16154,"16154","2009-03-05",\N,"Solution NMR structure of the OB domain (residues 67-166) of MM0293 from Methanosarcina mazei. Northeast Structural Genomics Consortium target MaR214a.",\N
16155,"16155","2009-03-12",\N,"Solution NMR structure of protein HS00059 from Homo Sapiens. Northeast Structural Genomics Consortium (NESG) target HT98A.",\N
16156,"16156","2009-03-05",\N,"Solution Structure of the Coiled-coil Domain of Synphilin-1",\N
16157,"16157","2009-03-30",\N,"alpha-amylase inhibitor Parvulustat (Z-2685) from Streptomyces parvulus",\N
16158,"16158","2009-10-07","2010-01-21","Beta1D Integrin Cytoplasmic Tail 1H and 15N Chemical Shift Assignments",\N
16159,"16159","2009-10-07","2010-01-21","Beta1A Integrin Cytoplasmic Tail 1H and 15N Chemical Shift Assignments",\N
16160,"16160","2012-08-07",\N,"1H, 13C, and 15N Chemical Shift Assignments for Myosin Phosphatase Trageting Subunit 1 (residues 1-98)",\N
16161,"16161","2009-03-12","2009-04-13","Solution NMR Structure of a domain from a Putative Phage Integrase Protein BF2284 from Bacteroides fragilis, Northeast Structural Genomics Consortium Target BfR257C",\N
16162,"16162","2009-10-07","2010-01-21","Beta1D Integrin Cytoplasmic Tail (Polyhistidine-Tagged) 1H and 15N Chemical Shift Assignments",\N
16163,"16163","2009-10-16","2009-12-01","NMR structure of the N-terminal domain of kindlin1",\N
16164,"16164","2009-10-16","2010-02-09","Solution structure of XcpT, the main component of the type 2 secretion system of Pseudomonas aeruginosa",\N
16165,"16165","2009-03-20",\N,"1H, 15N and 13C backbone resonance assignments of domain 2 (D2) of the non-structural 5A protein (NS5A) from the JFH1 Hepatitis C virus (HCV) strain.",\N
16166,"16166","2009-03-20",\N,"1H, 15N and 13C backbone resonance assignments of domain 3 of the non-structural 5A (NS5A) protein from Hepatitis C Virus (Con1)",\N
16167,"16167","2009-03-12",\N,"NMR data for FXYD4 in micelles",\N
16168,"16168","2009-03-06","2009-03-10","STRUCTURE OF THE NA,K-ATPASE REGULATORY PROTEIN FXYD1 IN MICELLES",\N
16169,"16169","2009-09-04",\N,"Barnase low pressure reference",\N
16170,"16170","2009-09-04",\N,"Barnase high pressure structure",\N
16171,"16171","2009-09-04",\N,"Barnase bound to d(CGAC), low pressure",\N
16172,"16172","2009-09-04",\N,"Barnase bound to d(CGAC) high pressure",\N
16173,"16173","2009-03-30","2009-05-19","The structure of the cataract causing P23T mutant of human gamma-D crystallin",\N
16174,"16174","2009-07-22","2009-11-17","15N, 13C and 1H resonance assignments for the Rv0287-Rv0288 complex",\N
16175,"16175","2009-07-10","2009-11-17","Backbone assignments for odorant binding protein 1",\N
16176,"16176","2009-08-10","2009-11-17","Prp40 FF4 domain",\N
16177,"16177","2009-08-10","2010-07-26","Backbone and sidechain chemical shift assignments for E73 from SSV-RH",\N
16178,"16178","2012-08-07",\N,"MeVamp-4",\N
16179,"16179","2009-10-16","2010-01-21","Structure of the C-terminal domain of EHD1 with FNYESTNPFTAK",\N
16180,"16180","2009-10-16","2010-01-21","Structure of the C-terminal domain of EHD1 in complex with FNYESTNPFTAK",\N
16181,"16181","2009-10-16","2010-05-20","Structure of the C-terminal domain of EHD1 with FNYESTGPFTAK",\N
16182,"16182","2010-10-18",\N,"The solution conformation of the leader sequence of the prepropeptide for the microcin-like patellamides",\N
16183,"16183","2009-05-20","2010-10-18","Tammar Wallaby Prion Protein (121-230)",\N
16184,"16184","2009-05-20",\N,"Mouse Prion Protein (121-231) with Mutations Y225A and Y226A",\N
16185,"16185","2009-05-20",\N,"Mouse Prion Protein (121-231) with Mutation V166A",\N
16186,"16186","2009-03-05","2009-06-09","Solution NMR structure of PSPTO_3016 from Pseudomonas syringae. Northeast Structural Genomics Consortium target PsR293.","/ftp/pub/bmrb/timedomain/bmr16186"
16187,"16187","2009-04-17",\N,"Backbone 1H Chemical Shift Assignments for FP1",\N
16188,"16188","2009-05-29","2009-07-13","NMR structure of Rv2175c",\N
16189,"16189","2010-11-10",\N,"Structure of the amino-terminal domain of human FK506-binding protein 3 / Northeast Structural Genomics Consortium Target HT99A",\N
16190,"16190","2009-05-20","2009-06-17","Structure of the N-terminal domain of human cardiac troponin C bound to calcium ion and to the inhibitor W7",\N
16191,"16191","2009-04-16","2010-04-15","NMR-Assignments of a Cytosolic Domain of the C-Terminus of Polycystin-2",\N
16192,"16192","2010-06-15","2010-07-09","NMR structure of the first qRRM of hnRNP F in complex with AGGGAU G-tract RNA",\N
16193,"16193","2010-06-15","2010-07-09","Structure of the second qRRM domain of hnRNP F in complex with a AGGGAU G-tract RNA",\N
16194,"16194","2010-06-15","2010-07-09","Structure of the third qRRM domain of hnRNP F in complex with a AGGGAU G-tract RNA",\N
16195,"16195","2009-08-10","2009-11-25","Resonance assignments of the human AKAP13 PH domain and stabilizing DH helix",\N
16196,"16196","2009-04-17","2012-10-05","Solution Structure of the acetyl Actinorhodin Acyl Carrier Protein from Streptomyces coelicolor",\N
16197,"16197","2009-04-17","2012-10-05","NMR Solution Structures of malonyl ACP from the actinorhodin polyketide synthase in Streptomyces coelicolor",\N
16198,"16198","2010-11-19",\N,"1H, 13C and 15N backbone and side chain chemical shift assignments of N-terminal domain of Tim23.",\N
16199,"16199","2009-04-22","2012-10-05","NMR Solution Structures of butyryl-ACP (a non-polar, non pathway intermediate) from the actinorhodin polyketide synthase in Streptomyces coelicolor",\N
16200,"16200","2009-04-17","2012-10-05","NMR Solution Structures of hexanoyl ACP (a non natural intermediate) from the actinorhodin polyketide synthase in Streptomyces coelicolor",\N
16201,"16201","2009-04-17","2012-10-05","NMR Solution Structures of octanoyl ACP (a non-natural intermediate) from the actinorhodin polyketide synthase in Streptomyces coelicolor",\N
16202,"16202","2009-04-22","2012-10-05","NMR Solution Structures of 3-oxo-butyl-ACP, an intermediate mimic from the actinorhodin polyketide synthase in Streptomyces coelicolor",\N
16203,"16203","2009-04-22","2012-10-05","NMR Solution Structures of 3,5-dioxohexyl ACP (a triketide mimic) from the actinorhodin polyketide synthase in Streptomyces coelicolor",\N
16204,"16204","2010-01-11","2010-05-20","Backbone 1H, 13C, and 15N Chemical Shift Assignments for apo HisJ and holo HisJ",\N
16205,"16205","2010-01-11","2010-05-20","Backbone 1H, 13C, and 15N Chemical Shift Assignments for apo HisJ and holo HisJ",\N
16206,"16206","2009-03-30","2009-05-22","THE RRM DOMAIN IN GW182 PROTEINS CONTRIBUTES TO MIRNA-MEDIATED GENE SILENCING",\N
16207,"16207","2010-09-10","2010-10-14","NmerA",\N
16208,"16208","2010-09-10","2010-10-14","NmerAHg",\N
16209,"16209","2009-05-29","2009-06-05","Solution Structure of JARID1A C-terminal PHD finger",\N
16210,"16210","2009-05-29","2009-06-05","Solution structure of JARID1A C-terminal PHD finger in complex with H3(1-9)K4me3",\N
16211,"16211","2009-11-05","2010-01-21","Solution structure of putative prolyl isomerase PpiD from E.Coli",\N
16212,"16212","2009-04-23","2010-07-19","Dimeric solution structure of the DNA loop d(TCGTTGCT)",\N
16213,"16213","2010-06-28","2010-08-12","A Complete NMR Spectral Assignment of the MESD Protein",\N
16214,"16214","2009-04-14",\N,"Zn finger protein YBIL from E.Coli; NESG target ET107; OCSP target EC0402","/ftp/pub/bmrb/timedomain/bmr16214"
16215,"16215","2013-01-28","2013-07-16","Refined solution structure of des-pyro Glu brazzein",\N
16216,"16216","2009-04-23","2009-06-05","Solution structure of protein ITSN1 from Homo sapiens. Northeast Structural Genomics Consortium target HR5524A","/ftp/pub/bmrb/timedomain/bmr16216"
16217,"16217","2012-08-06",\N,"Backbone 1H, 13CA, and 15N Chemical Shifts Assignments and 15N T1 and T2 Relaxation Parameters for the N-terminal (1-119) Fragment of sperm whale apomyoglobin",\N
16218,"16218","2012-08-06",\N,"Backbone 1H, 13CA, and 15N Chemical Shifts Assignments and 15N T1 and T2 Relaxation Parameters for the N-terminal (1-119) Fragment of sperm whale apomyoglobin in the presence of DnaK-beta",\N
16219,"16219","2009-10-16","2009-11-18","Solution structure of SH3 domain of PTK6",\N
16221,"16221","2009-06-02","2009-06-24","Backbone 1H, 13C, and 15N Chemical Shift Assignments for Collagen Binding domain of MMP2",\N
16222,"16222","2009-11-23","2010-07-16","NMR Structure of Aflatoxin Formamidopyrimidine alpha-anomer in duplex DNA",\N
16223,"16223","2009-11-23","2010-07-20","Aflatoxin Formamidopyrimidine alpha anomer in single strand DNA",\N
16225,"16225","2010-05-27","2010-07-16","Solution Structure of cis-5R,6S-thymine glycol opposite complementary adenine in duplex DNA",\N
16226,"16226","2009-11-05","2010-07-16","Solution Structure of cis-5R,6S-thymine glycol opposite complementary guanine in duplex DNA",\N
16228,"16228","2009-07-17","2012-09-19","1H, 13C, and 15N chemical shift assignments for stereo-array labeled (SAIL) ubiquitin",\N
16229,"16229","2010-12-09",\N,"1H, 13C, and 15N Chemical Shift Assignments for ring1B C-terminal domain/ cbx7 CBOX complex",\N
16230,"16230","2009-09-04","2009-11-19","Solution Structure of Yeast Prp24-RRM2 Bound to a Fragment of U6 RNA",\N
16231,"16231","2012-08-06",\N,"Solution Structure of a Pathogen Recognition Domain from a Lepidopteran Insect, Plodia interpunctella",\N
16233,"16233","2009-05-20","2009-11-24","1H, 13C, 15N Chemical Shift Assignments for Eimeria tenella microneme protein 3 mar1a domain",\N
16234,"16234","2009-06-17","2011-08-16","Relaxation data of the N-terminal domain of capsid protein from the Mason-Pfizer monkey virus",\N
16235,"16235","2010-01-12",\N,"Solution structure of linear kalata B1 (loop 6)",\N
16236,"16236","2009-11-23","2010-01-21","Bruno RRM3+",\N
16237,"16237","2011-06-01",\N,"Solution structure of the amino-terminal domain of OmpATb, a pore forming protein from Mycobacterium tuberculosis.",\N
16238,"16238","2009-05-07","2009-06-09","Solution NMR structure of VC_A0919 from Vibrio cholerae. Northeast Structural Genomics Consortium Target VcR52.","/ftp/pub/bmrb/timedomain/bmr16238"
16239,"16239","2009-06-25","2009-08-10","Plantaricin J in DPC-micelles",\N
16240,"16240","2009-09-24","2009-11-25","Solution structure of full-length SlyD from E.coli",\N
16241,"16241","2009-06-25","2009-08-10","Plantaricin J in TFE",\N
16243,"16243","2009-09-04","2009-11-18","Backbone NH Assignments for Prp24-RRM23",\N
16244,"16244","2009-09-04","2009-11-18","Backbone NH Assignments for Prp24-RRM23 Bound to AGAGAU RNA",\N
16245,"16245","2009-04-13",\N,"Assignment of the 1H and 15N Resonances of Escherichia coli IscU.",\N
16246,"16246","2009-09-04","2009-11-19","Resonance Assignments for Yeast Prp24-RRM2",\N
16247,"16247","2009-10-16","2010-02-11","NMR solution structure of the b30-82 domain of subunit b of Escherichia coli F1FO ATP synthase",\N
16248,"16248","2009-05-20",\N,"PknB-phosphorylated Rv1827",\N
16249,"16249","2010-05-07","2010-05-20","The carboxy-terminal non-repetitive domain of a spider dragline silk protein regulates nucleation of silk assembly",\N
16250,"16250","2009-06-11",\N,"NMR solution structure of the EH 1 domain from human intersectin-1 protein. Northeast Structural Genomics Consortium target HR3646e.","/ftp/pub/bmrb/timedomain/bmr16250"
16251,"16251","2009-06-23",\N,"Solution NMR structure of a phage integrase SSP1947 fragment 59-159 from Staphylococcus saprophyticus, Northeast Structural Genomics Consortium Target SyR103B","/ftp/pub/bmrb/timedomain/bmr16251"
16252,"16252","2009-07-10","2009-11-18","1H, 13C, 15N Chemical shift assignments of A13 homeodomain",\N
16253,"16253","2009-05-20","2010-08-12","NMR chemical shift assignments for Rv2377c, a MbtH-like protein from Mycobacterium tuberculosis: A Structural Genomics Center for Infectious Disease (SSGCID) community request",\N
16254,"16254","2010-01-12","2010-02-11","NMR Structure of human alpha defensin HNP-1",\N
16255,"16255","2009-05-20","2009-06-24","Solution Structure Of Protein Nmul_A0922 From Nitrosospira multiformis. Northeast Structural Genomics Consortium Target Hr5524a.","/ftp/pub/bmrb/timedomain/bmr16255"
16256,"16256","2010-04-01","2010-11-03","Drosha RNA Binding Domain",\N
16257,"16257","2010-05-19",\N,"Nogo66 at pH4.0",\N
16258,"16258","2009-09-04","2010-01-21","Solution Structure of RCL",\N
16259,"16259","2009-12-11","2010-01-21","Beta7 Integrin Cytoplasmic Tail 1H and 15N Chemical Shift Assignments",\N
16260,"16260","2009-10-16","2009-11-25","NMR assignments of FK506 binding domain from Plasmodium vivax",\N
16261,"16261","2009-07-22","2009-11-18","1H, 15N, 13C assignments of the Riphicephalus (Boophilus) microplus antimicrobial protein microplusin",\N
16262,"16262","2012-08-06",\N,"NMR solution structure of the N-terminal domain of the DNA polymerase alpha p68 subunit",\N
16263,"16263","2009-07-23","2010-04-15","Backbone and sidechain 1H, 15N and 13C assignments of the NLRP7 Pyrin domain",\N
16264,"16264","2009-07-14","2009-07-16","Solution structure of Glutaredoxin from Brucella melitensis. Seattle Structure Genomics Center for Infectious Disease (SSGCID) (Target ID BrabA.00079.a)",\N
16265,"16265","2009-05-29","2009-06-24","Complete backbone 15N, 13C and 1H resonance assignments for the oxidized form of the N-terminal domain of AhpF",\N
16266,"16266","2009-09-11","2009-11-18","Solution Structure of RPP29-RPP21 complex from Pyrococcus furiosis",\N
16267,"16267","2009-06-11","2009-06-23","Solution NMR structure of tungsten formylmethanofuran dehydrogenase subunit D from Archaeoglobus fulgidus, Northeast Structural Genomics Consortium target AtT7","/ftp/pub/bmrb/timedomain/bmr16267"
16268,"16268","2009-05-22",\N,"Human cannabinoid receptor-2 helix 6",\N
16269,"16269","2012-08-06",\N,"n-NafY. N-terminal domain of NafY",\N
16270,"16270","2009-07-16","2011-01-05","SOLUTION STRUCTURE OF THE S. AUREUS SORTASE A-SUBSTRATE COMPLEX",\N
16271,"16271","2009-06-25","2009-07-13","A PH domain within OCRL bridges clathrin mediated membrane trafficking to phosphoinositide metabolis",\N
16272,"16272","2010-03-09",\N,"Solution NMR structure of an O6-methylguanine DNA methyltransferase family protein from Vibrio parahaemolyticus. Northeast Structural Genomics Consortium target VpR247.","/ftp/pub/bmrb/timedomain/bmr16272"
16273,"16273","2009-06-25","2009-07-13","A PH domain within OCRL bridges clathrin mediated membrane trafficking to phosphoinositide metabolism",\N
16274,"16274","2012-08-06","2014-05-20","SLBP PAPA peptide",\N
16275,"16275","2009-08-04","2009-11-05","Apelin17 bound to DPC micelles",\N
16276,"16276","2010-05-06",\N,"NMR structure of the SO2144 H-NOX domain from Shewanella oneidensis in the Fe(II)CO ligation state",\N
16277,"16277","2009-09-04",\N,"Solution structure of the Actuator domain of the copper-transporting ATPase ATP7A",\N
16278,"16278","2010-05-06",\N,"NMR structure of the H103G mutant SO2144 H-NOX domain from Shewanella oneidensis in the Fe(II)CO ligation state",\N
16279,"16279","2011-08-31","2014-05-20","Backbone 1H, 13C, and 15N Chemical Shift Assignments for the yeast Hsp90 Middle Domain",\N
16280,"16280","2010-01-28","2010-07-20","d(GAGCTC)2 assignments",\N
16281,"16281","2010-01-28","2010-07-20","d(GAGCTC)2 plus dqdppn",\N
16282,"16282","2010-01-28","2010-07-20","d(AGAGCTCT)2 assignments",\N
16283,"16283","2010-09-17",\N,"1.7-mm microcryoprobe solution NMR structure of an O6-methylguanine DNA methyltransferase family protein from Vibrio parahaemolyticus. Northeast Structural Genomics Consortium target VpR247.","/ftp/pub/bmrb/timedomain/bmr16283"
16284,"16284","2010-12-02",\N,"NMR structure of the oxidized yeast TOR1 FATC domain bound to DPC micelles at 318K",\N
16285,"16285","2012-08-06",\N,"Solution structure of a PDZ protein",\N
16286,"16286","2010-01-28","2010-07-20","d(CGAGCTCG)2 assignments",\N
16287,"16287","2010-01-28","2010-07-20","d(AGAGCTCT)2 plus dqdppn 1:2 assignments",\N
16288,"16288","2010-01-28","2010-07-20","d(CGAGCTCG)2 plus dqdppn 1:2 assignments",\N
16289,"16289","2010-01-28","2010-07-20","d(GCTATAGC)2 assignments",\N
16290,"16290","2010-01-28","2010-07-20","d(GCTATAGC)2 1:1 complex with dqdppn assignments",\N
16291,"16291","2010-02-01","2010-07-19","d(AGAGCTCT)2 plus Ru ligand 1:2 assignments",\N
16292,"16292","2010-02-01","2010-07-19","d(CGAGCTCG)2 plus Ru ligand 1:2 assignments",\N
16293,"16293","2009-09-04","2009-11-18","Solution structure of CA150 FF1 domain and FF1-FF2 interdomain linker",\N
16294,"16294","2010-03-01","2010-05-20","1H (NH, HA, HB, other) Chemical Shift Assignments of Peach Pru p 3, Non-Specific Lipid Transfer Protein (nsLTP) isolated from Peach fruit skin",\N
16295,"16295","2011-10-07",\N,"The solution struture of the reduced yeast TOR1 FATC domain bound to DPC micelles at 298K",\N
16296,"16296","2009-06-11","2009-11-18","NMR Assignment of the Intrinsically Disordered C-terminal Region of Homo sapiens FCP1 in the Unbound State",\N
16297,"16297","2009-09-04","2009-10-16","AIDA-1 SAM domain tandem",\N
16298,"16298","2009-06-11","2009-06-23","Solution NMR structure of the domain N-terminal to the integrase domain of SH1003 from Staphylococcus haemolyticus. Northeast Structural Genomics Consortium Target ShR105F (64-166).","/ftp/pub/bmrb/timedomain/bmr16298"
16299,"16299","2009-07-22","2009-11-18","NMR assignment of a 48 kDa tetramer of the T1 domain of the mammalian voltage gated potassium channel Kv1.4",\N
16300,"16300","2009-06-03","2010-04-29","intrinsically unfolded alpha-synuclein",\N
16301,"16301","2009-06-03","2009-06-24","intrinsically unfolded alpha-synuclein variant SaS",\N
16302,"16302","2009-06-03","2009-06-24","SLAS-bound alpha-synuclein",\N
16303,"16303","2009-06-03","2009-06-24","SLAS-bound SaS synuclein variant",\N
16304,"16304","2009-06-03","2009-06-24","SLAS-bound beta-synuclein",\N
16305,"16305","2009-10-14","2009-11-25","1H, 13C and 15N assignments of a camelid nanobody directed against human alpha-synuclein",\N
16306,"16306","2009-07-22","2012-05-01","1H, 15N, and 13C resonance assignments of the 2/2 hemoglobin from the cyanobacterium Synechococcus sp. PCC 7002 in the ferric bis-histidine state",\N
16307,"16307","2009-07-22","2012-05-01","1H, 15N, and 13C resonance assignments of the 2/2 hemoglobin from the cyanobacterium Synechococcus sp. PCC 7002 in the ferric bis-histidine state",\N
16309,"16309","2009-10-14","2010-01-21","15N, 13C cL-BABP T91C holo",\N
16310,"16310","2009-10-14",\N,"Backbone assignment of the mutant cL-BABP T91C",\N
16311,"16311","2009-10-14","2010-03-05","Solution structure of the complex of VEK-30 and plasminogen kringle 2",\N
16312,"16312","2009-06-11",\N,"Solution NMR structure of a domain from a putative phage integrase protein Nmul_A0064 from Nitrosospira multiformis, Northeast Structural Genomics Consortium Target NmR46C.",\N
16313,"16313","2009-10-20",\N,"NMR Solution Structure of a Tubulin folding cofactor B obtained from Arabidopsis thaliana: Northeast Structural Genomics Consortium target AR3436A","/ftp/pub/bmrb/timedomain/bmr16313"
16314,"16314","2009-05-29","2009-06-15","Three-Dimensional NMR Structure of Rat Islet Amyloid Polypeptide in DPC micelles.",\N
16315,"16315","2012-08-03",\N,"NMR structure of fragment 87-196 from the putative phage integrase IntS of E. coli: Northeast Structural Genomics Consortium target ER652A",\N
16316,"16316","2012-08-03",\N,"NMR structure of IntB phage-integrase-like protein fragment 90-199 from Erwinia carotova subsp. atroseptica: Northeast Structural Genomics Consortium target EwR217E",\N
16317,"16317","2009-07-23","2009-11-25","Solution structure of human interleukin-33",\N
16318,"16318","2009-09-04",\N,"NMR Structure of CBP TAZ2 and Adenoviral E1A Complex",\N
16319,"16319","2009-09-04","2010-01-21","The solution structure of the circular bacteriocin carnocyclin A (CclA)",\N
16320,"16320","2009-10-14","2010-02-11","Solution structure of an archaeal protein SSO6904 from hyperthermophilic Sulfolobus solfataricus",\N
16321,"16321","2009-10-14","2010-04-19","Backbone 1H, 13C and 15N resonance assignments for the E2 conjugating enzyme, UbcH8",\N
16322,"16322","2009-06-23","2010-01-21","Extracellular CD147 (EMMPRIN): Isoforms -2",\N
16323,"16323","2012-08-03","2014-05-20","SLBP RBD 30-mer peptide",\N
16325,"16325","2009-06-11",\N,"Chemical shift assignments of the second domain of the listeria protein Lin2157, Northeast Structural Genomics Consortium target Lkr136b",\N
16327,"16327","2009-12-18","2010-09-24","DsbA wild type oxidized",\N
16328,"16328","2010-07-20","2010-10-06","the S173N variant of rabbit prion protein (91-228)",\N
16329,"16329","2009-12-11","2013-12-16","1H, 15N and 13C chemical shift assignments for the oxidised form of the DsbA oxidoreductase from Staphylococcus aureus",\N
16330,"16330","2009-12-11","2013-12-16","1H, 15N and 13C chemical shift assignments for the reduced form of the DsbA oxidoreductase from Staphylococcus aureus",\N
16332,"16332","2009-11-03",\N,"pH dependent structures of LAH4 in micellar environmnet:mode of acting",\N
16333,"16333","2009-11-03",\N,"pH dependent structures of LAH4 in micellar environment: mode of acting",\N
16334,"16334","2010-07-08","2010-12-06","Sequence specific backbone resonance assignment of Neuronal Calcium Sensor 1(NCS1) in non-myristoylated form.",\N
16335,"16335","2012-08-03",\N,"Solution structure of protein YlbL (BSU15050) from Bacillus subtilis, Northeast Structural Genomics Consortium target sr713a",\N
16336,"16336","2009-07-07",\N,"Solution Structure Of Protein NMB1076 From Neisseria meningitidis. Northeast Structural Genomics Consortium Target MR101B.","/ftp/pub/bmrb/timedomain/bmr16336"
16337,"16337","2009-11-18","2010-05-20","Backbone resonance assignments for the aminoglycoside phosphotransferase(3')-IIIa",\N
16338,"16338","2009-07-08",\N,"Solution NMR structure of the N-terminal Ubiquitin-like Domain from Tubulin-binding Cofactor B, CG11242, from Drosophila melanogaster. Northeast Structural Genomics Consortium Target FR629A (residues 8-92).","/ftp/pub/bmrb/timedomain/bmr16338"
16339,"16339","2009-11-16",\N,"NMR structures of a designed Cyanovirin-N homolog lectin; LKAMG",\N
16340,"16340","2009-06-11","2011-03-25","100% complete assignment of non-labile 1H, 13C, and 15N signals for calcium-loaded Calbindin D9K P43G",\N
16341,"16341","2009-11-16","2009-11-25","The inactive form of the retroviral protease of the murine intracisternal particle, inMIA-14 PR",\N
16342,"16342","2009-07-06","2010-04-29","Backbone 1H, 13C, 15N and 13C-beta Chemical Shift Assignments for alpha-synuclein at pH 3",\N
16343,"16343","2010-05-19",\N,"NMR STRUCTURE OF HUMAN INSULIN MUTANT GLU-B21-D-GLU, HIS-B10 ASP PRO-B28-LYS, LYS-B29-PRO, 20 STRUCTURES",\N
16344,"16344","2009-12-16","2010-01-21","Solution structure and backbone dynamics of the ribosomal protein S6wt.",\N
16345,"16345","2009-12-16","2010-01-21","Solution structure and backbone dynamics of the permutant P54-55",\N
16347,"16347","2009-07-07",\N,"Solution NMR structure of protein ATC0852 from Agrobacterium tumefaciens. Northeast Structural Genomics Consortium (NESG) target AtT2.",\N
16348,"16348","2009-08-06",\N,"SOLUTION STRUCTURE OF DEAD RINGER-LIKE PROTEIN 1 (AT-RICH INTERACTIVE DOMAIN-CONTAINING PROTEIN 3A) FROM HOMO SAPIENS, NORTHEAST STRUCTURAL GENOMICS CONSORTIUM (NESG) TARGET HR4394C","/ftp/pub/bmrb/timedomain/bmr16348"
16349,"16349","2009-08-10","2010-03-23","SOLUTION STRUCTURE OF C-terminal Domain of Tyrosine-protein kinase ABL2 FROM HOMO SAPIENS, NORTHEAST STRUCTURAL GENOMICS CONSORTIUM (NESG) TARGET HR5537A","/ftp/pub/bmrb/timedomain/bmr16349"
16350,"16350","2011-04-08",\N,"NMR solution structure of the pheromone En-A1 from Euplotes nobilii",\N
16352,"16352","2009-07-07",\N,"Solution NMR structure of protein AF2094 from Archaeoglobus fulgidus. Northeast Structural Genomics Consotium (NESG) target GT2",\N
16353,"16353","2009-08-06",\N,"SOLUTION STRUCTURE OF SH2 DOMAIN OF PROTO-ONCOGENE TYROSINE-PROTEIN KINASE FER FROM HOMO SAPIENS, NORTHEAST STRUCTURAL GENOMICS CONSORTIUM (NESG) TARGET HR3461D",\N
16354,"16354","2009-09-29","2010-02-03","NMR solution structure of the N terminal domain of subunit E (E1-52) of A1AO ATP synthase from Methanocaldococcus jannaschii",\N
16355,"16355","2012-02-22",\N,"NMR Solution Structure of a Putative Uncharacterized Protein obtained from Arabidopsis thaliana: Northeast Structural Genomics Consortium target AR3449A","/ftp/pub/bmrb/timedomain/bmr16355"
16356,"16356","2009-12-11","2010-02-11","Structure of a two-G-tetrad intramolecular G-quadruplex formed by a variant human telomeric sequence in K+ solution",\N
16357,"16357","2009-07-07",\N,"Solution NMR Structure of a dimeric protein of unknown function from Methanobacterium thermoautotrophicum, Northeast Structural Genomics Consortium Target TR5",\N
16359,"16359","2009-12-16",\N,"chemical shift assignment of West Nile protease in the absence of inhibitor",\N
16360,"16360","2010-01-07","2012-10-30","1H, 13C and 15N NMR sequence-specific resonance assignments and relaxation parameters for human apo-S100A1(aa) in the reduced form",\N
16361,"16361","2009-06-26","2010-01-21","NMR structure of the p62 PB1 domain",\N
16362,"16362","2009-11-16","2009-11-25","1H, 13C and 15N NMR assignments of StnII-R29Q, a defective lipid binding mutant of the sea anemone actinoporin Sticholysin II.",\N
16363,"16363","2010-08-16",\N,"Solution structure of the Nuclear coactivator binding domain of CBP",\N
16364,"16364","2009-07-07",\N,"Solution NMR structure of FHA domain of Mb1858 from Mycobacterium bovis. Northeast Structural Genomics Consortium Target MbR243C (24-155).","/ftp/pub/bmrb/timedomain/bmr16364"
16365,"16365","2012-08-03",\N,"Solution NMR structure of yeast protein YOR252W [residues 38-178]: Northeast Structural Genomics Consortium target YT654",\N
16366,"16366","2012-08-03",\N,"Solution NMR structure of Themotoga maritima protein TM1076: Northeast Structural Genomics Consortium target VT57",\N
16367,"16367","2009-12-11","2012-11-06","NMR Evidence for differential phosphorylation-dependent interactions in WT and DeltaF508 CFTR",\N
16368,"16368","2009-08-06",\N,"Solution NMR structure of the homodimeric winged helix-turn-helix DNA-binding domain (fragment 1-100) Mb0332 from Mycobacterium bovis, a possible ArsR-family transcriptional regulator. Northeast Structural Genomics Consortium Target MbR242E.","/ftp/pub/bmrb/timedomain/bmr16368"
16370,"16370","2009-06-29",\N,"Solution NMR Structure of the Ig-like C2-type 2 Domain of Human Myotilin. Northeast Structural Genomics Target HR3158.",\N
16371,"16371","2009-08-06",\N,"Solution Structure Of Protein DSY2949 From Desulfitobacterium hafniense. Northeast Structural Genomics Consortium Target DhR27",\N
16372,"16372","2009-06-30",\N,"Solution structure of protein af2351 from Archaeoglobus fulgidus. Northeast Structural Genomics Consortium target AtT9/Ontario Center for Structural Proteomics Target af2351",\N
16373,"16373","2009-07-07",\N,"Solution NMR structure of an integrase domain from protein SPA4288 from Salmonella enterica, Northeast Structural Genomics Consortium Target SlR105H","/ftp/pub/bmrb/timedomain/bmr16373"
16374,"16374","2009-09-15",\N,"Solution Structure of C-terminal domain of reduced NleG2-3 (residue 90-191) from Pathogenic E. coli O157:H7. Northeast Structural Genomics Consortium and Midwest Center for Structural Genomics target ET109A",\N
16375,"16375","2009-09-15",\N,"Solution Structure of C-terminal domain of oxidized NleG2-3 (residue 90-191) from Pathogenic E. coli O157:H7. Northeast Structural Genomics Consortium and Midwest Center for Structural Genomics target ET109A",\N
16376,"16376","2009-07-06","2009-07-08","Solution NMR structure of the monomeric W187R mutant of A/Udorn NS1 effector domain. Northeast Structural Genomics target OR8C[W187R].","/ftp/pub/bmrb/timedomain/bmr16376"
16377,"16377","2009-08-06","2011-06-21","RpR325/RPA3574 from Rhodopseudomonas palustris","/ftp/pub/bmrb/timedomain/bmr16377"
16378,"16378","2009-07-07",\N,"Chemical shift assignment of GtR34C from Geobacillus thermodenitrificans. North East Structural Genomics Consortium Target GtR34C",\N
16379,"16379","2010-03-10","2010-05-20","Solution structure of Interleukin 1a",\N
16380,"16380","2009-08-07","2011-01-24","NMR solution structure of A2LD1 (gi:13879369)",\N
16381,"16381","2010-03-01",\N,"Sequence-specific resonance assignments of human VDAC-1 in LDAO micelles",\N
16382,"16382","2009-09-15",\N,"Solution NMR structure of the Rhodanese-like domain from Anabaena sp Alr3790 protein. Northeast Structural Genomics Consortium Target NsR437A",\N
16384,"16384","2009-07-07",\N,"Solution NMR Structure of protein yutD from B.subtilis, Northeast Structural Genomics Consortium Target Target SR232","/ftp/pub/bmrb/timedomain/bmr16384"
16385,"16385","2009-07-06",\N,"Solution NMR structure of the CARDB domain of PF1109 from Pyrococcus furiosus. Northeast Structural Genomics Consortium target PfR193A","/ftp/pub/bmrb/timedomain/bmr16385"
16386,"16386","2009-08-06",\N,"Solution NMR Structure of the EGF-like 1 Domain of Human Fibulin-4. Northeast Structural Genomics Target HR6275.",\N
16387,"16387","2009-08-06","2012-12-12","Solution NMR Structure of denovo designed ferrodoxin fold like protein, Northeast Structural Genomics Consortium Target Target OR15","/ftp/pub/bmrb/timedomain/bmr16387"
16388,"16388","2009-08-06",\N,"NMR Solution structure of a diflavin flavoprotein A3 from Nostoc sp. PCC 7120, Northeast Structural Genomics Consortium Target NsR431C",\N
16389,"16389","2011-05-19",\N,"Solution NMR structure of protein of unknown function (NP_247299.1) from Methanococcus jannaschii",\N
16390,"16390","2009-07-07",\N,"NMR solution structure of human ubiquitin-like domain of ubiquilin 1, Northeast Structural Genomics Consortium (NESG) target HT5A",\N
16391,"16391","2009-08-06","2009-09-02","13C and 15N Chemical Shift Assignments for human alphaB-crystallin",\N
16392,"16392","2009-07-10","2011-03-29","NMR relaxation data for the beta-lactamase TEM-1",\N
16393,"16393","2009-12-11","2010-01-21","NMR Evidence for differential phosphorylation-dependent interactions in WT and deltaF508 CFTR",\N
16394,"16394","2009-12-14","2010-01-21","NMR Evidence for differential phosphorylation-dependent interactions in WT and deltaF508 CFTR",\N
16395,"16395","2009-09-04",\N,"Assignments of M.HhaI bound with hemimethylated DNA",\N
16396,"16396","2010-05-20",\N,"The solution structure of CBD of human MCM6",\N
16397,"16397","2010-10-18",\N,"Solution structure of SCA7 zinc finger domain from human ataxin-7 protein",\N
16398,"16398","2009-11-16","2009-11-25","1H, 13C and 15N Chemical Shift Assignment for the Psb27 Protein of Synechocystis PCC 6803",\N
16399,"16399","2009-08-12","2010-01-21","Role of Trp-Trp interactions in Trpzip beta-hairpin formation, structure and stability",\N
16400,"16400","2009-09-04","2010-01-21","SOLUTION STRUCTURE OF AN ABC COLLAGEN HETEROTRIMER REVEALS A SINGLE-REGISTER HELIX STABILIZED BY ELECTROSTATIC INTERACTIONS",\N
16401,"16401","2010-02-17",\N,"Separation of Inhibitor and Substrate Binding Locations in the Globin Dehaloperoxidase",\N
16402,"16402","2010-10-18",\N,"Solution structure of SCA7 zinc finger domain from human Ataxin-7-L3 protein",\N
16403,"16403","2009-08-21",\N,"SOLUTION STRUCTURE OF GLUTAREDOXIN FROM Bartonella henselae str. Houston. Seattle Structure Genomics Center for Infectious Disease (SSGCID)",\N
16404,"16404","2009-12-18","2010-03-05","Solution structure of human ubiquitin conjugating enzyme Ube2g2",\N
16405,"16405","2012-08-03",\N,"Solution Structure of the Tandem UIM Domain of Ataxin-3 Complexed with Ubiquitin",\N
16406,"16406","2009-07-23",\N,"Solution structure of peptidyl-prolyl cis-trans isomerase from Burkholderia pseudomallei. Seattle Structure Genomics Center for Infectious Disease (SSGCID)",\N
16407,"16407","2009-08-25","2010-01-21","Role of Trp-Trp interactions in Trpzip beta-hairpin formation, structure and stability",\N
16408,"16408","2010-03-12","2010-05-20","Cu(I)-bound CopK",\N
16409,"16409","2009-11-16",\N,"Backbone 1H, 15N, and 13C assignments for beta phosphoglucomutase in a ternary complex with alpha-galactose 1-phosphate and MgF3-",\N
16411,"16411","2010-09-17","2010-10-14","Solution structure of Rtt103 CTD interacting domain",\N
16412,"16412","2010-09-17","2010-10-14","Solution structure of Rtt103 bound to CTD peptide",\N
16413,"16413","2010-06-22","2010-10-06","C17orf37 Human 9606 Eukaryota Matazoa Homo sapiens",\N
16423,"16423","2010-03-08",\N,"Solution structure of a neurotrophic ligand bound to FKB12 and its effects on protein dynamics",\N
16424,"16424","2010-06-15","2010-10-06","Solution Structure of BamE, a component of the outer membrane protein assembly machinery in Escherichia coli",\N
16425,"16425","2010-07-27","2010-08-12","Interdomain RRM packing contributes to RNA recognition in the rna15, hrp1, anchor RNA 3' processing ternary complex",\N
16426,"16426","2009-12-18",\N,"NMR-derived structure of residues 29-138 of murine Ets-1, containing the PNT domain, along with phosphorylated Thr38 and Ser41",\N
16428,"16428","2010-02-02","2010-03-23","The structure of the KlcA and ArdB proteins show a novel fold and antirestriction activity against Type I DNA restriction systems in vivo but not in vitro.",\N
16430,"16430","2009-09-08","2009-11-25","1H, 13C, 15N backbone resonance assginments of Nep1 from Methanococcus jannaschii",\N
16431,"16431","2009-09-08",\N,"Complex of HIV-2 TAR RNA and a synthetic tripeptide in a 1:2 stoichiometry",\N
16435,"16435","2009-11-18","2010-01-20","Solution structure of native Leech-dreived tryptase inhibitor, LDTI",\N
16436,"16436","2009-11-18","2010-01-20","Solution structure of intermediate IIa of Leech-derived tryptase inhibitor, LDTI",\N
16437,"16437","2009-11-18","2010-01-20","Solution structure of intermeidate IIa of Leeck-derived tryptase inhibitor, LDTI.",\N
16438,"16438","2009-11-18","2010-01-20","Solution structure of intermeidate IIa of Leeck-derived tryptase inhibitor, LDTI.",\N
16439,"16439","2009-11-19","2010-01-20","Combined high- and low-resolution techniques reveal compact structure in central portion of factor H despite long inter-modular linkers",\N
16440,"16440","2009-11-19","2010-01-20","Solution structure of the nucleotide binding domain of the human Menkes protein in the ATP-free form",\N
16441,"16441","2009-11-19","2010-01-20","Solution structure of the nucleotide binding domain of the human Menkes protein in the ATP-bound form",\N
16442,"16442","2010-09-03",\N,"Solution structure of At3g03773.1 protein from Arabidopsis thaliana",\N
16443,"16443","2010-10-18","2011-05-05","NMR Solution structures of fully oxidised cytochrome c3 from Desulfovibrio desulfuricans ATCC 27774",\N
16444,"16444","2010-10-07","2011-03-25","NMR Chemical Shifts of GB1-SC35",\N
16445,"16445","2009-11-16","2009-11-25","Backbone and side chain 1H, 13C, 15N chemical shift assignments for K2",\N
16446,"16446","2009-11-19",\N,"Chemical shift assignments for Ncs1p",\N
16447,"16447","2009-12-11","2012-11-07","Structural tightening and interdomain communication in the catalytic cycle of phosphoglycerate kinase",\N
16448,"16448","2009-12-18",\N,"Resonance assignments of the SH3 domain of phosphatidylinositol-3-kinase (PI3-SH3) in amyloid fibril form determined by MAS NMR spectroscopy",\N
16449,"16449","2012-08-03","2014-05-20","Structure of the XPF-single strand DNA complex",\N
16450,"16450","2009-11-16","2009-11-25","Backbone and side chain 1H, 13C, 15N chemical shift assignments for YSK2",\N
16451,"16451","2009-12-11","2010-02-03","Structural tightening and interdomain communication in the catalytic cycle of phosphoglycerate kinase",\N
16452,"16452","2012-08-03",\N,"NMR structure of the C-terminal domain of pUL89",\N
16463,"16463","2009-11-19","2014-01-28","Backbone and side-chain 1H, 13C and 15N resonance assignments of LEN, a human immunoglobulin kIV light-chain variable domain",\N
16464,"16464","2009-12-11","2010-02-03","Structural tightening and interdomain communication in the catalytic cycle of phosphoglycerate kinase",\N
16465,"16465","2009-12-14","2010-02-03","CALMODULIN WRAPS AROUND ITS BINDING DOMAIN IN THE PLASMA MEMBRANE CA2+ PUMP ANCHORED BY A NOVEL 18-1 MOTIF",\N
16466,"16466","2009-12-11",\N,"Solution structure and functional characterization of human plasminogen kringle 5",\N
16467,"16467","2009-12-11",\N,"The Solution structure of the eTAFH domain of AML1-ETO complexed with HEB peptide",\N
16468,"16468","2012-08-03",\N,"High-resolution solution structure of the ASIC1a blocker PcTX1",\N
16469,"16469","2012-04-25",\N,"3J coupling constants related to the phi-torsion angles in Ribonuclease T1 (EC 3.1.27.3)",\N
16470,"16470","2010-01-28","2010-03-05","Backbone 1H, 13C, and 15N Chemical Shift Assignments for ShcA PTB Domain",\N
16471,"16471","2010-01-28","2010-03-05","Backbone 1H, 13C, and 15N Chemical Shift Assignments for IQGAP1 (401-533)",\N
16472,"16472","2010-08-26","2012-03-15","NMR Solution Structure of SH2 Domain of the Human Tensin Like C1 Domain Containing Phosphatase (TENC1)",\N
16473,"16473","2009-09-02","2009-10-06","Solution structure of zinc-substituted rubredoxin B (Rv3250c) from Mycobacterium tuberculosis. Seattle Structural Genomics Center for Infectious Disease(SSGCID)target MytuD.01635a",\N
16475,"16475","2009-12-14","2010-05-20","Assignment of 1H, 13C and 15N backbone resonances of Escherichia coli LpxC bound to L-161,240",\N
16476,"16476","2009-11-04",\N,"Solution structure of protein Atu0922 from A. tumefaciens. Northeast Structural Genomics Consortium target AtT13. Ontario Center for Structural Proteomics target ATC0905.","/ftp/pub/bmrb/timedomain/bmr16476"
16477,"16477","2009-12-11","2010-03-23","Solution structure of the transmembrane proximal region of the hepatis C virus E1 glycoprotein.",\N
16478,"16478","2010-05-05",\N,"Solution structure of UBA domain of XIAP",\N
16479,"16479","2010-03-15","2010-05-18","1H and 13C resonance assignments of a guanine sensing riboswitch's terminator hairpin",\N
16480,"16480","2009-11-04",\N,"NMR solution structure of double module LA45 of LDLR",\N
16481,"16481","2009-11-20","2010-02-03","1H, 13C and 15N resonance assignments of the hyperthermostable 264-residue endo-<beta>-1,3-glucanase LamA at 62 C",\N
16482,"16482","2010-02-03","2010-02-23","Solution Structure of complement repeat CR17 from LRP-1",\N
16483,"16483","2010-02-02","2010-02-23","Fusion construct of CR17 from LRP-1 and ApoE residues 130-149",\N
16484,"16484","2010-02-04","2010-03-23","NMR structure of CIP75 UBA domain",\N
16485,"16485","2010-02-17","2011-08-16","Solution structure of the THAP zinc finger of THAP1 in complex with its DNA target",\N
16486,"16486","2009-09-29",\N,"Solution NMR structure of the ACT domain from GTP pyrophosphokinase of Chlorobium tepidum. Northeast Structural Genomics Consortium Target CtR148A","/ftp/pub/bmrb/timedomain/bmr16486"
16487,"16487","2010-01-28","2010-02-23","Backbone 1H, 15N and 13C chemical shift assignments for HCV-1b Core+1/S polypeptide.",\N
16489,"16489","2010-04-06","2010-08-12","NMR structure of pep46 from the infectious bursal disease virus (IBDV) in CD3OH/CDCl3 (1/1)",\N
16490,"16490","2009-10-06",\N,"Solution structure of protein sf3929 from Shigella flexneri 2a. Northeast Structural Genomics Consortium target SfR81/Ontario Center for Structural Proteomics Target sf3929",\N
16491,"16491","2009-09-29",\N,"Solution structure of peptidyl-prolyl cis-trans isomerase from Burkholderia pseudomallei complexed with Cycloheximide-N-ethylethanoate. Seattle Structure Genomics Center for Infectious Disease (SSGCID)",\N
16492,"16492","2010-10-18",\N,"The Structure of Anti-TRAP",\N
16493,"16493","2009-10-06",\N,"Backbone and side chain 1H chemical shift assignments for acidic fibrobast growth factor bound to inositol hexasulfate",\N
16494,"16494","2009-10-06",\N,"Backbone and side chain 1H chemical shift assignments for acidic fibrobast growth factor",\N
16495,"16495","2012-08-03",\N,"Solution Structure of PYD peptide from ErbB2",\N
16496,"16496","2009-12-18",\N,"PLATELET INTEGRIN ALFAIIB-BETA3 TRANSMEMBRANE- CYTOPLASMIC HETEROCOMPLEX",\N
16497,"16497","2009-09-24","2010-04-09","1H, 13C, and 15N Chemical Shift Assignments for the Integrin AlphaIIb-Beta3 Transmembrane Complex",\N
16498,"16498","2009-10-16",\N,"Solution NMR structure of CLOLEP_01837 (fragment 61-160) from Clostridium leptum. Northeast Structural Genomics Consortium Target QlR8A.","/ftp/pub/bmrb/timedomain/bmr16498"
16499,"16499","2010-11-01",\N,"(1-77)Apomyoglobin",\N
16500,"16500","2010-11-01",\N,"(1-119)Apomyoglobin",\N
16501,"16501","2010-11-01",\N,"(1-153)Apomyoglobin",\N
16502,"16502","2009-10-20",\N,"Backbone and side chain 1H chemical shift assignments for acidic fibrobast growth factor bound to 1,3,6-naphthalenetrisulfonate",\N
16503,"16503","2010-01-26","2013-07-26","Ribonuclease A in 40% acetic acid and 8M urea pH 2",\N
16504,"16504","2009-11-20",\N,"Human cannabinoid receptor 1 - helix 7/8 peptide",\N
16505,"16505","2009-11-20","2010-02-03","NMR structure of the octarepeat region of prion protein bound to pentosan polysulfate",\N
16506,"16506","2010-03-01","2010-05-20","Back bone chemical shift assignments of the acyl-intermediates of fatty acid synthesis pathway of P. falciparum",\N
16507,"16507","2010-01-28","2010-02-23","NMR structure of mouse Par3-PDZ3 in complex with VE-Cadherin C-terminus",\N
16508,"16508","2009-11-20","2010-01-20","NMR chemical shift assignments of lipid-bound synaptobrevin",\N
16509,"16509","2010-02-02","2010-02-23","Complement Repeats 16 17 and 18 from LRP-1",\N
16510,"16510","2009-10-06",\N,"The solution structure of the first PHD finger of autoimmune regulator in complex with non-modified histone H3 tail reveals the antagonistic role of H3R2 methylation",\N
16511,"16511","2010-04-26","2010-08-12","A Doppel alpha-helix Peptide Fragment Mimics the Copper(II) Interactions with the whole Protein",\N
16512,"16512","2009-11-20","2010-01-20","NMR chemical shift of synaptobrevin fragment 60-116",\N
16514,"16514","2009-11-20","2010-01-20","NMR chemical shifts of soluble synaptobrevin (1-96) in buffer and in DPC micelle",\N
16515,"16515","2010-05-13",\N,"Solution structure of mouse Par-3 PDZ2 (residues 450-558)",\N
16516,"16516","2009-11-20","2010-05-20","Backbone and 13Cb chemical shifts for human AP endonuclease 1 (APE1) residues 39-318",\N
16517,"16517","2009-10-23","2013-08-08","Solution structure of an arsenate reductase (ArsC) related protein from Brucella melitensis. Seattle Structural Genomics Center for Infectious Disease (SSGCID) target BrabA.00007.a.",\N
16518,"16518","2009-11-20","2010-01-20","Backbone resonance assignments for oxidised Trypanosoma cruzi glutathione peroxidase",\N
16519,"16519","2012-08-03",\N,"Solution structure of human SDF1-alpha H25R",\N
16520,"16520","2010-01-28","2010-05-20","Solution structure of humar Par-3b PDZ2 (residues 451-549)",\N
16521,"16521","2014-03-04",\N,"NMR solution structure of CV_2116 from Chromobacterium violaceum.Northeast Structural Genomics Consortium Target CvT4(1-82)",\N
16522,"16522","2010-04-26","2010-07-28","A Doppel alpha-helix Peptide Fragment Mimics the Copper(II) Interactions with the whole Protein",\N
16523,"16523","2009-12-03","2010-05-20","Backbone 1H, 13C, and 15N Chemical Shift Assignments and heteronuclear NOEs for pfColA",\N
16524,"16524","2010-03-01","2012-10-05","NMR solution structures of hexanoyl-ACP from the Streptomyces coelicolor Fatty Acid Synthase",\N
16525,"16525","2010-09-03","2012-10-05","NMR solution structures of 3-oxooctanyl-ACP from Streptomyces coelicolor Fatty Acid Synthase",\N
16526,"16526","2010-09-03","2012-10-05","NMR solution structures of 3-hydroxyoctanoyl-ACP from Streptomyces coelicolor Fatty Acid Synthase",\N
16527,"16527","2010-09-03","2012-10-05","NMR solution structures of 2-octenoyl-ACP from Streptomyces coelicolor Fatty Acid Synthase",\N
16528,"16528","2010-09-03","2012-10-05","NMR solution structures of octanoyl-ACP from Streptomyces coelicolor Fatty Acid Synthase",\N
16529,"16529","2010-03-01","2010-05-20","Back bone chemical shift assignments of the octanoyl-ACP of P. falciparum fatty acid synthesis pathway",\N
16530,"16530","2010-03-01","2010-05-20","Back bone chemical shift assignments of the decanoyl-ACP of P. falciparum fatty acid synthesis pathway",\N
16531,"16531","2010-03-01","2010-05-20","Back bone chemical shift assignments of the dodecanoyl-ACP of P. falciparum fatty acid synthesis pathway",\N
16532,"16532","2010-03-01","2010-05-20","Back bone chemical shift assignments of the tetradecanoyl-ACP of P. falciparum fatty acid synthesis pathway",\N
16533,"16533","2010-03-01","2010-05-20","Back bone chemical shift assignments of the hexadecanoyl-ACP of P. falciparum fatty acid synthesis pathway",\N
16534,"16534","2010-02-08","2010-03-01","DICER LIKE protein",\N
16536,"16536","2012-08-03",\N,"Structure of the E1064A mutant of the N-domain of Wilson Disease Associated Protein",\N
16537,"16537","2009-12-18","2010-10-20","Backbone assignment of the 26 kDa neuron-specific ubiquitin carboxyl-terminal hydrolase L1 (UCH-L1)",\N
16538,"16538","2010-01-11","2010-05-18","15N, 13C and 1H Resonance Assignments of the Middle MA-3 Domain of the Tumour Suppressor Protein Pdcd4",\N
16539,"16539","2012-08-03",\N,"Solution structure of nasonin-1",\N
16540,"16540","2012-08-03",\N,"Solution structure of nasonin-1M",\N
16541,"16541","2010-10-06",\N,"Assignment of the Orphan Nuclear Receptor Nurr1 by NMR",\N
16542,"16542","2010-01-12","2010-05-18","15N, 13C and 1H Backbone Resonance Assignments for the Complete Tandem MA-3 Region of the Tumour Suppressor Protein Pdcd4",\N
16543,"16543","2010-01-28","2010-04-29","Backbone 1H and 15N Chemical Shifts for Disordered alpha-Synuclein",\N
16544,"16544","2012-08-03","2013-05-03","RECQL4 AMINO-TERMINAL DOMAIN",\N
16545,"16545","2010-11-10",\N,"Solution NMR structure of protein CV0237 from Chromobacterium violaceum. Northeast Structural Genomics Consortium (NESG) target CvT1.",\N
16546,"16546","2010-01-28","2010-04-29","Backbone 1H and 15N Chemical Shifts for Disordered A30P alpha-Synuclein",\N
16547,"16547","2010-01-28","2010-04-29","Backbone 1H and 15N Chemical Shifts for Disordered E46K alpha-Synuclein",\N
16548,"16548","2010-01-28","2010-04-29","Backbone 1H and 15N Chemical Shifts for Disordered A53T alpha-Synuclein",\N
16549,"16549","2009-11-09",\N,"Solution NMR structure of the Mus81 N-terminal HhH. Northeast Structural Genomics Consortium target MmT1A",\N
16550,"16550","2010-02-18","2010-08-12","Specific motifs of the V-ATPase a2-subunit isoform interact with catalytic and regulatory domains of ARNO",\N
16551,"16551","2010-02-18","2010-08-12","Specific motifs of the V-ATPase a2-subunit isoform interact with catalytic and regulatory domains of ARNO",\N
16555,"16555","2009-11-30","2010-05-20","1H, 15N and 13C assignments of the dimeric C-terminal domain of HIV-1 capsid protein",\N
16556,"16556","2009-11-18",\N,"Solution NMR structure of Streptomyces coelicolor SCO3027 modelled with Zn+2 bound. Northeast Structural Genomics Consortium Target RR58.","/ftp/pub/bmrb/timedomain/bmr16556"
16557,"16557","2009-11-18",\N,"Solution Structure Of Protein SOS-response transcriptional repressor, LexA From Eubacterium rectale. Northeast Structural Genomics Consortium Target ErR9A",\N
16558,"16558","2012-05-09",\N,"MAGI-1 PDZ1",\N
16559,"16559","2012-05-09",\N,"MAGI-1 PDZ1 / E6CT",\N
16560,"16560","2010-01-07",\N,"Solution NMR Structure of uncharacterized protein from gene locus NE0665 of Nitrosomonas europaea. Northeast Structural Genomics Target NeR103A",\N
16561,"16561","2010-09-17",\N,"Solution NMR structure of a Bacterial Ig-like (Big_3) domain from Bacillus cereus. Northeast Structural Genomics Consortium target BcR147A.","/ftp/pub/bmrb/timedomain/bmr16561"
16562,"16562","2009-11-02","2012-07-03","SOLUTION NMR STRUCTURE OF DE NOVO DESIGNED ROSSMANN 2x2 FOLD PROTEIN, NORTHEAST STRUCTURAL GENOMICS CONSORTIUM TARGET OR16","/ftp/pub/bmrb/timedomain/bmr16562"
16563,"16563","2009-11-23",\N,"Solution NMR structure of Lin0431 protein from Listeria innocua. Northeast Structural Genomics Consortium Target LkR112",\N
16564,"16564","2012-08-03",\N,"NMR Structure of Agrobacterium tumefaciens protein Atu1219: Northeast Structural Genomics Consortium target AtT14",\N
16565,"16565","2009-12-03","2010-03-05","apo-WT yeast Triosephosphate Isomerase (TIM)",\N
16566,"16566","2009-12-03","2010-03-05","D-G3P-bound WT yeast Triosephosphate Isomerase (TIM)",\N
16567,"16567","2010-05-04",\N,"1H, 13C, and 15N chemical shift assignments for the RNA recognition motif of Nab3",\N
16568,"16568","2009-11-04","2014-05-20","Solution Structure of Domain IV from the YbbR family protein of Desulfitobacterium hafniense",\N
16569,"16569","2010-11-24",\N,"Solution NMR structure of the N-terminal domain of cg2496 protein from Corynebacterium glutamicum. Northeast Structural Genomics Consortium Target CgR26A","/ftp/pub/bmrb/timedomain/bmr16569"
16570,"16570","2012-01-24",\N,"NMR Structure of YbbR family protein Dhaf_0833 (residues 32-118) from Desulfitobacterium hafniense DCB-2: Northeast Structural Genomics Consortium target DhR29B",\N
16571,"16571","2010-01-28","2010-05-20","NMR assignments of the DNA binding domain of ML4 protein from Mesorhizobium loti",\N
16572,"16572","2009-10-22",\N,"NMR solution structure of Lamin-B1 protein from Home sapiens: Northeast Structural Genomics Consortium target, HR5546A(438-548)","/ftp/pub/bmrb/timedomain/bmr16572"
16576,"16576","2010-01-07","2012-01-24","Solution Structure Of Protein BH0266 From Bacillus halodurans. Northeast Structural Genomics Consortium Target BhR97a",\N
16577,"16577","2010-03-24","2010-07-19","Backbone Chemical Shift Assignments of Mouse HOXA13 DNA Binding Domain in Complex with DNA Duplex",\N
16578,"16578","2012-08-03",\N,"Solution NMR structure of the apo form of a ribonuclease H domain of protein DSY1790 from Desulfitobacterium hafniense, Northeast Structural Genomics target DhR1A.",\N
16579,"16579","2010-02-08","2010-03-24","2J coupling constants in oxidized Flavodoxin from Desulfovibrio vulgaris (Hildenborough)",\N
16580,"16580","2010-02-08","2010-05-18","2J coupling constants in Ribonuclease T1 from Aspergillus oryzae",\N
16581,"16581","2010-02-08","2010-05-18","2J coupling constants in human Frataxin C-terminal domain (90-210)",\N
16582,"16582","2010-02-08","2010-05-18","2J coupling constants in human Ubiquitin",\N
16583,"16583","2010-02-08","2010-05-18","2J coupling constants in Xylanase from Bacillus agaradhaerens",\N
16584,"16584","2010-02-08","2010-05-18","2J coupling constants in DFPase from Loligo vulgaris",\N
16585,"16585","2010-05-19",\N,"Solution structure of SNase140",\N
16586,"16586","2009-11-24","2010-05-20","Backbone assignment of 3F5 heavy chain antibody fragment in its free form",\N
16587,"16587","2010-02-09","2010-05-18","Chemical shifts of a native-like folding intermediate of beta2-microglobulin",\N
16588,"16588","2009-11-24","2010-03-01","NMR Assignment of the C-terminal Domain of yeast Aha-1",\N
16589,"16589","2011-05-19",\N,"peptide_ptha",\N
16590,"16590","2010-05-06","2010-05-26","protein x",\N
16591,"16591","2010-02-01","2010-03-01","1H and 15N chemical shifts for the immune inhibitory receptor LAIR-1 collagen binding domain",\N
16592,"16592","2009-11-30",\N,"Solution NMR structure of a domain from BT9727_4915 from Bacillus thuringiensis, Northeast Structural Genomics Consortium Target BuR95A",\N
16593,"16593","2010-06-28","2010-08-12","1H, 15N and 13C chemical shifts for the apo form of F98N-flavodoxin from Anabaena PCC7119",\N
16594,"16594","2009-11-24",\N,"Solution structure of DnaK suppressor protein from Agrobacterium tumefaciens C58. Northeast Structural Genomics Consortium target AtT12/Ontario Center for Structural Proteomics Target atc0888",\N
16595,"16595","2009-11-24",\N,"HIV Fusion Peptide in Cholesterol-Rich Membranes",\N
16596,"16596","2010-01-28","2010-03-01","First PBZ domain of human APLF protein",\N
16597,"16597","2009-11-09",\N,"Influenza Virus Fusion Peptide in Membranes without Cholesterol at pH 5.0",\N
16598,"16598","2010-05-05","2010-10-06","1H, 13C and 15N backbone resonance assignments of cTEM-17m, a TEM-1/PSE-4 class A beta-lactamases chimera",\N
16599,"16599","2010-09-28","2010-10-19","Backbone resonance assignments of clytin",\N
16600,"16600","2010-09-28","2010-11-15","Backbone resonance assignments of cgGFP",\N
16601,"16601","2012-06-26","2012-08-23","kkgf",\N
16602,"16602","2010-02-11",\N,"1H, 13C and 15N Chemical Shift Assignment Assignment of Human Membrane Protein KCNE3 in LMPC micelles",\N
16603,"16603","2012-08-29",\N,"Solution Structure of apo-IscU",\N
16604,"16604","2010-09-02",\N,"1H, 13C, 15N chemical shift sssignments of the artificial neomycin-sensing riboswitch in complex with tobramycin",\N
16605,"16605","2010-06-24","2011-05-20","MAUROCALCINE IN D CONFIGURATION FROM SCORPIO MAURUS PALMATUS",\N
16606,"16606","2010-05-13",\N,"SOLUTION STRUCTURE OF THE KI O18/O8 Y87H IMMUNOGLOBULIN LIGHT CHAIN VARIABLE DOMAIN",\N
16607,"16607","2010-05-13",\N,"SOLUTION STRUCTURE OF THE AL-09 H87Y IMMUNOGLOBULIN LIGHT CHAIN VARIABLE DOMAIN",\N
16608,"16608","2010-03-15",\N,"NMR Structure of Proinsulin",\N
16609,"16609","2010-09-02","2015-01-30","1H, 13C, 15N chemical shift sssignments of the artificial neomycin-sensing riboswitch in complex with ribostamycin",\N
16610,"16610","2012-08-03",\N,"Solution structure of the N-terminal domain (residues 1-111) of Brugia malayi asparaginyl-tRNA synthetase",\N
16611,"16611","2010-10-14","2011-03-25","Phosphorylation of SUMO-interacting motif by CK2 enhances Daxx SUMO binding activity.",\N
16612,"16612","2010-02-08",\N,"Solid-state NMR structure of the M2 transmembrane peptide of the influenza A virus in DMPC lipid bilayers bound to deuterated amantadine",\N
16613,"16613","2010-06-15","2010-08-12","SARS Coronavirus-unique domain (SUD): Three-domain molecular architecture in solution and RNA binding",\N
16614,"16614","2010-05-05",\N,"1H, 13C and 15N resonance assignments of a highly-soluble murine interleukin-3 analogue with wild-type bioactivity",\N
16615,"16615","2012-08-03",\N,"Backbone assignment of E. coli HU protein",\N
16616,"16616","2010-10-13","2010-10-18","assignment for the I214V variant of rabbit prion protein (91-228)",\N
16617,"16617","2010-03-22","2010-05-19","Solution structure of Avian Thymic Hormone",\N
16618,"16618","2010-05-05",\N,"NMR structure of the J-domain (residues 2-72) in the Escherichia coli CbpA",\N
16619,"16619","2010-02-08","2010-05-19","Sequence-specific 1H, 13C, and 15N resonance assignments of Diva (Boo), an apoptosis regulator of the Bcl-2 family",\N
16620,"16620","2010-01-06",\N,"Solution NMR structure of zinc binding N-terminal domain of ubiquitin-protein ligase E3A from Homo Sapience. Northeast Structural Genomics Consortium (NESG) target HR3662A.",\N
16621,"16621","2010-02-11",\N,"1H, 13C, and 15N chemical shift assignment of KCNE3 in isotropic bicelles",\N
16622,"16622","2012-08-03",\N,"Bergerac-SH3: frustation induced by stabilizing the folding nucleus",\N
16623,"16623","2010-01-28",\N,"The U-box domain of mus musculus E4B",\N
16624,"16624","2010-02-09","2010-05-19","Solution Structure of an Acyl Carrier Protein Domain from Fungal Type I Polyketide Synthase",\N
16626,"16626","2010-01-25","2010-05-19","Backbone and stereospecific beta-sidechain assignments of 1H, 13C and 15N for Ubiquitin Unfolded in 8M Urea, pH2.5.",\N
16627,"16627","2010-01-25","2010-05-19","Backbone and stereospecific beta-sidechain assignments of 1H, 13C and 15N for Protein G Unfolded in 7.4M Urea, pH 2.0.",\N
16628,"16628","2010-07-19","2010-10-06","Sequence-specific 1H, 13C and 15N resonance assignments of the nucleotide-free wildtype cyclic nucleotide binding domain from a cyclic nucleotide-activated K+ channel",\N
16629,"16629","2012-08-03",\N,"solution structure of Helicobacter pylori SlyD",\N
16630,"16630","2010-08-23",\N,"1H, 13C and 15N NMR assignments of StnII-Y111N, a mutant of the sea anemone actinoporin Sticholysin II",\N
16632,"16632","2012-08-03","2012-12-07","Kalirin DH1 NMR structure",\N
16633,"16633","2010-08-12","2010-09-08","Solution structure of Bv8",\N
16634,"16634","2010-06-28","2010-08-12","Backbone Dynamics and Global Effects of an Activity Enhancing Mutation in Minimized Mtu RecA Inteins",\N
16635,"16635","2010-05-05",\N,"Solution structure of the N-terminal domain of Bacillus subtilis delta subunit of RNA polymerase",\N
16636,"16636","2010-05-05",\N,"NMR solution structure of the DNA binding domain of Competence protein A",\N
16637,"16637","2010-02-01","2010-05-19","Solution Structure of extended PDZ2 Domain from NHERF1 (150-270)",\N
16638,"16638","2010-02-01","2010-05-19","Solution Structure of human sodium/ hydrogen exchange regulatory factor 1(150-358).",\N
16639,"16639","2010-05-05",\N,"Structure of a complex between domain V of beta2-glycoprotein I and the fourth ligand-binding module from LDLR determined with Haddock.",\N
16640,"16640","2012-08-03",\N,"Solution NMR Structure of 26S protease regulatory subunit 8 from H.sapiens, Northeast Structural Genomics Consortium Target Target HR3102A","/ftp/pub/bmrb/timedomain/bmr16640"
16641,"16641","2011-05-04","2011-07-01","RDC refined solution structure of the first SH3 domain of CD2AP",\N
16642,"16642","2011-05-04","2011-07-01","High resolution structure of the second SH3 domain of CD2AP",\N
16643,"16643","2011-05-04","2011-07-01","RDC refined high resolution structure of the third SH3 domain of CD2AP",\N
16646,"16646","2010-05-13",\N,"Solution structure of the RBD1,2 domains from human nucleolin",\N
16647,"16647","2010-01-06",\N,"Solution NMR structure of SH3 domain from CPF_0587 (fragment 415-479) from Clostridium perfringens. Northeast Structural Genomics Consortium (NESG) Target CpR74A.","/ftp/pub/bmrb/timedomain/bmr16647"
16648,"16648","2010-07-26","2011-09-02","Solution NMR Structure of a Conserved Hypothetical Membrane Lipoprotein Obtained from Ureaplasma parvum: Northeast Structural Genomics Consortium Target UuR17A (139-239)","/ftp/pub/bmrb/timedomain/bmr16648"
16649,"16649","2010-02-22",\N,"Solution NMR structure of the PCP_red domain of light-independent protochlorophyllide reductase subunit B from Chlorobium tepidum. Northeast Structural Genomics Consortium Target CtR69A",\N
16652,"16652","2011-11-09",\N,"Solution NMR Structure of asl3597 from Nostoc sp. PCC7120. Northeast Structural Genomics Consortium Target ID Nsr244.",\N
16653,"16653","2010-05-05",\N,"1H, 13C and 15N resonance assignment of the PDZ domain of HtrA from Streptococcus pneumonia",\N
16654,"16654","2011-06-01",\N,"Solution structure of the human mitochondrial tRNAMet ASL containing the 5-formylcytidine modification in position 34",\N
16655,"16655","2011-06-01",\N,"Solution structure of the Human Mitochondrial tRNAMet",\N
16656,"16656","2010-01-19",\N,"Solution NMR structure of the Q251Q8_DESHY(21-82) protein from Desulfitobacterium Hafniense. Northeast Structural Genomics Consortium Target DhR8C.",\N
16657,"16657","2010-05-05","2011-08-16","Assignment and structural characterization of intrinsically disordered CDK inhibitor Sic1 from yeast",\N
16658,"16658","2010-05-20","2010-08-12","Heterodimeric association of Transmembrane domains of ErbB1 and ErbB2 receptors Enabling Kinase Activation",\N
16659,"16659","2010-05-05","2011-08-16","Assignment and structural characterization of intrinsically disordered CDK inhibitor phosphoSic1 from yeast",\N
16660,"16660","2011-03-17",\N,"SOLUTION CONFORMATION OF SUBSTANCE P IN WATER COMPLEXED WITH NK1R",\N
16661,"16661","2010-01-12","2014-05-20","Pf ACP with Transit Peptide",\N
16662,"16662","2010-05-05","2010-05-27","Solution NMR structure of apo Sterol Carrier Protein - 2 from Aedes aegypti (AeSCP-2)",\N
16663,"16663","2012-08-03","2014-05-20","NMR STRUCTURE OF HUMAN INSULIN MUTANT GLY-B8-D-ALA, HIS-B10-2 ASP PRO-B28-LYS, LYS-B29-PRO, 20 STRUCTURES",\N
16664,"16664","2010-05-05",\N,"Backbone 1H, 13C and 15N resonance assignments for lysozyme from bacteriophage lambda",\N
16665,"16665","2010-05-05","2010-05-27","Solution NMR structure of Sterol Carrier Protein - 2 from Aedes aegypti (AeSCP-2) complex with C16 fatty acid (palmitate)",\N
16666,"16666","2011-03-31",\N,"Sequence-specific 1H, 15N and 13C resonance assignments of Sugarcane defensin 5 (Sd5).",\N
16668,"16668","2010-02-16","2010-03-01","GTPase RhoA-GDP",\N
16669,"16669","2010-02-16","2010-03-01","GTPase RhoA GTPgS",\N
16670,"16670","2010-01-19",\N,"NMR structure of the apoptosis- and inflammation-related NALP1 pyrin domain",\N
16671,"16671","2010-02-23","2010-03-23","Mechanism for the selective interaction of C-terminal EH-domain proteins with specific NPF-containing partners",\N
16672,"16672","2010-05-18","2010-08-12","NMR structures of TM domain of the n-Acetylcholine receptor b2 subunit",\N
16673,"16673","2010-06-28","2010-10-06","backbone resonance assignment for the class A beta-lactamase Bacillus licheniformis BS3",\N
16674,"16674","2010-10-18","2011-05-05","NMR Solution structures of fully reduced cytochrome c3 from Desulfovibrio desulfuricans ATCC 2777",\N
16675,"16675","2010-05-05",\N,"The NMR structure of protein-glutaminase from Chryseobacterium proteolyticum",\N
16676,"16676","2011-05-19",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for Oryctin",\N
16677,"16677","2010-05-26","2010-08-12","Inter-molecular interactions in a 44 kDa interferon-receptor complex detected by asymmetric back-protonation and 2D NOESY",\N
16678,"16678","2010-06-01","2010-06-15","1H, 13C and 15N Chemical Shift Assignments for Sensory Rhodopsin II",\N
16679,"16679","2010-04-08","2010-05-18","1H, 13C and 15N assignment of the C terminal domain of GNA2132 from Neisseria meningitidis",\N
16680,"16680","2012-08-03",\N,"Solution structure of human stem cell transcription factor Nanog",\N
16681,"16681","2010-02-22",\N,"Solution NMR Structure of the SH3 Domain from the p85beta subunit of Phosphatidylinositol 3-kinase from H.sapiens. Northeast Structural Genomics Consortium Target HR5531E.",\N
16682,"16682","2010-10-18","2011-09-02","Lipocalin Q83 is a Siderocalin",\N
16683,"16683","2011-01-25",\N,"RRM domain of mRNA export adaptor REF2-I bound to HSV-1 ICP27 peptide",\N
16684,"16684","2010-02-08","2010-03-24","Structural homology between the C-terminal domain of the PapC usher and its plug",\N
16685,"16685","2010-07-27","2010-10-06","NMR resonance assignment of the major extracytoplasmic domain of MreC from Bacillus subtilis",\N
16686,"16686","2010-02-25",\N,"Solution NMR structure of mucin-binding domain of protein lmo0835 from Listeria monocytogenes. Northeast Structural Genomics Consortium Target LmR64A","/ftp/pub/bmrb/timedomain/bmr16686"
16687,"16687","2010-05-05","2012-07-10","1H, 13C and 15N assignments of the dimeric regulatory subunit (ilvN) of E.coli AHAS I",\N
16688,"16688","2010-02-25",\N,"Solution NMR structure of the CPE1231(468-535) protein from Clostridium perfringens. Northeast Structural Genomics Consortium Target CpR82B.","/ftp/pub/bmrb/timedomain/bmr16688"
16689,"16689","2010-05-18","2010-10-06","Backbone and side chain 1H, 15N and 13C assignments for a thiol-disulphide oxidoreductase from the Antarctic bacterium Pseudoalteromonas haloplanktis TAC125",\N
16690,"16690","2010-05-05","2010-05-27","Backbone 1H, 13C and 15N chemical shift assignments for the prolyl isomerase Ess1 from Candida albicans",\N
16691,"16691","2010-02-25",\N,"Solution NMR Structure of Probable 30S Ribosomal Protein PSRP-3 (Ycf65-like protein) from Synechocystis sp. (strain PCC 6803), Northeast Structural Genomics Consortium Target Target SgR46","/ftp/pub/bmrb/timedomain/bmr16691"
16692,"16692","2010-03-02",\N,"Solution NMR structure of a domain of protein A6KY75 from Bacteroides vulgatus, Northeast Structural Genomics target BvR106A",\N
16693,"16693","2011-01-25","2011-03-25","Solution Structure of a Novel hKv1.1 inhibiting scorpion toxin from Mesibuthus tamulus",\N
16694,"16694","2010-05-05",\N,"Solution Structure of the Second Bromodomain of Human Polybromo in complex with an acetylated peptide from Histone 3",\N
16695,"16695","2010-05-05","2010-06-15","Backbone Assignments for the HIV-1 Integrase Core Domain (residues 50-212)",\N
16696,"16696","2011-01-25",\N,"HSV-1 ICP27 (REF-interation) peptide backbone assignment in free form",\N
16697,"16697","2011-01-25",\N,"RRM domain of mRNA export adaptor REF2-I backbone assignment",\N
16698,"16698","2011-01-25",\N,"HVS ORF57 8-120 backbone assignment",\N
16699,"16699","2010-05-05","2010-05-27","1H Chemical Shift Assignments for gH617-644 fusion peptide from HSV-1 gH protein",\N
16700,"16700","2010-05-05","2010-05-27","1H Chemical Shift Assignments for gH626-639 fusion peptide from HSV-1 gH protein",\N
16701,"16701","2010-03-26",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for the C-terminal domain of Stt3p",\N
16703,"16703","2012-08-03",\N,"SPI2",\N
16704,"16704","2012-08-03",\N,"SPI2 (T7Y)",\N
16705,"16705","2012-08-03",\N,"SPI2 (T7A)",\N
16706,"16706","2010-03-31","2010-08-12","1H, 13C, and 15N chemical shift assignments for H2H2, a mini prion protein",\N
16707,"16707","2011-05-19",\N,"Spatial structure of Lch-alpha peptide from two-component lantibiotic Lichenicidin VK21",\N
16708,"16708","2010-05-07","2010-10-06","1H,13C,15N assignments of RNA recognition motifs 1 and 2 of BRUNOL-3",\N
16709,"16709","2011-05-19",\N,"Spatial structure of Lch-beta peptide from two-component lantibiotic system Lichenicidin VK21",\N
16710,"16710","2010-05-18","2010-08-12","Backbone and C-beta chemical shifts of Spider Roll, NESG target OR24",\N
16711,"16711","2012-08-03",\N,"NMR structure of the protein NP_415897.1",\N
16712,"16712","2010-04-26","2010-10-06","1H, 13C and 15N backbone and side-chain chemical shift assignments for oxidized desulthioredoxin",\N
16713,"16713","2010-04-26","2010-10-06","1H, 13C and 15N backbone and side-chain chemical shift assignments for reduced desulthioredoxin",\N
16714,"16714","2011-08-17","2014-05-20","Structure of a human Xist RNA A-repeat AUCG tetraloop hairpin essential for X-inactivation",\N
16715,"16715","2011-06-23",\N,"1H, 13C, and 15N Chemical Shift Assignments for human Vaccinia-Related Kinase-1 Lysozyme",\N
16716,"16716","2010-08-12","2010-09-08","Backbone chemical shifts of NI3C_Mut5 DARPin",\N
16717,"16717","2010-08-12","2010-09-08","Backbone chemical shifts of NI3C DARPin",\N
16718,"16718","2010-08-12","2010-09-08","Backbone chemical shifts of NI2C DARPin",\N
16719,"16719","2011-12-20","2012-08-23","Solution structure of Cytotoxic T-Lymphocyte Antigent-2(CTLA-2) like protein, Crammer",\N
16720,"16720","2010-05-18","2010-08-12","Horse prion protein",\N
16721,"16721","2012-08-03",\N,"Solution structure of BRD1 PHD1 finger",\N
16722,"16722","2010-05-18","2010-08-12","mPrP_D167S",\N
16723,"16723","2010-05-18","2010-08-12","mPrP_D1567D_N173K",\N
16726,"16726","2011-02-15",\N,"Resonance assignment of myristoylated Neuronal Calcium Sensor 1(NCS1) in membrane bound form.",\N
16727,"16727","2012-08-03",\N,"The solution structure of the monomeric antimicrobial peptide culbertcidin",\N
16729,"16729","2010-05-03","2010-05-19","NMR assignment of Salmonella typhimurium tip protein SipD",\N
16731,"16731","2010-03-22",\N,"Solution Structure of a putative disulphide-isomerase from Bacteroides thetaiotaomicron",\N
16732,"16732","2010-05-18",\N,"NMR structure of the PASTA domain 1 and 2 of Mycobacterium tuberculosis of PknB",\N
16733,"16733","2010-05-18",\N,"NMR structure of the PASTA domain 2 and 3 of Mycobacterium tuberculosis of PknB",\N
16734,"16734","2010-05-18",\N,"NMR structure of the PASTA domain 3 and 4 of Mycobacterium tuberculosis of PknB",\N
16735,"16735","2010-05-18","2010-08-19","NMR resonance assignment of the apo C-terminal polypeptide of the Anthrax Lethal Factor catalytic domain",\N
16736,"16736","2010-05-03",\N,"NMR STRUCTURE OF P62 PB1 DIMER DETERMINED BASED ON PCS",\N
16737,"16737","2011-05-20",\N,"1H,13C and 15N chemical shift assignment for NMB1343 apoprotein",\N
16738,"16738","2011-05-13","2011-07-01","solution structure of human vaccinia related kinase1(VRK1)",\N
16739,"16739","2010-06-01",\N,"1H, 13C, and 15N Chemical Shift Assignments for plectasin",\N
16740,"16740","2010-10-05","2010-10-14","Amide assignments for Paracoccus denitrificans amicyanin-ZnII.",\N
16741,"16741","2010-10-05","2010-10-14","Backbone assignments for Paracoccus denitrificans amicyanin-CuI.",\N
16742,"16742","2012-08-03","2014-05-20","Backbone 1H, 13C, and 15N Chemical Shift Assignments for Unfolded Bovine Pancreatic Ribonuclease A",\N
16743,"16743","2010-09-02",\N,"Three dimensional structure of HuPrP(90-231 M129 Q212P)",\N
16744,"16744","2010-05-18","2010-05-26","Structure and identification of ADP-ribose recognition motifs of APLF and role in the DNA damage response",\N
16745,"16745","2012-08-03",\N,"1H and 13C Chemical Shift Assignments for Antimicrobial Peptide Sm-AMP-1.1a",\N
16746,"16746","2010-03-31",\N,"Chemical shift assignment of GmR58A from Geobacter metallireducens. Northeast Structural Genomics Consortium Target GmR58A",\N
16747,"16747","2011-03-08",\N,"Glycocin A",\N
16748,"16748","2011-06-09",\N,"Complete 1H, 13C, and 15N Chemical Shift Assignments for AafA-dsc",\N
16749,"16749","2011-03-08","2012-03-15","Backbone Assignments of the PX Domain of Noxo1b",\N
16750,"16750","2010-05-03",\N,"backbone chemical shifts assignments of acid-denatured c-src SH3 with increasing urea concentration",\N
16752,"16752","2010-03-24",\N,"Mapping the Interacting Regions between Troponins T and C",\N
16764,"16764","2012-08-03",\N,"HALOTHANE BINDS TO DRUGGABLE SITES IN CALCIUM-CALMODULIN: Solution Structure of halothane-CaM N-terminal domain",\N
16766,"16766","2010-09-08","2010-12-09","Solution Structure of the human BLM HRDC domain",\N
16767,"16767","2010-08-12","2010-09-29","Human Regenerating Gene Type IV (REG IV) PROTEIN, P91S mutant",\N
16768,"16768","2011-11-28","2012-11-08","EGF",\N
16769,"16769","2010-08-12",\N,"Solution structure of the par toxin Fst in DPC micelles",\N
16770,"16770","2010-07-27",\N,"NMR solution structure of a soluble PrgI mutant from Salmonella Typhimurium",\N
16771,"16771","2011-05-19",\N,"Integrin beta3 subunit in a disulfide linked alphaIIb-beta3 cytosolic domain",\N
16772,"16772","2012-08-03",\N,"SOLUTION STRUCTURE OF CI-MPR ligand-free domain 5",\N
16773,"16773","2012-08-03",\N,"SOLUTION STRUCTURE OF CI-MPR domain 5 bound to N-acetylglucosaminyl 6-phosphomethylmannoside",\N
16774,"16774","2010-03-22","2011-06-01","Solution structure of the Mycobacterium tuberculosis protein Rv0543c, a member of the DUF3349 superfamily. Seattle Structural Genomics Center for Infectious Disease (SSGCID) target MytuD.17112.a",\N
16777,"16777","2012-08-03",\N,"nmr chemical shift of hahellin in 8 M urea",\N
16778,"16778","2011-05-26",\N,"Solution structure of the CBX7 chromodomain in complex with a H3K27me2 peptide",\N
16779,"16779","2010-06-28","2010-10-06","Backbone 1H, 13C, and 15N Chemical Shift Assignments for LMO2(LIM2)-Ldb1(LID)",\N
16780,"16780","2014-03-04",\N,"1H, 15N, 13C resonance assignments for CobR",\N
16781,"16781","2010-05-03","2010-05-19","Backbone chemical shift assignments for the microtubule binding domain of the Dictyostelium discoideum dynein heavy chain",\N
16782,"16782","2010-04-21","2010-12-02","Solution NMR structure of Photosystem II reaction center Psb28 protein from Synechocystis sp.(strain PCC 6803), Northeast Structural Genomics Consortium Target SgR171","/ftp/pub/bmrb/timedomain/bmr16782"
16783,"16783","2010-05-03","2010-10-06","Smr in bicelles",\N
16784,"16784","2010-05-03","2010-07-29","solution structure of conotoxin mr3c",\N
16785,"16785","2010-05-03","2010-07-28","solution structure of cis-4-hydroxyproline contained conotoxin cis-mr3c",\N
16786,"16786","2010-05-03","2010-07-29","solution structure of 4-hydroxyproline contained cis-conomarphin",\N
16787,"16787","2010-06-15","2010-08-12","NMR assignments for Thermus thermophilus Rieske protein at pH 5.2 at the reduced state",\N
16788,"16788","2011-05-02",\N,"Solution structure of NusE:NusG-CTD complex",\N
16789,"16789","2010-09-24",\N,"Solution NMR structure of human ubiquitin specific protease Usp7 UBL domain (residues 537-664). NESG target hr4395c/ SGC-Toronto",\N
16790,"16790","2010-03-31","2013-01-29","Solution NMR structure of uncharacterized protein CV0863 from Chromobacterium violaceum. NESG target CvT3. OCSP target CV0863.","/ftp/pub/bmrb/timedomain/bmr16790"
16791,"16791","2010-04-26",\N,"solution NMR structure of yaiA from Escherichia Eoli. Northeast Structural Genomics Target ER244",\N
16792,"16792","2010-04-26",\N,"Solution NMR Structure of SAP domain of MKL/myocardin-like protein 1 from H.sapiens, Northeast Structural Genomics Consortium Target Target HR4547E",\N
16794,"16794","2012-08-03",\N,"NMR Solution Structure of Q7A1E8 protein from Staphylococcus aureus: Northeast Structural Genomics Consortium target: ZR215",\N
16795,"16795","2010-04-26",\N,"Solution NMR of Putative excisionase from Klebsiella pneumoniae, Northeast Structural Genomics Consortium Target Target KpR49",\N
16796,"16796","2011-05-19",\N,"Solution NMR structure of the Cdt1 binding domain(CBD) in complex with the MCM6 binding domain (MBD)",\N
16797,"16797","2010-07-27",\N,"Structure of the three-Cys2His2 domain of mouse testis zinc finger protein",\N
16798,"16798","2011-05-02","2011-07-01","1H, 15N and 13C backbone resonance assignments of domain 3 of the non-structural 5A (NS5A) protein from Hepatitis C Virus (JFH-1)",\N
16799,"16799","2011-05-02","2011-07-01","1H, 15N and 13C backbone resonance assignments of domain 3 of the non-structural 5A (NS5A) protein from Hepatitis C Virus (JFH-1) in presence of 50%TFE",\N
16800,"16800","2011-05-02","2011-07-01","1H, 15N and 13C backbone resonance assignments of domain 3 of the non-structural 5A (NS5A) protein from Hepatitis C Virus (Con1) in presence of 50%TFE",\N
16801,"16801","2012-08-03",\N,"Structure of residues 160-235 of putative peptidoglycan binding protein lmo0835 from Listeria monocytogenes: target LmR64B of the Northeast Structural Genomics Consortium",\N
16802,"16802","2014-03-04",\N,"Solution structure of N-terminal domain of CcmH from Escherichia.coli",\N
16803,"16803","2010-04-28",\N,"1H, 13C and 15N backbone and side chain resonance assignment of the human RANTES-E66S mutant in a dimeric form",\N
16804,"16804","2010-06-15","2012-11-09","NMR assignments for Thermus thermophilus Rieske protein at pH 5.2 in oxidized state",\N
16805,"16805","2010-04-28",\N,"Solution NMR of the specialized acyl carrier protein (RPA2022) from Rhodopseudomonas palustris, Northeast Structural Genomics Consortium Target RpR324",\N
16806,"16806","2010-04-28",\N,"Solution NMR Structure of the Slr1183 protein from Synechocystis sp. PCC 6803. Northeast Structural Genomics Consortium Target Target SgR145.","/ftp/pub/bmrb/timedomain/bmr16806"
16807,"16807","2010-04-14",\N,"Solution NMR Structure of the Holo Form of a Ribonuclease H domain from D.hafniense, Northeast Structural Genomics Consortium Target Target DhR1A",\N
16808,"16808","2010-04-28",\N,"Solution NMR Structure of Cyclin-dependent kinase 2-associated protein 1 (CDK2-associated protein 1; oral cancer suppressor Deleted in oral cancer 1, DOC-1) from H.sapiens, Northeast Structural Genomics Consortium Target Target HR3057H",\N
16809,"16809","2012-08-03",\N,"Ensemble Structures of the binary complex between the SH3 and SH2 domain of interleukin-2 tyrosine kinase.",\N
16810,"16810","2010-04-28",\N,"Solution NMR Structure of the N-terminal domain of protein PG_0361 from P.gingivalis, Northeast Structural Genomics Consortium Target Target PgR37A",\N
16811,"16811","2010-05-28","2010-08-12","Solution Structure of Bacillus anthracis Sortase A (SrtA) Transpeptidase",\N
16812,"16812","2010-04-29","2010-07-15","data-driven model of MED1:DNA complex",\N
16813,"16813","2010-05-19",\N,"Solution NMR structure of the parkin Ubl domain in complex with the endophilin-A1 SH3 domain",\N
16814,"16814","2010-07-27",\N,"Structure of the three-Cys2His2 domain of mouse testis zinc finger protein",\N
16815,"16815","2010-07-27",\N,"Structure of the three-Cys2His2 domain of mouse testis zinc finger protein",\N
16816,"16816","2010-09-17",\N,"Solution NMR Structure of SAP domain of MKL/myocardin-like protein 1 from H.sapiens, Northeast Structural Genomics Consortium Target Target HR4547E",\N
16817,"16817","2010-06-15",\N,"Solution structure of dermcidin-1L, a human antibiotic peptide",\N
16818,"16818","2010-05-11",\N,"Solution structure of a novel Ubiquitin-binding domain from Human PLAA (PUBD, Gly76-Pro77 trans isomer)",\N
16819,"16819","2012-08-03",\N,"The solution structure of the dimeric culbertcidin",\N
16820,"16820","2012-08-03",\N,"SOLUTION STRUCTURE OF RIBOSOMAL PROTEIN S8E FROM Methanothermobacter thermautotrophicus, NORTHEASTSTRUCTURAL GENOMICS CONSORTIUM (NESG) TARGET TR71D",\N
16821,"16821","2012-08-03",\N,"SOLUTION NMR STRUCTURE OF TETRATRICOPEPTIDE REPEAT DOMAIN PROTEIN SRU_0103 FROM SALINIBACTER RUBER, NORTHEAST STRUCTURAL GENOMICS CONSORTIUM (NESG) TARGET SRR115C",\N
16822,"16822","2010-04-29","2010-05-19","Solution structure of Bacillus anthracis dihydrofolate reductase",\N
16824,"16824","2010-05-05",\N,"Solution Structure of the GTPase Binding Domain of WASP in Complex with EspFU, an EHEC Effector",\N
16831,"16831","2010-05-11",\N,"Solution structure of C-domain of Lsr2",\N
16832,"16832","2012-08-03",\N,"Structure of C-terminal domain from mtTyrRS of A. nidulans",\N
16833,"16833","2010-04-29",\N,"Minimal Constraint Solution NMR Structure of Translationally-controlled tumor protein (TCTP) from C.elegans, Northeast Structural Genomics Consortium Target Target WR73","/ftp/pub/bmrb/timedomain/bmr16833"
16834,"16834","2010-07-27",\N,"NMR structure of fully methylated GATC site",\N
16835,"16835","2010-05-11","2010-08-12","The NMR structure of the autophagy-related protein Atg8",\N
16837,"16837","2011-12-15","2012-08-23","HAV 3C C24S",\N
16838,"16838","2010-06-15","2010-10-06","Backbone 1H, 13C, and 15N chemical shift assignments of the extracellular domain of tissue factor",\N
16839,"16839","2010-05-10",\N,"Solution structure of the human chemokine CCL27",\N
16840,"16840","2010-08-19","2010-10-06","1H, 15N and 13C resonance assignment of Darcin, a Major Urinary Protein of the mouse",\N
16841,"16841","2010-09-08","2010-10-26","Chemical Shift Assignments of Fibronectin 6FnI1-2FnII7FnI",\N
16842,"16842","2011-05-23","2011-06-15","1H and 15N resonance assignments for fully reduced triheme cytochrome PpcA from Geobacter sulfurreducens",\N
16843,"16843","2012-08-03","2014-05-20","Seeing the Invisible: Structures of Excited Protein States by Relaxation Dispersion NMR",\N
16845,"16845","2010-10-14","2010-10-14","Cementoin backbone chemical assignment and spin relaxation",\N
16846,"16846","2010-05-10",\N,"Central B domain of Rv0899 from Mycobacterium tuberculosis",\N
16847,"16847","2010-04-30",\N,"Assignments for LC8 bound to a peptide corresponding to residues 233-249 of neuronal Nitric Oxide Synthase",\N
16848,"16848","2010-05-10",\N,"Solution structure of a novel Ubiquitin-binding domain from Human PLAA (PFUC, Gly76-Pro77 cis isomer).",\N
16849,"16849","2010-05-19",\N,"NMR Structure of Ni Substitued Desulfovibrio vulgaris Rubredoxin",\N
16851,"16851","2012-08-02","2014-05-20","The structure of E-protein activation domain 1 bound to the KIX domain of CBP/p300 elucidates leukemia induction by E2A-PBX1",\N
16852,"16852","2010-07-27","2010-11-18","Solution structure of a fully modified 2'-F/2'-OMe siRNA construct",\N
16853,"16853","2012-08-02","2013-05-23","NMR structure of the transmembrane and cytoplasmic domains of human CD4",\N
16854,"16854","2012-08-02",\N,"an eye lens fragment from human alpha-crystallin",\N
16856,"16856","2010-04-20","2010-05-03","Solution Structure of acyl carrier protein from Borrelia burgdorferi, Seattle Structural Genomics Center for Infectious Disease (SSGCID) consortium",\N
16857,"16857","2010-05-19",\N,"Human Jagged-1, exon 6",\N
16858,"16858","2010-09-03",\N,"Solution Structures of the double PHD fingers of human transcriptional protein DPF3b bound to a histone H3 peptide containing acetylation at lysine 14",\N
16859,"16859","2010-09-03",\N,"Solution structure of the double PHD (plant homeodomain) fingers of human transcriptional protein DPF3b bound to a histone N-terminal H3 peptide",\N
16860,"16860","2010-04-29","2011-10-05","Solution NMR structure of holo acyl carrier protein from Geobacter metallireducens refined with NH RDCs. Northeast Structural Genomics Consortium Target GmR141.","/ftp/pub/bmrb/timedomain/bmr16860"
16861,"16861","2010-09-03",\N,"Solution structure of the double PHD (plant homeodomain) fingers of human transcriptional protein DPF3b bound to a histone H4 peptide containing acetylation at lysine 16",\N
16862,"16862","2010-09-24","2010-10-05","Chemical shift assignments of CaBP1 with 3 Ca2+ bound",\N
16863,"16863","2010-06-15","2010-10-05","1H, 13C and 15N backbone and side chain resonance assignments of the N-terminal domain of the histidine kinase inhibitor KipI from Bacillus subtilis",\N
16864,"16864","2010-06-15","2013-06-17","Sequence Specific 1H, 13C and 15N backbone resonance assignments of uvi31+ from Chlamydomonas reinhardtii",\N
16865,"16865","2010-09-03",\N,"Solution structure of the double PHD (plant homeodomain) fingers of human transcriptional protein DPF3b bound to a histone H4 peptide containing N-terminal acetylation at serine 1",\N
16866,"16866","2010-04-29","2010-06-16","VAMP7(1-118):ISOLATED LONGIN DOMAIN",\N
16867,"16867","2010-04-29","2010-06-16","VAMP7(1-180):CYTOPLASMIC DOMAIN OF VAMP7.",\N
16868,"16868","2012-08-02",\N,"Solution structure of the aminoterminal domain of E. coli NusA",\N
16869,"16869","2010-07-27","2010-10-05","Backbone assignment of the catalytic core of a Y-family DNA polymerase",\N
16870,"16870","2011-09-28",\N,"1H, 13C, and 15N resonance assignments of the N-terminal domain of human Tubulin Cofactor C",\N
16871,"16871","2011-05-05",\N,"Solution structure of the second PDZ domain from human zonula occludens-1: A dimeric form with 3D domain swapping",\N
16872,"16872","2010-05-26","2010-08-12","Mcm10 C-terminal DNA binding domain",\N
16873,"16873","2010-07-27",\N,"NMR determination of protein pKa values in the solid state",\N
16874,"16874","2010-05-17",\N,"The solution structure of rat Lipocalin-type Prostaglandin D Synthase",\N
16876,"16876","2011-05-05","2012-03-15","1HN, 1HA, 13CA, 13CB, 13CO and 15N Chemical Shift Assignments for Intrinsically Disordered Dehydrin ERD14",\N
16877,"16877","2010-04-29","2010-05-19","Simultaneous recognition of HIV-1 TAR RNA bulge and loop sequences by cyclic peptide mimics of Tat protein",\N
16878,"16878","2010-07-27",\N,"NMR Structure of AIRE PHD Finger",\N
16879,"16879","2010-07-27","2010-10-05","Chemical shift assignments of the 3rd PDZ domain of protein tyrosine phosphatase basophil like (PTP-BL)",\N
16880,"16880","2010-10-14","2011-09-02","Solution Structure of UBM2 of murine Polymerase iota in Complex with Ubiquitin",\N
16881,"16881","2012-08-02",\N,"Solution NMR structure of of Streptomyces coelicolor polyketide cyclase SCO5315: Northeast Structural Genomics Consortium target RR365",\N
16882,"16882","2010-06-15",\N,"Solution Structure of the Ubiquitin-Binding Motif of Human Polymerase Iota",\N
16883,"16883","2010-06-15","2010-10-05","the N-terminal domain of human H-REV107",\N
16884,"16884","2011-12-15",\N,"1H, 13C and 15N Chemical Shift assignments for RRM3 of Brunol-3.",\N
16885,"16885","2010-10-14","2011-09-02","Solution Structure of UBM1 of murine Polymerase iota in Complex with Ubiquitin",\N
16886,"16886","2011-05-19",\N,"NS2 [27-59]",\N
16887,"16887","2010-08-12",\N,"Backbone 1H, 13C, 15N Chemical Shift Assignments for HIV-2 unmyristoylated matrix protein",\N
16888,"16888","2012-08-02","2013-05-24","Solution structure of the HIV-2 myristoylated Matrix protein",\N
16889,"16889","2012-08-02","2013-05-24","Solution structure of HIV-2 myrMA bound to di-C4-PI(4,5)P2",\N
16890,"16890","2010-07-27","2010-08-19","Structure of G61-101",\N
16891,"16891","2010-04-26",\N,"Backbone 1H, 13C and 15N Chemical Shift Assignments for the free alpha chain of human haemoglobin",\N
16892,"16892","2011-05-19",\N,"NS2 [60-99]",\N
16893,"16893","2010-06-16","2010-07-29","MDM4 binds ligands via an induced fit mechanism in which disordered regions become structured",\N
16894,"16894","2010-06-16","2010-07-28","MDM4 binds ligands via an induced fit mechanism in which disordered regions become structured",\N
16895,"16895","2011-05-02",\N,"The solution structure of UBB+1, frameshift mutant of ubiquitin B",\N
16897,"16897","2011-04-08",\N,"The solution structure of MTH1821",\N
16898,"16898","2010-05-27","2014-05-20","Backbone 1H, 13C and 15N Chemical Shift Assignments for the alpha chain of human haemoglobin bound to alpha-haemoglobin stabilizing protein (AHSP)",\N
16900,"16900","2010-06-16","2010-07-28","MDM4 binds ligands via an induced fit mechanism in which disordered regions become structured",\N
16901,"16901","2010-05-19",\N,"Solution structure of the relaxin-like factor",\N
16902,"16902","2010-07-26","2010-10-05","Backbone 1H, 15N, 13C and ile, leu, val sidechain CH3 Chemical Shift assignments for Aagglutinin-like ALS1 N-terminal domain",\N
16904,"16904","2010-09-28","2011-03-25","Backbone assignment of human alpha-synuclein in viscous 2 M glucose solution",\N
16905,"16905","2010-10-27","2011-03-25","Sma0114",\N
16907,"16907","2010-07-28","2013-10-25","The hemagglutinin fusion peptide (H1 subtype) at pH 7.4",\N
16908,"16908","2011-05-02",\N,"The high resolution structure of Ubiquitin like domain of UBLCP1",\N
16909,"16909","2012-01-04",\N,"1H, 13C, and 15N Chemical Shift Assignments for IRTKS-SH3 and EspFu-R47 complex",\N
16910,"16910","2011-05-02",\N,"Assignment of HN,HA,HB,N,CA,CB and C' of the STAS domain of motor protein Prestin (Anion Transporter SLC26A5)",\N
16911,"16911","2012-01-18","2012-03-15","Chemical Shift Assignments from PfEMP1: Structured Core",\N
16912,"16912","2010-10-05","2010-10-26","Delta subunit of RNA polymerase from Bacillus subtilis",\N
16913,"16913","2010-07-26","2010-09-15","The solution structure of the squash aspartic acid proteinase inhibitor (SQAPI)",\N
16914,"16914","2012-08-02",\N,"Solution strcture of UBX domain of human UBXD2 protein",\N
16915,"16915","2011-06-30","2012-03-15","Human Insulin Mutant A22Gly-B31Lys-B32Arg",\N
16916,"16916","2010-09-08","2011-03-25","Backbone 1H,13C, and 15N assignments of Streptococcus pneumoniae mevalonate diphosphate decarboxylase (spMDD) in complex with mevalonate 5-diphosphate (DPM) and AMPPCP",\N
16917,"16917","2011-05-23","2012-03-15","Receiver domain of sensor histidine kinase CKI1RD of Arabidopsis thaliana",\N
16918,"16918","2011-05-23","2012-03-15","Mg(2+)-bound receiver domain of sensor histidine kinase CKI1RD of Arabidopsis thaliana",\N
16919,"16919","2010-09-08","2011-03-25","Backbone 1H,13C, and 15N assignments of Streptococcus pneumoniae mevalonate diphosphate decarboxylase (spMDD) in apo-state",\N
16920,"16920","2011-03-24","2011-04-11","NMR structure of human Tra2beta1 RRM in complex with AAGAAC RNA",\N
16921,"16921","2010-07-26","2010-10-05","1H, 13C, 15N chemical shifts for the bacterial cell division regulator MinE.",\N
16922,"16922","2010-06-15","2010-07-09","Backbone structure of the membrane domain of E. coli histidine kinase receptor KdpD",\N
16923,"16923","2010-10-14","2010-11-09","Solution Structure of Smurf2 WW2 and WW3 bound to Smad7 PY peptide Smad7 PY motif containing peptide",\N
16925,"16925","2010-11-18","2013-01-02","Ligand Induced Changes in FKBP12 ps-ns Dynamics: The Free Enzyme",\N
16926,"16926","2011-01-06","2011-02-09","NMR Structure of Escherichia coli BamE, a Lipoprotein Component of the beta-Barrel Assembly Machinery Complex",\N
16927,"16927","2012-02-22",\N,"Solution structure of SuR18C from Streptococcus thermophilus. Northeast Structural Genomics Consortium Target SuR18C",\N
16928,"16928","2010-07-16","2010-10-14","1H, 13C and 15N chemical shift assignment of the N-terminal domain of the voltage-gated potassium channel-hERG",\N
16929,"16929","2010-12-02","2012-11-20","NMR structure and calcium-binding properties of the tellurite resistance protein TerD from Klebsiella pneumoniae",\N
16930,"16930","2010-10-14","2010-10-19","Chemical shift assignments of the Talin F2 domain (residues 196-309)",\N
16931,"16931","2010-11-18","2011-06-20","Ligand Induced Changes in FKBP12 ps-ns Dynamics: The Rapamycin-Bound Enzyme",\N
16932,"16932","2010-10-14","2010-10-19","Chemical shift assignments of the Talin F2F3 domain (residues 196-405)",\N
16933,"16933","2010-11-18","2011-01-19","Ligand Induced Changes in FKBP12 ps-ns Dynamics: FKBP12 in complex with rapamycin and the FRB domain from mTOR",\N
16934,"16934","2010-07-08",\N,"Solution NMR structure of the PBS linker domain of phycobilisome linker polypeptide from Anabaena sp. Northeast Structural Genomics Consortium Target NsR123E",\N
16935,"16935","2011-04-12","2011-07-01","Solution structure of the PECAM-1 cytoplasmic tail with DPC",\N
16936,"16936","2011-06-22","2011-09-02","Solution structure and dynamic analysis of chicken MBD2 methyl binding domain bound to a target methylated DNA sequence",\N
16937,"16937","2010-09-08","2011-01-19","apoWCBD4-6",\N
16939,"16939","2011-07-07","2011-12-15","WT alpha-synuclein fibrils",\N
16940,"16940","2010-07-26","2010-08-12","Backbone 1H, 13C, 15N assignments for hirugen bound PPACKed thrombin",\N
16941,"16941","2010-08-24","2011-01-19","Recognition of HIV TAR RNA by peptide mimetic of Tat protein",\N
16942,"16942","2012-08-02",\N,"Solution NMR Structure () from B.subtilis, Northeast Structural Genomics Consortium Target Target SR518","/ftp/pub/bmrb/timedomain/bmr16942"
16943,"16943","2010-08-19","2010-09-15","Solution structure of the leader sequence of the patellamide precursor peptide, PatE1-34",\N
16944,"16944","2010-06-22","2011-11-30","Chemical shift assignment of CpR82G from Clostridium perfringens. North East Structural Genomics Consortium Target CpR82g.",\N
16945,"16945","2011-05-05",\N,"solution structure of Ca-free chicken parvalbumin 3 (CPV3)",\N
16946,"16946","2010-08-18","2011-03-25","15N, 13C and 1H Resonance Assignments of the PAS domain of hERG (KV11.1)",\N
16947,"16947","2010-06-15","2010-07-09","Backbone structure of the membrane domain of E. coli histidine kinase receptor ArcB",\N
16948,"16948","2011-05-24",\N,"Resonance assignments of GTPase effector domain of Dynamin in the aprotic solvent deuterated Dimethyl Sulfoxide",\N
16949,"16949","2012-08-02",\N,"PDZ3 of ZO-1",\N
16950,"16950","2010-07-02","2010-07-09","The Structure of RNA Internal Loops with Tandem AG Pairs: 5'AAGU/3'UGAA",\N
16951,"16951","2010-07-02","2010-07-09","The Structure of RNA Internal Loops with Tandem AG Pairs: 5'GAGC/3'CGAG",\N
16952,"16952","2010-07-02","2010-07-09","The Structure of RNA Internal Loops with Tandem AG Pairs: 5'UAGA/3'AGAU",\N
16953,"16953","2010-07-02","2010-07-09","The Structure of RNA Internal Loops with Tandem AG Pairs: 5'UAGG/3'GGAU",\N
16954,"16954","2010-08-19","2010-09-29","Structure of the AML1-ETO Nervy Domain - PKA(RIIa) complex and its contribution to AML1-ETO activity",\N
16955,"16955","2011-05-05","2012-11-06","solution structure of calcium-bound CPV3",\N
16956,"16956","2010-08-19","2011-03-25","NMR assignments of 1H, 13C, 15N resonance in C-terminal subunit from Azotobacter vinelandii mannronan C5-epimerase 6 (AlgE6R3)",\N
16957,"16957","2010-09-24","2010-10-26","Solution structure of the voltage-sensing domain of KvAP",\N
16958,"16958","2010-08-19","2011-03-25","1H, 13C and 15N chemical shift assignments for ZCCHC9",\N
16959,"16959","2014-03-10",\N,"Chemical shift assignments of the Talin F1F2 double domain (residues 86-303 (&#8710; D139-D168))",\N
16960,"16960","2010-07-26",\N,"Solution structure of GxTX-1E",\N
16961,"16961","2012-08-02",\N,"Solution NMR structure of Dsy0195(21-82) protein from Desulfitobacterium Hafniense. Northeast Structural Genomics Consortium Target DhR8C.",\N
16962,"16962","2010-12-02","2011-01-19","1J and 2J coupling constants in human oxidized ERp18",\N
16963,"16963","2012-03-29",\N,"Structure of the scorpion toxin U1-Liotoxin-Lw1a",\N
16964,"16964","2010-06-30","2010-08-19","Solid-state NMR assignment of the globular domain of HET-s(1-227) prion protein in microcrystalline form.",\N
16965,"16965","2010-06-30","2010-08-19","Backbone NMR assignment of the globular domain of HET-s(1-227) prion protein.",\N
16966,"16966","2014-03-04",\N,"Insights into protein-protein and enzyme-substrate interactions in modular polyketide synthases",\N
16967,"16967","2012-09-20",\N,"Solution structure of MAST2-PDZ complexed with the C-terminus of PTEN",\N
16968,"16968","2010-06-22",\N,"The Solution Structure of a Conformationally Restricted Fully Active Derivative of the Human Relaxin-like Factor (RLF)",\N
16969,"16969","2010-07-26","2010-09-15","Structural basis for homodimerization of the Src-associated during mitosis, 68 kD protein (Sam68) Qua1 domain",\N
16970,"16970","2010-07-01","2014-05-20","Solution structure of the Bem1p SH3-CI domain from L.elongisporus in complex with Ste20p peptide",\N
16971,"16971","2011-01-06","2011-03-25","backbone and sidechain 1H, 13C, and 15N assignments for F-plasmid TraI 381-569",\N
16977,"16977","2010-08-19","2011-03-25","Resonance assignment of nsp7a from arterivirus",\N
16978,"16978","2011-08-03","2012-03-15","1H, 15N, 13C chemical shifts and structure of CKR-brazzein",\N
16979,"16979","2010-06-24",\N,"Solution structure of Enzyme IIB subunit of PTS system from Escherichia coli K12. Northeast Structural Genomics Consortium target ER315/Ontario Center for Structural Proteomics target ec0544",\N
16980,"16980","2010-07-26",\N,"RDC and RCSA refinement of an A-form RNA: Improvements in Major Groove Width",\N
16981,"16981","2010-07-08","2010-09-29","NMR Structure of the SARS Coronavirus Nonstructural Protein Nsp7 in Solution at pH 6.5",\N
16982,"16982","2010-08-19","2011-03-25","Backbone assignment of the D-allose binding protein from Escherichia coli in the apo form",\N
16983,"16983","2010-08-12",\N,"The solution structure of the PHD3 finger of MLL",\N
16984,"16984","2010-08-19","2011-03-25","Backbone assignments of D-allose binding protein from Escherichia coli in the complex form with D-allose",\N
16986,"16986","2010-07-26","2010-08-12","N-terminal domain of the DP1 subunit of an archaeal D-family DNA polymerase",\N
16988,"16988","2010-08-10",\N,"Solution NMR Structure of a domain of adhesion exoprotein from Pediococcus pentosaceus, Northeast Structural Genomics Consortium Target PtR41O",\N
16989,"16989","2010-08-12",\N,"Solution structure of the RRM domain of CYP33",\N
16991,"16991","2010-08-10",\N,"Solution NMR Structure of the N-terminal Domain of Putative ATP-dependent DNA Helicase RecG-related Protein from Nitrosomonas europaea, Northeast Structural Genomics Consortium Target NeR70A",\N
16992,"16992","2010-10-14","2011-03-25","1H,13C,15N backbone and sidechain assignment of human Raf kinase inhibitor protein from Escherichia coli",\N
16994,"16994","2011-06-01",\N,"Calmodulin, C-terminal domain, F92E mutant",\N
16995,"16995","2010-07-01",\N,"Solution structure of a bolA protein (ECH_0303) from Ehrlichia chaffeensis, the causative agent of human monocytic ehrlichiosis. Seattle Structural Genomics Center for Infectious Disease (SSGCID) target EhchA.10365.a",\N
16996,"16996","2011-06-01",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for human Rad51D from 1 to 83",\N
16997,"16997","2010-07-07",\N,"Solution structure of protein SF1141 from Shigella flexneri 2a. Northeast Structural Genomics Consortium (NESG) TARGET SFT2.",\N
16998,"16998","2010-07-09",\N,"Solution NMR Structure of Transcription factor NF-E2 45 kDa subunit DNA binding domain from Homo sapiens, Northeast Structural Genomics Consortium Target HR4653B","/ftp/pub/bmrb/timedomain/bmr16998"
16999,"16999","2010-07-07",\N,"Solution structure of protein CV0426 from Chromobacterium violaceum. NORTHEAST STRUCTURAL GENOMICS CONSORTIUM (NESG) TARGET CVT2.",\N
17000,"17000","2011-03-24","2011-05-27","Structure of E1-69 of Yeast V-ATPase",\N
17001,"17001","2010-09-24","2010-11-09","ASIP(80-132, P103A, P105A, Q115Y, S124Y)",\N
17002,"17002","2010-09-02",\N,"Solution NMR structure of the protein YP_510488.1",\N
17003,"17003","2010-10-14",\N,"Vpr(1-20) Vpr(21-40) Vpr(25-40)",\N
17005,"17005","2011-05-31",\N,"Three-dimensional structure of a truncated phosphoribosylanthranilate isomerase (residues 255-384) from Escherichia coli",\N
17006,"17006","2010-08-12","2010-09-24","Solution structure of alpha-mannosidase binding domain of Atg19",\N
17007,"17007","2010-08-12","2010-09-24","Solution structure of alpha-mannosidase binding domain of Atg34",\N
17008,"17008","2010-07-07",\N,"Solution NMR Structure of Peptide methionine sulfoxide reductase msrB from Bacillus subtilis, Northeast Structural Genomics Consortium Target SR10","/ftp/pub/bmrb/timedomain/bmr17008"
17009,"17009","2010-12-03","2011-01-19","Sequence specific backbone assignment of the C-terminal domain of MqsA",\N
17010,"17010","2010-07-09","2010-08-20","Backbone Amide relaxation parameters for wild-type Tryptophan Repressor",\N
17011,"17011","2012-04-10",\N,"s34r structure",\N
17012,"17012","2010-07-09","2011-03-31","Backbone Amide relaxation parameters for mutant L75F Tryptophan Repressor",\N
17013,"17013","2010-07-09","2011-03-31","Backbone Amide relaxation parameters for mutant A77V Tryptophan Repressor",\N
17015,"17015","2011-06-01",\N,"CUPIENNIN 1A, NMR, MINIMIZED AVERAGE STRUCTURE",\N
17016,"17016","2010-08-12","2012-11-07","solution structure of the CARMIL CAH3a/b domain bound to capping protein (CP_",\N
17017,"17017","2010-07-26",\N,"Solution NMR Structure of (Ubiquitin thioesterase OTU1 EC3.1.2.-) from Mus musculus, Northeast Structural Genomics Consortium Target MmT2A",\N
17018,"17018","2011-03-07",\N,"DAXX helical bundle (DHB) domain",\N
17019,"17019","2011-03-07",\N,"DAXX helical bundle (DHB) domain / Rassf1C complex",\N
17020,"17020","2012-08-02",\N,"Solution NMR structure of CV_0373(175-257) protein from Chromobacterium violaceum, Northeast Structural Genomics Consortium Target CvR118A","/ftp/pub/bmrb/timedomain/bmr17020"
17021,"17021","2010-07-26",\N,"Solution NMR Structure of Q8PSA4 from Methanosarcina mazei, Northeast Structural Genomics Consortium Target MaR143A",\N
17022,"17022","2010-08-19",\N,"Solution NMR Structure of A3DHT5 from Clostridium thermocellum, Northeast Structural Genomics Consortium Target CmR116",\N
17023,"17023","2012-08-02",\N,"Solution NMR structure of the ZNF216 A20 zinc finger",\N
17024,"17024","2012-08-02",\N,"Solution structure of the non-covalent complex of the ZNF216 A20 domain with ubiquitin",\N
17025,"17025","2010-08-23",\N,"Solution NMR Structure of protein BVU3908 from Bacteroides vulgatus, Northeast Structural Genomics Consortium Target BvR153",\N
17026,"17026","2010-08-23",\N,"Solution NMR Structure of protein BT2368 from Bacteroides thetaiotaomicron, Northeast Structural Genomics Consortium Target BtR375",\N
17027,"17027","2011-04-01","2011-04-11","NMR-derived spatial structure of water-soluble Lynx1",\N
17028,"17028","2010-09-24","2010-10-14","The Solution Structure of the C-terminal Ig-like Domain of the Bacteriophage Lambda Tail Tube Protein",\N
17029,"17029","2011-10-28",\N,"1H, 15N and 13C assignments for the potential GTPase binding domain of dictyostelium discoideum Fomin C",\N
17030,"17030","2010-07-07",\N,"Solution NMR Structure of the Ras-binding domain of Serine/threonine-protein kinase B-raf from Homo sapiens, Northeast Structural Genomics Consortium Target HR4694F","/ftp/pub/bmrb/timedomain/bmr17030"
17031,"17031","2010-08-24",\N,"Solution NMR structure of the PBS linker polypeptide domain of phycobilisome linker protein apcE from Synechocystis sp. Northeast Structural Genomics Consortium Target SgR209C","/ftp/pub/bmrb/timedomain/bmr17031"
17032,"17032","2011-08-17","2014-05-20","1H, 13C, and 15N chemical shifts and structure of brazzein-derived peptide CKR-PNG",\N
17033,"17033","2010-07-09",\N,"Solution NMR Structure of Nonsense mRNA reducing factor 3A from H. Sapiens, Northeast Structural Genomics Consortium Target HR4714B",\N
17034,"17034","2011-01-19","2011-02-16","1H and 15N Chemical Shift Assignments for the Syrian hamster prion protein shPrP(90-232)",\N
17035,"17035","2011-12-15",\N,"NMR Solution Structure of asr4154 from Nostoc sp. PCC7120 Northeast Structural Genomics Consortium target ID Nsr143",\N
17036,"17036","2010-08-24",\N,"SOLUTION STRUCTURE OF ZINC FINGER DOMAIN OF E3 UBIQUITIN-PROTEIN LIGASE PROTEIN Praja-1 FROM HOMO SAPIENS, NORTHEAST STRUCTURAL GENOMICS CONSORTIUM (NESG) TARGET HR4710B",\N
17038,"17038","2010-08-24",\N,"Solution NMR Structure of protein STY4237 (residues 36-120) from Salmonella enterica, Northeast Structural Genomics Consortium Target SlR115",\N
17039,"17039","2012-08-02",\N,"Solution NMR Structure of putative cell surface protein MA_4588 (272-376 domain) from Methanosarcina acetivorans, Northeast Structural Genomics Consortium Target MvR254A",\N
17040,"17040","2010-09-03","2010-11-18","STRUCTURAL AND FUNCTIONAL ANALYSIS OF TM VI OF THE NHE1 ISOFORM OF THE Na+/H+ EXCHANGER",\N
17041,"17041","2010-07-09","2011-03-31","Backbone dynamics of Tryptophan repressor protein in holo-form",\N
17042,"17042","2010-07-13",\N,"Backbone 1H, 15N, and 13C resonance assignment of rat-nNOS fragment (residues 134-298)",\N
17043,"17043","2014-03-05",\N,"TMS2 domain of Dengue virus NS4A protein",\N
17044,"17044","2010-09-24","2010-10-14","Solution structure of Rtt103 CTD-interacting domain bound to a Ser2 phosphorylated CTD peptide",\N
17045,"17045","2010-09-08","2011-03-25","KSR1 CA1 domain",\N
17046,"17046","2010-08-09","2011-03-31","Backbone dynamics of Tryptophan repressor L75F mutant protein in holo-form",\N
17047,"17047","2010-08-09","2011-08-16","Backbone dynamics of Tryptophan repressor A77V mutant protein in holo-form",\N
17048,"17048","2012-08-02","2014-05-20","AP180 aa 623-680 Backbone Assignment",\N
17050,"17050","2010-08-12","2010-09-29","Tudor domain from Drosophila Polycomblike",\N
17062,"17062","2010-08-19",\N,"Solution Structure of Human Plasminogen Kringle 3",\N
17063,"17063","2010-08-19",\N,"1H and 15N Chemical Shift Assignments of Mutated (K57D) Human Plasminogen Kringle 3",\N
17064,"17064","2011-01-19",\N,"13C, and 15N Chemical Shift Assignments for Anabaena sensory rhodopsin 1-229",\N
17065,"17065","2010-10-14","2011-03-25","Backbone 1H, 13C, and 15N Chemical Shift Assignments for the Binary Tandem Ubiquitin Binding Domains of Signal Transducing Adapter Molecule 1",\N
17066,"17066","2011-05-23",\N,"SOLUTION NMR STRUCTURE OF THE N-TERMINAL PAS DOMAIN OF HERG POTASSIUM CHANNEL",\N
17067,"17067","2010-11-15","2010-12-02","Complex hMia40-hCox17",\N
17068,"17068","2010-11-09","2010-11-18","Assigment of the 1H, 13C, and 15N resonances of the yeast frataxin (Yfh1) under cold denaturation",\N
17069,"17069","2010-08-24",\N,"Backbone dynamics of E73 from SSV-RH",\N
17070,"17070","2013-02-04","2013-04-15","SOLUTION STRUCTURE OF THE R6 DOMAIN OF TALIN",\N
17071,"17071","2010-08-18","2014-05-20","Solution NMR structure of the Cbx3 in complex with H3K9me3 peptide",\N
17072,"17072","2010-08-18","2014-05-20","Solution NMR structure of the chromobox protein 7 with H3K9me3",\N
17073,"17073","2010-10-22","2010-11-18","Structure of CBP nuclear coactivator binding domain in complex with p53 TAD",\N
17074,"17074","2010-10-22","2011-03-25","An arsenate reductase",\N
17075,"17075","2010-08-24","2010-11-18","Chemical shift assignments for Bacillus subtilis TatAd protein, the channel-forming component of the Tat protein transport system",\N
17076,"17076","2010-10-22","2011-03-25","An arsenate reductase",\N
17077,"17077","2010-10-22","2011-03-25","An arsenate reductase",\N
17078,"17078","2010-10-14","2011-03-25","1H, 15N chemical shift assignments of the imino groups in the base pairs of Escherichia coli tRNALeu (CAG)",\N
17079,"17079","2010-08-18","2014-05-20","Solution NMR structure ov the chromobox protein Cbx7 with H3K27me3",\N
17080,"17080","2010-09-02","2010-11-09","Shc-PTB:biphosphorylated integrin beta3 cytoplasmic tail complex (1:1)",\N
17081,"17081","2012-03-09",\N,"Mouse Prion Protein (121-231) with mutation Y169G",\N
17082,"17082","2012-08-02","2013-01-30","Mouse Prion Protein (121-231) with mutation F175A",\N
17083,"17083","2010-10-14","2010-12-02","Structure of a conserved retroviral RNA packaging element by NMR spectroscopy and cryo-electron tomography",\N
17084,"17084","2012-08-02",\N,"NMR structure of mouse PrP fragment 121-231 at 20 C.",\N
17085,"17085","2012-05-14",\N,"NMR structure of the HLTF HIRAN domain",\N
17086,"17086","2011-10-28",\N,"1H assignments for ASIP(93-126, P103A, P105A, P111A, Q115Y, S124Y)",\N
17087,"17087","2012-08-02",\N,"Mouse prion protein (121-231) with the mutations Y169A, Y225A, and Y226A.",\N
17088,"17088","2010-08-18","2010-11-09","Solution structure of the pseudouridine modified P6.1 hairpin of human telomerase RNA",\N
17089,"17089","2012-08-02",\N,"SH3-F2",\N
17090,"17090","2010-08-18",\N,"Solution NMR structure of the protein YP_399305.1",\N
17091,"17091","2011-06-01","2012-03-15","Zinc to cadmium replacement in the A. thaliana SUPERMAN Cys2His2 zinc finger induces structural rearrangements of typical DNA base determinant positions",\N
17092,"17092","2012-08-02",\N,"NMR solution structure of the N-terminal domain of DNA-binding protein SATB1 from Homo sapiens: Northeast Structural Genomics Target HR4435B(179-250)","/ftp/pub/bmrb/timedomain/bmr17092"
17103,"17103","2010-09-08","2010-11-09","The structure of the calcium-sensitizer, dfbp-o, in complex with the N-domain of troponin C and the switch region of troponin I",\N
17104,"17104","2010-08-18",\N,"YP_001336205.1",\N
17105,"17105","2010-08-18",\N,"Solution Structure of the N-terminal Domain of NP_954075.1",\N
17106,"17106","2010-08-19","2011-03-25","solution structure of a preQ1 riboswitch (Class I) aptamer bound to preQ1",\N
17107,"17107","2012-08-02",\N,"NMR STRUCTURE OF HUMAN INSULIN MUTANT GLY-B20-D-ALA, GLY-B23 2 PRO-B28-LYS, LYS-B29-PRO, 20 STRUCTURES",\N
17108,"17108","2012-08-02",\N,"NMR STRUCTURE OF HUMAN INSULIN MUTANT ILE-A2-LEU, VAL-A3-LEU 2 HIS-B10-ASP, PRO-B28-LYS, LYS-B29-PRO, 20 STRUCTURES",\N
17109,"17109","2014-03-04",\N,"The Structure of the Family D Sortase from Bacillus anthracis",\N
17110,"17110","2012-08-30","2014-03-04","chicken IGF2R domain 11",\N
17111,"17111","2012-08-30",\N,"Mupirocin didomain ACP",\N
17112,"17112","2010-12-08","2012-03-15","1H, 13C and 15N NMR Assignments of the C1B Subdomains of PKC-delta.",\N
17113,"17113","2010-12-08","2012-03-15","1H, 13C and 15N NMR Assignments of the C1A Subdomains of PKC-delta.",\N
17124,"17124","2011-05-04","2011-07-01","NP_888769.1",\N
17125,"17125","2011-05-18",\N,"SOLUTION STRUCTURE OF LACTOBACILLUS CASEI DIHYDROFOLATE REDUCTASE APO-FORM, 25 CONFORMERS",\N
17126,"17126","2010-09-02",\N,"NMR assigment of Heparanase construct Hep158-417",\N
17127,"17127","2012-08-30","2014-03-04","COMPLEX STRUCTURE OF E4 mutant HUMAN IGF2R DOMAIN 11 BOUND TO IGF-II",\N
17128,"17128","2014-03-04",\N,"unbound Cation-independent mannose-6-phosphate receptor domain 11 E4 mutant",\N
17129,"17129","2012-05-22",\N,"Chemical shifts of the 25-mer oligonucleotide encompassing the variable region of a MUC1 DNA aptamer.",\N
17130,"17130","2010-09-24",\N,"Zif 268 with 12bp DNA",\N
17131,"17131","2010-11-10","2011-01-19","NMR resonance assignment of the N-terminal domain of Latrodectus hesperus (black widow) major ampullate spider silk fibroin 1",\N
17132,"17132","2010-09-02",\N,"Solution Structure of human UBA-like domain of OTUD7A_11_83, NESG target HT6304a/OCSP target OTUD7A_11_83/SGC-Toronto",\N
17133,"17133","2011-01-25","2011-03-24","Chemical shift assignments for the RanBP2-type ZnF from Ewing's Sarcoma (EWS)",\N
17134,"17134","2014-03-04",\N,"Solution structure of Opossum Domain 11",\N
17135,"17135","2014-03-07",\N,"Mature Drosophila Frataxin Homolog (Dfh)",\N
17136,"17136","2010-10-26","2011-03-24","Rhodanese G",\N
17137,"17137","2010-10-26","2011-03-24","Rhodanese Y",\N
17138,"17138","2012-08-02",\N,"Solution structure of the coiled-coil complex between MBD2 and p66alpha",\N
17139,"17139","2011-06-07",\N,"Structure of ARC92VBD/MED25ACID",\N
17141,"17141","2010-09-28",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for HYL1-dsRBD2",\N
17143,"17143","2010-09-24",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for the first dsRBD of protein HYL1",\N
17144,"17144","2010-10-04","2011-03-24","1H, 13C, and 15N backbone, side-chain, and heme chemical shift assignments for the oxidized form of the monoheme c-type cytochrome ApcA isolated from the acidophilic metal-reducing bacterium Acidiphilium cryptum",\N
17145,"17145","2010-11-09","2011-03-24","Chemical Shifts of the R24H Pitx2 Homeodomain Mutant",\N
17146,"17146","2010-10-04","2011-03-24","1H, 13C, and 15N backbone, side-chain, and heme chemical shift assignments for the reduced form of the monoheme c-type cytochrome ApcA isolated from the acidophilic metal-reducing bacterium Acidiphilium cryptum",\N
17147,"17147","2010-11-09","2011-03-24","Chemical Shifts of the Pitx2 Homeodomain",\N
17148,"17148","2010-09-13","2012-03-15","N-terminal domain of Nephila clavipes major ampulate spidroin 1",\N
17149,"17149","2012-08-01",\N,"Folding Intermediate of the Fyn SH3 A39V/N53P/V55L from NMR Relaxation Dispersion Experiments",\N
17150,"17150","2010-09-16",\N,"Solution Structure of cellobiose-specific phosphotransferase IIB component protein from Borrelia burgdorferi. Seattle Structure Genomics Center for Infectious Disease (SSGCID).",\N
17151,"17151","2010-11-01",\N,"Solution structure of peptidyl-prolyl cis-trans isomerase from Burkholderia pseudomallei complexed with 1-{[(4-methylphenyl)thio]acetyl}piperidine. Seattle Structure Genomics Center for Infectious Disease (SSGCID)",\N
17152,"17152","2011-05-04","2012-03-15","Helical hairpin structure of a novel antimicrobial peptide EcAMP1 from seeds of barnyard grass (Echinochloa crus-galli)",\N
17153,"17153","2012-08-28",\N,"Thiostrepton",\N
17154,"17154","2012-08-28",\N,"Thiostrepton (oxidized 9:CA-CB)",\N
17155,"17155","2012-08-28",\N,"Thiostrepton (epimer 9:CA)",\N
17156,"17156","2012-08-28",\N,"Thiostrepton (reduced 14:N-CA)",\N
17157,"17157","2011-01-27","2011-03-07","DNA repair protein zinc finger 1",\N
17158,"17158","2011-01-27","2011-03-07","DNA repair protein zinc finger 2",\N
17159,"17159","2010-09-16","2010-10-05","Backbone assignment of the affibody-bound amyloid B-peptide",\N
17160,"17160","2010-11-09","2011-03-24","1H, 13C, 15N resonance assignment of the chitin-binding protein CBP21 from Serratia marcescens",\N
17161,"17161","2010-10-26","2011-03-24","Rna14p/Rna15p heterodimer",\N
17162,"17162","2010-11-09","2010-12-02","Backbone 1H, 13C, and 15N Chemical Shift Assignments for a photochromic fluorescent protein Dronpa in the bright state",\N
17163,"17163","2010-11-09","2010-12-02","Backbone 1H, 13C, and 15N Chemical Shift Assignments for a photochromic fluorescent protein Dronpa in the dark state",\N
17165,"17165","2011-02-04",\N,"Prion-like conversion during amyloid formation at atomic resolution",\N
17166,"17166","2011-02-04",\N,"Prion-like conversion during amyloid formation at atomic resolution",\N
17169,"17169","2010-10-01",\N,"Solution NMR Structure of DRBM 2 domain of Interleukin enhancer-binding factor 3 from homo sapiens, Northeast Structural Genomics Consortium Target HR4527E","/ftp/pub/bmrb/timedomain/bmr17169"
17170,"17170","2012-08-01",\N,"Resonance assignments of the Myb2 DNA binding domain in complex with its promoter MRE-1 from Trichomonas vaginalis",\N
17171,"17171","2012-08-01",\N,"The chemical shift assignment of the SWIRM domain of LSD1",\N
17172,"17172","2010-09-13",\N,"Bovine Pancreatic Ribonuclease A C-dimer",\N
17173,"17173","2011-03-30","2012-03-15","1H, 13C, and 15N chemical shift assignments of the Nrd1-CTD Interacting Domain",\N
17174,"17174","2012-03-09",\N,"MOUSE PRION PROTEIN FRAGMENT 121-231 AT 37 C",\N
17175,"17175","2010-11-05",\N,"Solution NMR structure of hepothetical homodimer protein SP_0782 (7-79) from Streptococcus pneumoniae, Northeast Structural Genomics Consortium Target SpR104.","/ftp/pub/bmrb/timedomain/bmr17175"
17176,"17176","2010-11-05","2014-06-09","Solution NMR structure of the BT_0084 lipoprotein from Bacteroides thetaiotaomicron, Northeast Structural Genomics Consortium Target BtR376.","/ftp/pub/bmrb/timedomain/bmr17176"
17177,"17177","2010-11-09","2010-12-14","Partial backbone 1H,15N chemical shift of arrestin-1",\N
17188,"17188","2010-10-26","2010-11-09","Solution structure of P2a-J2a/b-P2b of human telomerase RNA",\N
17189,"17189","2012-05-22",\N,"Pfu Rpp30 Free",\N
17190,"17190","2012-05-22",\N,"Complex Pfu Rpp30",\N
17191,"17191","2011-10-10",\N,"Solution NMR Structure of a putative Uracil DNA glycosylase from Methanosarcina acetivorans, Northeast Structural Genomics Consortium Target MvR76","/ftp/pub/bmrb/timedomain/bmr17191"
17192,"17192","2010-10-13",\N,"Solution NMR Structure of CH domain of Rho guanine nucleotide exchange factor 7 from Homo sapiens, Northeast Structural Genomics Consortium Target HR4495E","/ftp/pub/bmrb/timedomain/bmr17192"
17193,"17193","2010-09-24",\N,"NMR Structure in a Membrane Environment Reveals Putative Amyloidogenic Regions of the SEVI Precursor Peptide PAP248-286",\N
17194,"17194","2012-08-01",\N,"Oxki4a, spider derived antimicrobial peptide",\N
17195,"17195","2011-03-24",\N,"Backbone assignments for the UBA Domain of E2-25K",\N
17196,"17196","2012-08-01",\N,"Solution structure of the putative copper-ion-binding protein from Bacillus anthracis str. Ames",\N
17199,"17199","2011-03-30",\N,"Solution structure of Rap1-Taz1 fusion protein",\N
17200,"17200","2011-05-02","2012-03-15","NMR structure of UHRF1 Tandem Tudor Domains in a complex with Histone H3 peptide",\N
17201,"17201","2011-08-03","2014-05-20","Backbone assignment of the little finger domain of Y-family DNA polymerase Dpo4",\N
17202,"17202","2011-06-21","2012-03-15","Solution structure of tandem SH2 domain from Spt6",\N
17203,"17203","2010-11-01",\N,"NMR structure of Acyl carrier protein from Brucella melitensis. Seattle Structure Genomics Center for Infectious Disease (SSGCID)",\N
17204,"17204","2014-03-04",\N,"the 1H, 13C and 15N resonance assignment of ubiquitin-like small archaeal modifier protein from Haloferax volcanii",\N
17205,"17205","2011-03-07",\N,"Chemical shift of fully reduced Cox17 from Yeast.",\N
17206,"17206","2010-10-22",\N,"villin head piece domain of human ABLIM2",\N
17207,"17207","2010-10-06",\N,"Solution NMR Structure of the PBS linker domain of phycobilisome rod linker polypeptide from Synechococcus elongatus, Northeast Structural Genomics Consortium Target SnR168A","/ftp/pub/bmrb/timedomain/bmr17207"
17208,"17208","2011-05-05",\N,"Backbone 1H, 13C, and 15N chemical shift assignments for the nucleotide-binding domain of E.coli DnaK in the ADP.Pi-bound state",\N
17209,"17209","2011-05-05",\N,"Backbone 1H, 13C, and 15N chemical shift assignments for the nucleotide-binding domain of E.coli DnaK in the nucleotide-free state",\N
17210,"17210","2011-05-05",\N,"Backbone 1H, 13C, and 15N Chemical Shift Backbone 1H, 13C, and 15N chemical shift assignments for the nucleotide-binding domain of E.coli DnaK in the ATP-bound state",\N
17211,"17211","2011-06-23","2014-11-26","Backbone and partial sidechain assignments of a fragment comprising transmembrane helix 1 to transmembrane helix 3 of the Ste2p receptor in TFE/water",\N
17212,"17212","2011-03-30","2012-11-06","1H, 13C and 15N resonance assignment of Rap1 BRCT domain from Saccharomyces cerevisiae",\N
17213,"17213","2012-08-01",\N,"Mouse prion protein (121-231) with the mutation Y169A",\N
17214,"17214","2012-02-20","2013-05-24","A30P alpha-synuclein fibrils",\N
17226,"17226","2011-10-28","2012-03-15","1H, 15N, and 13C chemical shift assignments, and 15N dynamics for trHbN-cyanomet from M. tuberculosis",\N
17228,"17228","2012-03-09",\N,"C-terminal zinc knuckle of the HIVNCp7",\N
17229,"17229","2012-03-09",\N,"C-terminal zinc knuckle of the HIVNCp7 with DNA",\N
17231,"17231","2010-11-15","2011-03-24","Resonance assignments of ArsD",\N
17232,"17232","2012-07-25",\N,"Solution structure of the PlyG catalytic domain",\N
17233,"17233","2012-07-25",\N,"Solution structure of the PlyG cell wall binding domain",\N
17234,"17234","2011-02-24","2011-05-23","NMR structure of the DNA-binding domain of E.coli Lrp",\N
17235,"17235","2010-10-20",\N,"Solution structure of a putative acyl carrier protein from Anaplasma phagocytophilum. Seattle Structural Genomics Center for Infectious Disease (SSGCID) target AnphA.01018.a",\N
17236,"17236","2011-01-18","2011-03-24","cytochrome c domain of pp3183 protein from Pseudomonas putida",\N
17237,"17237","2013-06-04",\N,"NMR Structure of hFn14",\N
17238,"17238","2012-07-25",\N,"NMR structure of the UBA domain of S. cerevisiae Dcn1",\N
17239,"17239","2012-07-25",\N,"NMR structure of the UBA domain of S. cerevisiae Dcn1 bound to ubiquitin",\N
17240,"17240","2010-10-19","2010-12-02","INFLUENZA HEMEGGLUTININ FUSION PEPTIDE MUTANT G13A",\N
17241,"17241","2011-03-30","2011-05-03","YAP WW2",\N
17242,"17242","2013-07-01",\N,"Solution Structures of Oxidized and Reduced Thioredoxin C from M. tb","/ftp/pub/bmrb/timedomain/bmr17242"
17243,"17243","2011-06-01",\N,"The Solution Structure of Human Cardiac Troponin C in complex with the Green Tea Polyphenol; (-)-epigallocatechin-3-gallate",\N
17244,"17244","2012-07-25","2014-05-15","Structural basis for histone code recognition by BRPF2-PHD1 finger",\N
17245,"17245","2012-02-03",\N,"Solution Structure of the Chemokine CCL21",\N
17246,"17246","2011-03-30","2011-05-05","Solution structure of the Streptococcus pneumoniae RrgB pilus backbone D1 domain",\N
17247,"17247","2013-06-04",\N,"Solution NMR Structure of xenopus Fn14",\N
17249,"17249","2011-01-18","2012-03-15","1H, 13C and 15N resonances of the AlgE62 subunit from Azotobacter vinelandii mannuronan C5-epimerase",\N
17250,"17250","2012-07-25",\N,"GNA1946",\N
17251,"17251","2011-01-18","2012-03-15","the N-terminal domain of SARS-CoV main protease",\N
17252,"17252","2013-06-04",\N,"Solution NMR Structure of BCMA",\N
17253,"17253","2011-01-12","2011-05-19","1H and backbone 15N chemical shifts of a peptide inhibitor for the Malaria surface protein, Apical Membrane Antigen 1",\N
17254,"17254","2011-03-24","2011-05-05","Promiscuous Binding at the Crossroads of Numerous Cancer Pathways: Insight from the Binding of GIP with Glutaminase L",\N
17255,"17255","2011-03-24","2011-05-05","GIP/Glutaminase L peptide complex",\N
17256,"17256","2011-03-30",\N,"Solution structure of Ste5PM24 in the presence of SDS micelle",\N
17257,"17257","2011-05-19",\N,"NMR structure of the Xanthomonas VirB7",\N
17258,"17258","2011-08-17","2012-03-15","Resonance assignments and secondary structure of a phytocystatin from Ananas comosus",\N
17260,"17260","2011-02-10","2012-03-15","Backbone and side-chain 1H, 13C and 15N assignments of the UCHL1 S18Y variant",\N
17261,"17261","2010-11-15","2011-02-04","SOLUTION STRUCTURE OF APO S100A16",\N
17262,"17262","2010-11-15","2011-02-04","SOLUTION STRUCTURE OF CALCIUM BOUND S100A16",\N
17263,"17263","2011-01-18","2011-02-03","Solution structure of the small archaeal modifier protein 1 (SAMP1) from Methanosarcina acetivorans.",\N
17264,"17264","2010-12-22","2011-02-01","Solution NMR Structure of apo-calmodulin in complex with the IQ motif of Human Cardiac Sodium Channel NaV1.5",\N
17265,"17265","2011-06-07","2012-03-15","NMR structure of fusion of CtIP (641-685) to LMO4-LIM1 (18-82)",\N
17266,"17266","2011-02-10","2011-08-16","Solution structure of the C-terminal domain of SilB from Cupriavidus metallidurans",\N
17267,"17267","2010-11-08",\N,"Solution Structure of an Uncharacterized Thioredoin-like Protein from Clostridium perfringens",\N
17268,"17268","2013-07-01",\N,"Solution Structures of Oxidized and Reduced Thioredoxin C from M. tb",\N
17270,"17270","2011-05-18","2011-06-24","Complex between BD1 of Brd3 and GATA-1 C-tail",\N
17271,"17271","2011-01-18","2011-02-04","Co-ordinates and 1H, 13C and 15N chemical shift assignments for the complex of GPS2 53-90 and SMRT 167-207",\N
17272,"17272","2011-04-08","2011-05-13","Solution structures of human PIWI-like 1 PAZ domain",\N
17273,"17273","2011-04-08","2011-05-13","Solution Structures of human PIWI-like 1 PAZ domain with ssRNA (5'-pUGACA)",\N
17274,"17274","2012-05-22","2012-08-23","1H, 13C, and 15N Chemical Shift Assignments for the IIA(Chitobiose)-HPr Complex of the N,N'-Diacetylchitobiose Branch of the Escherichia coli Phosphotransferase System",\N
17275,"17275","2010-11-15",\N,"Solution Structure of Thioredoxin from Bacteroides Vulgatus",\N
17276,"17276","2011-10-28",\N,"Unbound TbRI-ED",\N
17277,"17277","2010-11-15",\N,"Solution Structure of a Putative Thioredoxin from Neisseria meningitidis",\N
17278,"17278","2010-11-15",\N,"NMR assignment of actin depolymerizing and dynamics regulatory protein from toxoplasma gondii",\N
17279,"17279","2011-05-05","2011-06-24","Solution NMR structure of protein lipocalin 12 from rat epididymis",\N
17280,"17280","2010-11-15",\N,"Solution NMR Structure of BVU_3817 from , Northeast Structural Genomics Consortium Target BvR159",\N
17281,"17281","2011-05-18","2011-06-30","Conformational and membrane interactins studies of antimicrobial peptide Alyteserin-1C",\N
17282,"17282","2012-08-29","2013-01-28","Solution Structure of apo-IscU(WT)",\N
17283,"17283","2011-01-18","2012-03-15","Sequence-specific 1H, 13C and 15N assignments of the phosphoesterase (PE) domain of Pseudomonas aeruginosa DNA ligase D (LigD)",\N
17284,"17284","2012-07-25",\N,"Solution NMR structure of E2 lipoyl domain from Thermoplasma acidophilum",\N
17285,"17285","2011-02-01","2011-04-11","Structure of the first PHD finger (PHD1) from CHD4 (Mi2b).",\N
17286,"17286","2012-07-25",\N,"Solution structure of the C-terminal domain of hRpn13",\N
17287,"17287","2012-11-05","2014-03-04","NMR solution structure ensemble of domain 11 of the echidna M6P/IGF2R receptor",\N
17288,"17288","2011-01-10","2012-03-15","1H, 13C, and 15N backbone and side-chain chemical shift assignment of the staphylococcal toxin MazF",\N
17289,"17289","2011-01-18","2011-01-27","NMR structure of calcium-loaded STIM2 EF-SAM.",\N
17290,"17290","2011-05-02","2012-03-15","Backbone and side chain assignments for the intrinsically disordered cytoplasmic domain of human neuroligin-3",\N
17291,"17291","2014-03-04",\N,"A novel design concept: New Y-receptor agonists with increased membrane recruitment, Y2 affinity and selectivity",\N
17292,"17292","2011-01-27","2011-06-01","NMR structure of the A730 loop of the Neurospora VS ribozyme",\N
17293,"17293","2012-01-09","2014-05-15","Solution structure of human J-protein co-chaperone Dph4",\N
17294,"17294","2011-03-28","2011-05-23","Protein and metal cluster structure of the wheat metallothionein domain g-Ec-1. The second part of the puzzle.",\N
17295,"17295","2011-03-28","2011-05-23","Protein and metal cluster structure of the wheat metallothionein domain g-Ec-1. The second part of the puzzle.",\N
17296,"17296","2011-03-30",\N,"NMR solution structure of GLP-2 in 2,2,2 trifluroethanol",\N
17297,"17297","2011-03-30",\N,"NMR Solution structure of GLP-2 in DHPC micelles",\N
17298,"17298","2011-01-18","2012-03-15","Resonance assignments of protein SSO1118 from hyperthermophilic archaeon Sulfolobus solfataricus P2",\N
17299,"17299","2011-02-04","2012-03-15","1H, 13C and 15N Chemical shift assignments of the thioredoxin from the anaerobic bacteria Desulfovibrio vulgaris Hildenborough",\N
17300,"17300","2011-02-04","2012-03-15","1H, 13C and 15N Chemical shift assignments of the thioredoxin from the anaerobic bacteria Desulfovibrio vulgaris Hildenborough",\N
17301,"17301","2011-06-01","2012-03-15","NMR Structure of an Archaeal DNA Binding Protein Sso7c4",\N
17302,"17302","2012-06-05",\N,"1H and 15N RESONANCE ASSIGNMENT OF HUMAN APO L-FABP",\N
17303,"17303","2012-06-05",\N,"1H and 15N RESONANCE ASSIGNMENT OF HUMAN HOLO L-FABP",\N
17304,"17304","2010-12-16",\N,"Solution NMR Structure of de novo designed rossmann 2x3 fold protein, Northeast Structural Genomics Consortium Target OR28",\N
17305,"17305","2011-12-02","2013-02-21","Three-dimensional structure of the N-terminal effector PYRIN domain of NLRP12",\N
17306,"17306","2011-03-21",\N,"NRC consensus ankyrin repeat protein backbone and sidechain assignments",\N
17307,"17307","2010-12-16",\N,"NMR Structure of the monomeric mutant C-terminal domain of HIV-1 Capsid in complex with stapled peptide Inhibitor",\N
17308,"17308","2011-01-18","2011-02-16","drosophila CstF-50 (1-65)",\N
17309,"17309","2011-03-09","2011-04-11","Solution structure of coronaviral stem-loop 2 (SL2)",\N
17310,"17310","2011-03-30","2014-05-15","L.casei DHFR-TRIMETHOPRIM complex",\N
17311,"17311","2011-03-30","2011-05-13","L.casei DHFR-NADPH complex",\N
17312,"17312","2012-01-04","2014-05-15","Tah1 complexed by MEEVD",\N
17313,"17313","2011-01-18","2011-02-16","drosophila CstF-50 (1-92)",\N
17314,"17314","2012-07-25",\N,"Solution Structure of a Nonphosphorylated Peptide Recognizing Domain",\N
17315,"17315","2011-10-25",\N,"Structure of C-terminal dsRBD of the Fission Yeast DICER (Dcr1)",\N
17316,"17316","2011-02-22","2011-04-12","Specifier domain and GA motif region of B. subtilis tyrS T box leader RNA",\N
17318,"17318","2010-12-16",\N,"NMR solution structure of the protein YP_001092504.1",\N
17319,"17319","2010-12-16",\N,"NMR solution structure of the protein NP_253742.1",\N
17320,"17320","2012-07-25",\N,"NMR structure of the protein YP_926445.1 from Shewanella Amazonensis",\N
17321,"17321","2011-11-07","2012-03-15","New high resolution NMR structure of gpW (W protein of bacteriophage lambda) at neutral pH",\N
17322,"17322","2012-09-20",\N,"High resolution NMR structure of gpW (W protein of bacteriophage lambda) at acidic pH",\N
17323,"17323","2010-12-22","2012-03-15","Solution NMR Structure of Med25(391-543) Comprising the Activator-Interacting Domain (ACID) of Human Mediator Subuniti 25. Northeast Structural Genomics Consortium Target HR6188A","/ftp/pub/bmrb/timedomain/bmr17323"
17324,"17324","2013-09-16",\N,"NMR Solution Structure of the winged-helix domain from MUS81 junction-specific endonuclease",\N
17325,"17325","2011-05-05","2012-03-15","1H, 13C and 15N resonance assignment of the 117 residue fragment of Engrailed 2, a partially disordered protein.",\N
17326,"17326","2012-01-24","2012-03-15","Shin-Dalgarno sequence of the hcnA gene of Pseudomonas fluourescens",\N
17327,"17327","2011-10-31","2012-03-15","Not known",\N
17328,"17328","2011-03-30","2011-05-13","magnesium bound CIB1",\N
17329,"17329","2011-03-30","2011-05-13","The Solution Structure of Calcium Bound CIB1",\N
17330,"17330","2011-06-01",\N,"NMR solution structure of GIP in micellular media",\N
17331,"17331","2011-06-01",\N,"NMR solution structure of GIP in Bicellular media",\N
17332,"17332","2012-07-25",\N,"Solution Structure of the talin Vbs2b domain",\N
17343,"17343","2011-03-30","2012-03-15","Structure of the NOXO1b PX domain",\N
17344,"17344","2011-02-01","2011-04-11","Solution structure of CHD4-PHD2 in complex with H3K9me3",\N
17345,"17345","2011-01-05",\N,"Solution NMR structure of human NFATC2IP ubiquitin-like domain, NFATC2IP_244_338, NESG target HT65A/OCSP target hs00387_244_338/SGC-toronto",\N
17346,"17346","2011-01-27","2011-03-24","Solution NMR structure of PAP248-286 in 50% TFE",\N
17347,"17347","2011-01-27","2011-03-24","Solution NMR structure of PAP248-286 in 30% TFE",\N
17350,"17350","2013-02-04",\N,"SOLUTION STRUCTURE OF THE R2 DOMAIN OF TALIN",\N
17351,"17351","2012-07-25",\N,"Ribonucleotide Perturbation of DNA Structure: Solution Structure of [d(CGC)r(G)d(AATTCGCG)]2",\N
17352,"17352","2011-03-30","2011-05-13","The structure of a domain from yeast",\N
17353,"17353","2012-07-25","2014-05-15","Androcam",\N
17354,"17354","2012-07-25","2014-05-15","high calcium androcam",\N
17355,"17355","2012-07-25",\N,"NMR solution structure of meACP",\N
17356,"17356","2011-05-05","2011-05-27","Biophysical studies of lipid interacting regions of DGD2 in Arabidopsis thaliana",\N
17357,"17357","2011-02-01","2012-03-15","PsbQ protein",\N
17358,"17358","2012-02-15",\N,"Solution structure of the third Immunoglobulin-like domain of nectin-1",\N
17359,"17359","2011-01-05",\N,"Solution NMR Structure of protein CD1104.2 from Clostridium difficile, Northeast Structural Genomics Consortium Target CfR130","/ftp/pub/bmrb/timedomain/bmr17359"
17360,"17360","2011-03-07","2011-05-13","Solution structure of Ca2+/calmodulin complexed with a peptide representing the calmodulin-binding domain of calmodulin kinase I",\N
17361,"17361","2011-08-03","2013-01-28","The Conformation of Bacteriorhodopsin Loops in Purple Membranes resolved by Solid-state MAS-NMR",\N
17362,"17362","2010-12-16","2014-05-15","Backbone assignments for E2-25K",\N
17363,"17363","2012-08-30",\N,"NMR Structure of the B domain of talin",\N
17364,"17364","2012-06-04","2013-04-29","The solution structure of the PTB Domain of TENC1 in complex with the peptide of DLC1",\N
17365,"17365","2011-05-02","2011-05-23","ASHH2 a CW domain",\N
17367,"17367","2012-07-25",\N,"Assignments of Drosophila cytotoxic T-lymphocyte antigen 2 (CTLA-2) like protein, crammer at pH3",\N
17368,"17368","2011-02-09","2012-03-15","Fyn SH2 free form",\N
17369,"17369","2011-02-09","2012-03-15","Fyn SH2 bound form",\N
17370,"17370","2011-01-05","2011-01-26","Solution NMR structure of conjugate transposon protein BVU_1572(27-141) from Bacteroides Vulgatus, Northeast Structural Genomics Consortium Target BvR155.","/ftp/pub/bmrb/timedomain/bmr17370"
17371,"17371","2011-01-24","2011-01-26","Solution NMR structure of N-terminal Ubiquitin-like domain of FUBI, a ribosomal protein S30 precursor from Homo sapiens. NorthEast Structural Genomics consortium (NESG) target HR6166",\N
17373,"17373","2011-01-14","2011-02-01","PDZ2 from human SAP97",\N
17374,"17374","2011-05-04","2011-10-05","1H, 13C and 15N resonance assignments for ADF/Cofilin from Trypanosoma brucei",\N
17375,"17375","2012-11-26",\N,"Assignment of Human Proliferating Cell Nuclear Antigen Complexed with a 20 Amino Acids Peptide from the C-terminal Region of p21 (WAF1/CIP1)",\N
17376,"17376","2012-11-26",\N,"Backbone Assignment of Human Proliferating Cell Nuclear Antigen Complexed with a 12 Amino Acids Peptide from the C-terminal Region of p21 (WAF1/CIP1)",\N
17377,"17377","2011-02-14","2012-10-31","Solution structure of the MFS-bound Sans CEN2 peptide",\N
17378,"17378","2011-05-18",\N,"Structure of CEL-PEP-RAGE V domain complex",\N
17379,"17379","2011-10-12","2012-03-13","QUI/G-quadruplex complex",\N
17380,"17380","2011-01-25","2011-03-24","rbp56 RanBP2 zinc finger backbone chemical shifts",\N
17381,"17381","2012-02-29",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for a putative surface protein",\N
17382,"17382","2011-02-15","2011-06-01","Solution structure of the human Raf-1 kinase inhibitor protein",\N
17383,"17383","2011-05-03","2011-06-30","Crimean Congo Hemorrhagic Fever Gn zinc finger",\N
17384,"17384","2011-05-04","2012-03-13","Backbone Assignment of the Tyrosine Kinase Src Catalytic Domain in Complex with Imatinib.",\N
17385,"17385","2011-01-28","2011-03-24","TEX13A RanBP2 zinc finger backbone chemical shifts",\N
17386,"17386","2011-01-28","2011-03-24","RBM10 RanBP2 zinc finger backbone chemical shifts",\N
17387,"17387","2011-01-28","2011-03-24","RBM5 RanBP2 zinc finger backbone chemical shifts",\N
17388,"17388","2011-12-14",\N,"Solution Structure of the Zinc Finger Domain of USP13",\N
17389,"17389","2011-01-31",\N,"Solution NMR Structure of the serine-rich domain of hEF1( Enhancer of filamentation 1) from homo sapiens, Northeast Structural Genomics Consortium Target HR5554A","/ftp/pub/bmrb/timedomain/bmr17389"
17390,"17390","2011-01-24",\N,"Solution NMR Structure of de novo designed protein, P-loop NTPase fold, Northeast Structural Genomics Consortium Target OR32","/ftp/pub/bmrb/timedomain/bmr17390"
17391,"17391","2012-01-11","2014-07-15","A protein from Haloferax volcanii",\N
17392,"17392","2011-02-09","2012-10-31","NMR Solution structures of CBP bromodomain with small molucule J28",\N
17393,"17393","2011-02-09","2011-05-24","Solution NMR structures of CBP bromodomain with small molecule of HBS",\N
17394,"17394","2012-06-19",\N,"Solution NMR structure of human amylin in SDS micelles at pH 7.3",\N
17395,"17395","2011-02-04","2012-08-29","The 27-residue N- terminus CCR5-peptide in a ternary complex with HIV-1 gp120 and a CD4-mimic peptide",\N
17396,"17396","2011-05-19","2011-06-01","1H, 13C, and 15N Chemical Shift Assignments for FCS domain from human polyhomeotic homolog 1",\N
17397,"17397","2011-05-12","2012-03-13","Solution structure of all parallel G-quadruplex formed by the oncogene RET promoter sequence",\N
17398,"17398","2011-12-20","2012-08-23","A protein from yeast",\N
17399,"17399","2011-12-20",\N,"Structure of a novel CBM3 lacking the calcium-binding site",\N
17400,"17400","2012-02-13",\N,"B. ste. A26I TRAP methyls",\N
17401,"17401","2011-02-04",\N,"NMR Spectroscopy and Molecular Dynamics Simulation of r(CCGCUGCGG)2 Reveal a Dynamic UU Internal Loop Found in Myotonic Dystrophy Type 1",\N
17402,"17402","2011-12-02","2012-03-13","Structure/function of the LBR Tudor domain",\N
17403,"17403","2011-03-07","2012-03-13","1H, 15N and 13C resonance assignment of the N-terminal C39-peptidase like domain of the ABC transporter Haemolysin B (HlyB)",\N
17404,"17404","2011-07-07","2012-12-07","Backbone (H,N,CA,HA,CB,HB) assignment of the Escherichia coli peptidyl-tRNA hydrolase",\N
17405,"17405","2011-05-03","2012-03-13","IPSE/alpha-1",\N
17406,"17406","2011-08-17","2012-03-13","Structure of a 4X4 Nucleotide RNA Internal Loop from an R2 Retrotransposon",\N
17407,"17407","2012-06-04","2012-08-23","The complex structure of homeodomain in solution",\N
17408,"17408","2012-08-14",\N,"Chemical probe bound to HIV TAR RNA",\N
17409,"17409","2012-01-05",\N,"A biocompatible backbone modification? - Structure and dynamics of a triazole-linked DNA duplex",\N
17410,"17410","2011-08-17","2012-04-10","1H, 15N and 13C backbone chemical shift assignment of the titin A67-A68 domain tandem",\N
17411,"17411","2011-05-03","2011-06-30","Backbone 1H, 13C, and 15N Chemical Shift Assignments for CHIP (carboxyl terminal of Hsc70-interacting protein)",\N
17412,"17412","2011-06-02","2011-07-01","GABARAPL-1 NBR1-LIR complex structure",\N
17413,"17413","2012-02-13",\N,"B. ste. A26I Holo TRAP Ile, Leu, and Val methyls",\N
17414,"17414","2012-01-04",\N,"Structure of an engineered splicing intein mutant based on Mycobacterium tuberculosis RecA",\N
17415,"17415","2011-02-23","2011-04-01","Reduced and CO-bound cytochrome P450cam (CYP101A1)",\N
17416,"17416","2011-02-16",\N,"Aquifex aeolicus LpxC/CHIR-090 complex",\N
17417,"17417","2011-04-08","2012-03-13","mutant C335A, K309C of the Nek2 kinase leucine zipper",\N
17418,"17418","2011-05-03","2011-09-13","Backbone and sidechain assignments of intein from DNA polymerase II of Pyrococcus abyssi",\N
17419,"17419","2011-08-03","2014-07-15","NMR STRUCTURE OF THE CYTIDINE REPRESSOR DNA BINDING DOMAIN IN PRESENCE OF OPERATOR HALF-SITE DNA",\N
17420,"17420","2011-02-04",\N,"Solution structure of Chr148 from Cytophaga hutchinsonii. Northeast Structural Genomics Consortium Target Chr148",\N
17421,"17421","2011-03-08",\N,"Solution structure of human protein C6orf130 in complex with ADP-ribose",\N
17422,"17422","2011-02-09","2011-02-23","Solution Structure of a DNA Duplex Containing the Potent Anti-Poxvirus Agent Cidofovir",\N
17423,"17423","2011-02-09","2011-02-23","Solution Structure of a DNA Duplex Containing the Potent Anti-Poxvirus Agent Cidofovir",\N
17424,"17424","2012-08-14","2014-05-15","Solution NMR Structure of Transmembrane and Cytosolic Regions of Integrin 1 in Detergent Micelles",\N
17425,"17425","2011-08-17","2012-03-13","Staphylococcus aureus pathogenicity island 1 protein gp6, an internal scaffold in size determination",\N
17426,"17426","2011-11-03","2012-03-13","Solution structure of SFTI-OPN, a pro-angiogenic peptide with osteopontin sequence grafted into SFTI-1 cyclic framework",\N
17427,"17427","2011-03-08","2011-04-01","Chemical Shift Assignments for p21-KID Bound to Cdk2 and Cyclin A in Solution",\N
17428,"17428","2012-08-14",\N,"AIDA1 PTB domain",\N
17429,"17429","2011-02-11",\N,"Solution NMR structure of the phycobilisome linker polypeptide domain of CpcC (20-153) from Thermosynechococcus elongatus, Northeast Structural Genomics Consortium Target TeR219A","/ftp/pub/bmrb/timedomain/bmr17429"
17430,"17430","2011-06-07","2012-03-13","Spatial structure of antimicrobial peptide Arenicin-2 dimer in DPC micelles",\N
17431,"17431","2011-04-08","2011-05-24","Solution structure of the E. coli outer membrane protein RcsF (periplasmatic domain)",\N
17432,"17432","2012-01-09","2013-08-08","Solution structure of murine myristoylated msrA",\N
17433,"17433","2011-12-20","2012-08-23","Structure of the Integrin beta3(A711P,K716A) Transmembrane Segment",\N
17436,"17436","2011-06-16","2012-03-13","Structure of the HIV-1 frameshift site RNA bound to a small molecule inhibitor of viral replication",\N
17437,"17437","2011-03-09",\N,"1H, 13C and 15N backbone chemical shift assignments of the UBC domain of Ube2S",\N
17438,"17438","2012-01-30","2014-04-23","LAK160-P7",\N
17439,"17439","2011-03-09",\N,"1H, 13C and 15N backbone chemical shift assignments of ubiquitin at pH 7.2",\N
17440,"17440","2011-02-24","2011-03-07","Structure of trans-Resveratrol in complex with the cardiac regulatory protein Troponin C",\N
17441,"17441","2012-02-14","2014-04-23","LAK160-P10",\N
17442,"17442","2012-02-14","2014-04-23","LAK160-P12",\N
17443,"17443","2011-05-12","2011-07-01","Solution structure of human ubiquitin conjugating enzyme Rad6b",\N
17444,"17444","2011-03-09","2011-03-24","transmembrane domain of LR11/SorLA",\N
17445,"17445","2014-03-05",\N,"1H 15N 13C Backbone Assignment of Akap79 'M' domain, a human A-kinase anchor protein 5",\N
17446,"17446","2012-08-14",\N,"1H 15N 13C Backbone Assignment of Sap97 N terminal region and PDZ1 domain",\N
17447,"17447","2012-08-30","2014-07-15","1H, 15N and 13C resonance assignment of a common Major Urinary Protein of the mouse",\N
17448,"17448","2011-03-08",\N,"Solution structure of the protein YP_546394.1, the first structural representative of the pfam family PF12112",\N
17449,"17449","2011-03-08","2012-03-13","Solution Structure of the human Anti-codon Stem and loop(hASL) of transfer RNA Lysine III (tRNALys3)",\N
17450,"17450","2011-08-17",\N,"Solution structure of AS1p-Tar in 10% negatively charged bicelles",\N
17451,"17451","2011-05-03","2012-03-13","Central domain of RSV M2-1",\N
17452,"17452","2012-08-14",\N,"Chemical Shifts of the Pitx2 Homeodomain in complex with a TAAGCT non-consensus DNA site",\N
17453,"17453","2011-08-17",\N,"Oligomeric Structure of the Chemokine CCL5/RANTES from NMR, MS, and SAXS Data",\N
17454,"17454","2011-08-17",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for human PMP22 (WT)",\N
17455,"17455","2011-08-17",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for human TrJ disease-related mutant form of PMP22",\N
17456,"17456","2012-09-24","2014-05-15","1H, 15N, 13C chemical shift assignment of the THAP domain 1-81 from the cell growth suppressor human THAP11 protein",\N
17458,"17458","2011-12-08","2012-03-13","NMR STRUCTURE OF THYMOSIN ALPHA-1",\N
17466,"17466","2011-12-12","2012-03-13","Solution structure of the RING finger-like domain of Retinoblastoma Binding Protein-6 (RBBP6)",\N
17467,"17467","2011-03-08","2012-08-23","NMR assignment of the second B3 domain of VERNALIZATION1 from Arabidopsis thaliana",\N
17468,"17468","2011-05-03","2012-03-13","Resonance assignment of a 179 residue fragment of hepatitis C virus non-structural protein 5A",\N
17471,"17471","2011-12-12",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for p38 alpha MAPK",\N
17472,"17472","2011-05-19","2011-07-01","TRPV5 C-terminal peptide",\N
17473,"17473","2011-03-07","2011-04-11","Backbone 1H and 15N Chemical Shift Assignments for chimeric fusion of S. cerevisiae and C. albicans Sup35",\N
17474,"17474","2011-06-01","2012-03-13","Backbone 1H, 13C, and 15N Chemical Shift Assignments for CD147 Ig0 C66M domain.",\N
17475,"17475","2011-06-01","2012-03-13","Structural basis of p63a SAM domain mutants involved in AEC syndrome",\N
17476,"17476","2011-03-08",\N,"The solution structure of the ZnF UBP domain of USP33/VDU1.",\N
17477,"17477","2012-08-31","2013-02-07","NMR Structure of the Mouse MFG-E8 C2 Domain",\N
17478,"17478","2011-05-12","2011-06-30","Structure of cIAP1 CARD",\N
17479,"17479","2011-05-05",\N,"Structure of the human Shwachman-Bodian-Diamond syndrome (SBDS) protein",\N
17481,"17481","2011-05-02",\N,"Solution NMR Structure of Q5HLI9 from Staphylococcus epidermidis, Northeast Structural Genomics Consortium Target SeR147",\N
17482,"17482","2011-10-26","2012-03-13","Structural Characterization of small heat shock protein (Hsp12)",\N
17483,"17483","2011-10-26","2012-03-13","Structural characterization of small heat shock protein (Hsp12) in aqueous solution",\N
17484,"17484","2012-06-05",\N,"Solution NMR Structure of Homeobox domain of Homeobox protein Nkx-3.1 from homo sapiens, Northeast Structural Genomics Consortium Target HR6470A","/ftp/pub/bmrb/timedomain/bmr17484"
17485,"17485","2011-03-30","2011-05-13","Solution structure of Pf1 SID1-mSin3A PAH2 Complex",\N
17487,"17487","2011-06-07",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for ICL3 of 5TH1A receptor",\N
17488,"17488","2011-05-10",\N,"Spatial structure of dimeric ErbB3 transmembrane domain",\N
17489,"17489","2011-06-07","2012-08-23","1H, 13C, and 15N Chemical Shift Assignments for the FF domain L24A mutant",\N
17490,"17490","2011-06-22","2012-03-09","Solution Structure of the C-terminal domain of Prp24",\N
17491,"17491","2011-06-22","2012-03-09","Backbone Resonance Assignments for the C-terminus of Prp24",\N
17492,"17492","2011-05-05","2011-05-19","Trn- peptide of the two-component bacteriocin Thuricin CD",\N
17493,"17493","2011-05-06","2011-05-19","Solution structure of the MoCVNH-LysM module from the rice blast fungus Magnaporthe oryzae protein (MGG_03307)",\N
17494,"17494","2011-06-01","2011-06-30","Zinc knuckle in PRDM4",\N
17495,"17495","2011-05-05","2011-05-19","Trn- peptide of the two-component bacteriocin Thuricin CD",\N
17496,"17496","2011-06-01",\N,"Solution Structure of the PilZ Domain Protein PA4608 Complex with Cyclic Di-GMP Identifies Charge Clustering as Molecular Readout",\N
17497,"17497","2011-05-19",\N,"SNX-17-PX-DOMAIN",\N
17498,"17498","2011-07-13","2012-04-10","Solid-state NMR assignment of alpha-synuclein amyloid fibrils",\N
17499,"17499","2011-09-29","2012-03-09","Solid-state NMR assignment of the Ure2p prion C-terminal 70-354 in microcrystalline form.",\N
17500,"17500","2011-11-03","2012-03-09","Papiliocin",\N
17501,"17501","2011-03-25",\N,"The NMR structure of the protein NP_344798.1 reveals a CCA-adding enzyme head domain",\N
17502,"17502","2012-03-01",\N,"NMR STRUCTURE OF THE C-TERMINAL RRM DOMAIN OF POLY(U) BINDING 1",\N
17503,"17503","2012-02-17",\N,"Staphylococcus aureus FusB",\N
17504,"17504","2011-06-07","2011-07-08","RNA Duplex-Quadruplex Junction Complex with FMRP RGG peptide",\N
17505,"17505","2011-06-07","2012-04-10","1H, 13C, and 15N Chemical Shift Assignments for human muscle Acylphosphatase",\N
17506,"17506","2012-06-19",\N,"Backbone and CB assignment of N-terminal Domain of Ribosomal Protein L9 (NTL9) native state",\N
17507,"17507","2011-03-14",\N,"DJ-1 backbone assignment",\N
17508,"17508","2011-05-02",\N,"Solution NMR Structure of RRM domain of RNA-binding protein FUS from homo sapiens, Northeast Structural Genomics onsortium Target HR6430A","/ftp/pub/bmrb/timedomain/bmr17508"
17509,"17509","2011-03-25",\N,"NMR structure of the protein YP_557733.1 from Burkholderia xenovorans",\N
17510,"17510","2011-07-07","2012-04-10","1H, 13C and 15N backbone and side-chain resonance assignments of Drosophila melanogaster Ssu72",\N
17511,"17511","2011-04-04","2011-04-11","Backbone 1H, 13C, and 15N Chemical Shift Assignments for Leucine Zipper GCN4 coiled coil and x-form conformations.",\N
17512,"17512","2011-06-07","2012-11-06","1H, 13C, and 15N resonance assignments for S. aureus primase C-terminal domain",\N
17513,"17513","2012-01-30","2012-03-09","Towards an atomistic level understanding of the unfolded state of Immunity protein 7 in non-denaturing conditions",\N
17514,"17514","2012-08-07",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for Leucine Zipper c-Jun.",\N
17515,"17515","2011-09-01",\N,"solution structure of INAD PDZ5 complexed with Kon-tiki peptide",\N
17517,"17517","2011-08-02","2012-03-09","Pseudouridine_ASL_Tyr",\N
17518,"17518","2012-08-07",\N,"Solution Strucuture of CBM25-1 of beta/alpha-amylase from Paenibacillus polymyxa",\N
17519,"17519","2012-08-07",\N,"Solution Strucuture of CBM25-2 of beta/alpha-amylase from Paenibacillus polymyxa",\N
17520,"17520","2011-08-02","2012-08-23","Unmodified_ASL_Tyr",\N
17521,"17521","2011-06-01","2012-03-08","Solution structure of an E. coli lipoprotein",\N
17523,"17523","2011-06-08","2012-04-10","Backbone and side-chain 1H, 15N, and 13C resonance assignments of Norwalk virus protease",\N
17524,"17524","2011-05-09",\N,"Solution NMR Structure of Mitotic checkpoint serine/threonine-protein kinase BUB1 N-terminal domain from Homo sapiens, Northeast Structural Genomics Consortium Target HR5460A","/ftp/pub/bmrb/timedomain/bmr17524"
17525,"17525","2012-01-18",\N,"ATR13 Chemical Shifts",\N
17526,"17526","2011-06-30","2012-03-08","EcNusB bound to BoxA RNA",\N
17527,"17527","2011-04-11",\N,"Structure of epidermal growth factor-like repeat 12 of mouse Notch-1 receptor",\N
17528,"17528","2011-04-11",\N,"Structure of epidermal growth factor-like repeat 12 of mouse Notch-1 receptor",\N
17529,"17529","2011-06-23",\N,"Third WW domain of human Nedd4L in complex with doubly phosphorylated human smad3 derived peptide.",\N
17530,"17530","2011-04-11",\N,"Solution NMR structure of the AHSA1-like protein RHE_CH02687 (1-152) from Rhizobium etli, Northeast Structural Genomics Consortium Target ReR242","/ftp/pub/bmrb/timedomain/bmr17530"
17531,"17531","2011-05-27","2011-06-30","Three-dimensional structure of the cyclotide Cter M",\N
17532,"17532","2011-06-07","2013-01-28","NMR structure of Ca2+-bound CaBP1 C-domain with RDC",\N
17533,"17533","2011-05-03","2011-05-19","Solution structure of the Sex Peptide from Drosophila melanogaster",\N
17534,"17534","2012-05-10",\N,"NMR resonance assignment of the autoimmunity protein SpaI from Bacillus subtilis ATCC 6633",\N
17535,"17535","2011-05-12",\N,"DNA / RNA Hybrid containing a central stereo specific Rp borano phosphate linkage",\N
17536,"17536","2011-12-14","2012-03-08","Molecular Determinants of Paralogue-Specific SUMO-SIM Recognition",\N
17537,"17537","2011-06-03","2011-06-30","Solution structure of a Human minimembrane protein OST4",\N
17538,"17538","2011-06-23",\N,"Structure of the second WW domain from human YAP in complex with a human Smad1 derived peptide",\N
17539,"17539","2011-06-23",\N,"Structure of first WW domain of human YAP in complex with a human Smad1 doubly-phosphorylated derived peptide.",\N
17540,"17540","2011-06-23","2012-12-07","Structure of the first WW domain of human YAP in complex with a mono-phosphorylated human Smad1 derived peptide",\N
17541,"17541","2011-06-23",\N,"Structure of the first domain of human Smurf1 in complex with a monophosphorylated human Smad1 derived peptide.",\N
17542,"17542","2011-06-23",\N,"Structure of the first domain of human Smurf1 in complex with a doubly phosphorylated human Smad1 derived peptide.",\N
17543,"17543","2011-06-23","2011-12-15","Structure of the second domain of human Smurf1 in complex with a human Smad1 derived peptide containing a PY motif",\N
17544,"17544","2011-06-23",\N,"Structure of the second domain of human Nedd4L in complex with a doubly phosphorylated human Smad3 derived peptide.",\N
17545,"17545","2011-06-23",\N,"Structure of the first domain of human PIN1 in complex with a human Smad3 derived peptide.",\N
17546,"17546","2011-05-03",\N,"Refined Structural Basis for the Photoconversion of A Phytochrome to the Activated FAR-RED LIGHT-ABSORBING Form",\N
17547,"17547","2011-10-26",\N,"Hevein-type Antifungal Peptide with a Unique 10-Cysteine Motif",\N
17549,"17549","2011-05-04","2011-05-19","Backbone Resonance Assignment of the von-Willebrand-factor-A-like domain 2 of type VII collagen",\N
17550,"17550","2011-07-05",\N,"Backbone assignments of the IDOL RING domain",\N
17551,"17551","2012-05-10",\N,"Solution structure of chicken ileal BABP in complex with glycochenodeoxycholic acid",\N
17552,"17552","2012-05-10",\N,"Backbone resonance chemical shift assignments of Ph SAM linker",\N
17553,"17553","2011-04-11",\N,"Solution structure of acyl CoA binding protein from Babesia bovis T2Bo. Seattle Structure Genomics Center for Infectious Disease (SSGCID)",\N
17554,"17554","2012-03-05",\N,"solution structure of tandem UBA of USP13",\N
17555,"17555","2012-05-10",\N,"Chemical shift assignments of the VBS1 domain of talin",\N
17557,"17557","2011-12-14","2012-08-23","Solution structure of the dimerization domain of human ribosomal protein P1/P2 heterodimer",\N
17558,"17558","2011-12-05","2012-03-08","Structure of the CHR of the Prion protein in DPC Micelles",\N
17559,"17559","2012-01-24","2012-03-08","Assignment of the stem loop 2 of RsmZ",\N
17560,"17560","2012-01-24","2012-03-08","Assignment of the stemloop 4 of RSMZ",\N
17561,"17561","2012-04-03",\N,"Solution Structure of the Dimeric Form of a Unliganded Bovine Neurophysin, Minimized Average Structure",\N
17562,"17562","2012-04-02",\N,"N2-dG:N2-dG interstrand cross-link induced by trans-4-hydroxynonenal",\N
17563,"17563","2012-04-04",\N,"Glycyl-tRNA(GCC) anticodon stem-loop from Bacillus subtilis",\N
17564,"17564","2012-04-04",\N,"Glycyl-tRNA(UCC)1B anticodon stem-loop from Staphylococcus epidermidis",\N
17565,"17565","2012-04-04",\N,"Unmodified Glycyl-tRNA(UCC) anticodon stem-loop from Bacillus subtilis",\N
17566,"17566","2012-01-24","2012-03-08","22 nt artificial stemloop TASL1",\N
17567,"17567","2012-01-24","2012-03-08","26 nt artificial stemloop TASL2",\N
17568,"17568","2012-01-24","2012-03-08","30 nt artificial stemloop TASL3",\N
17569,"17569","2011-06-16","2011-07-08","Solution structure of the ADD domain of ATRX complexed with histone tail H3 1-15 K9me3",\N
17570,"17570","2012-06-19",\N,"Solid-state NMR assignment of the C-terminal domain of the Ure2p prion in its fibrillar form",\N
17571,"17571","2012-04-03",\N,"(Revised) SOLUTION STRUCTURE OF THE MONOMERIC FORM OF A MUTANT UNLIGANDED BOVINE NEUROPHYSIN, 20 STRUCTURES.",\N
17572,"17572","2011-08-02","2012-03-08","i6A37_tyrASL",\N
17573,"17573","2011-08-02","2012-03-08","Conformation Effects of Base Modification on the Anticodon Stem-loop of Bacillus subtilis tRNATYR",\N
17574,"17574","2011-08-03",\N,"Structure of a yeast RNase III dsRBD complex with a non-canonical RNA substrate provides new insights into substrate recognition",\N
17575,"17575","2012-01-04","2012-03-08","solution structure of the C domain of Rv0899 from mycobacterium tuberculosis",\N
17576,"17576","2011-05-12",\N,"1H, 13C, and 15N assignments of wild-type gamma-S crystallin",\N
17577,"17577","2011-10-12","2012-03-08","Siderocalin Q83 reveals a dual ligand binding mode",\N
17578,"17578","2011-06-30","2014-05-15","Solution structure of the S. cerevisiae H/ACA RNP protein Nhp2p-S82W mutant",\N
17579,"17579","2011-06-30","2014-05-15","H/ACA RNP protein Nhp2p",\N
17580,"17580","2012-02-10",\N,"Myc G-quadruplex formed at the 5'-end of NHEIII element",\N
17581,"17581","2012-05-09","2014-02-27","Solution structure of the skeletal muscle and neuronal voltage gated sodium channel antagonist mu-conotoxin CnIIIC",\N
17582,"17582","2011-05-12",\N,"1H, 13C, and 15N assignments of cataract-related variant gamma-S-G18V crystallin",\N
17583,"17583","2011-08-17","2012-03-08","Thurincin H",\N
17584,"17584","2011-12-02","2012-03-08","1H 13C 15N resonance assignment of CD4+ T cell-derived peptide Thp5",\N
17585,"17585","2011-10-26",\N,"Rv0020c_Nter structure",\N
17586,"17586","2011-10-26",\N,"Rv0020c_FHA Structure",\N
17587,"17587",\N,\N,"Complement control protein module pair of human complement component C7.",\N
17588,"17588","2012-05-09",\N,"Solution structure of the RXLR effector P. capsici AVR3a4",\N
17589,"17589","2011-06-22","2012-03-08","Backbone Resonance Assignments for Prp24-RRM3",\N
17590,"17590","2011-06-22","2012-03-08","Backbone assignments of Anabaena Sensory Rhodopsin Transducer with D-tails",\N
17591,"17591","2011-06-22","2012-03-08","Backbone assignments of Anabaena Sensory Rhodopsin Transducer with F-tails",\N
17592,"17592","2011-06-22","2012-03-08","Backbone assignments of Anabaena Sensory Rhodopsin Transducer with DNA",\N
17593,"17593","2012-08-07",\N,"NMR analysis of TM1_TM2 in TFE:water(0.1%TFA) (1:1)",\N
17594,"17594","2012-08-07",\N,"Solution NMR structure of a helical bundle domain from human E3 ligase HECTD1. Northeast structural genomics consortium (NESG) target HT6305A",\N
17595,"17595","2011-12-14","2012-08-23","NMR resonance assignments for an archaeal homolog of the endonuclease Nob1 involved in ribosome biogenesis",\N
17596,"17596","2011-08-19","2012-04-10","Backbone and sidechain 1H, 13C and 15N chemical shift assignments of the hydrophobin DewA from Aspergillus nidulans",\N
17597,"17597","2011-05-19","2012-04-10","Chemical shift assignments for Rv0577, a putative glyoxylase associated with virulence from Mycobacterium tuberculosis. Seattle Structural Genomics Center for Infectious Disease (SSGCID) target MytuD.17269.a.",\N
17598,"17598","2011-12-20",\N,"Solution Structure of PilP from Pseudomonas aeruginosa",\N
17599,"17599","2011-12-01",\N,"Solution structure of Par-6 Q144C/L164C",\N
17600,"17600","2011-12-01",\N,"Solution structure of the isolated Par-6 PDZ domain",\N
17601,"17601","2011-12-02","2012-03-08","Solution structure of the MLV readthrough pseudoknot",\N
17602,"17602","2012-08-23",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments of wildtype phosphomannomutase/phosphoglucomutase",\N
17603,"17603","2011-09-01","2012-03-08","Solution Structure of a Minor and Transiently Formed State of a T4 Lysozyme Mutant",\N
17604,"17604","2011-09-01","2012-03-08","Solution Structure of a Minor and Transiently Formed State of a T4 Lysozyme Mutant",\N
17606,"17606","2012-02-06","2012-04-10","Solution structure of RBBP1 chromobarrel domain",\N
17607,"17607","2012-05-09",\N,"Solution structure of RBBP1 tudor domain",\N
17608,"17608","2011-10-12","2013-01-28","RLIP76 (GAP-GBD)",\N
17609,"17609","2011-06-01",\N,"Chemical shift assignment of Hr4436B from Homo Sapiens, Northeast",\N
17610,"17610","2012-05-09","2012-05-17","Solution structure of GppNHp-bound H-RasT35S mutant protein.",\N
17611,"17611","2011-06-01",\N,"Solution NMR structure of protein Rmet_5065 from Ralstonia metallidurans. Northeast Structural Genomics Consortium Target CrR115.","/ftp/pub/bmrb/timedomain/bmr17611"
17612,"17612","2011-06-01",\N,"Solution NMR Structure of a Protein With a Redesigned Hydrophobic Core, Northeast Structural Genomics Consortium Target OR38",\N
17613,"17613","2011-06-01",\N,"Solution NMR Structure of DE NOVO DESIGNED PROTEIN, P-LOOP NTPASE FOLD, Northeast Structural Genomics Consortium Target OR36","/ftp/pub/bmrb/timedomain/bmr17613"
17614,"17614","2011-08-02","2012-03-07","Structure of the mitochondrial uncoupling protein 2 determined by NMR molecular fragment replacement",\N
17615,"17615","2012-07-30",\N,"Solution Structure of RfaH carboxyterminal domain",\N
17616,"17616","2012-05-09",\N,"Backbone Resonance assignment of 1H, 13C, 15N for P2 of plasmodium falciparum in 9M urea.",\N
17617,"17617","2011-06-03",\N,"IIIS4",\N
17618,"17618","2012-04-11",\N,"1H and 15N assignments of WALP19-P10 peptide in SDS micelles",\N
17619,"17619","2012-04-11",\N,"1H and 15N assignments of WALP19-P8 peptide in SDS micelles",\N
17620,"17620","2011-06-03","2014-02-27","1H,15N and 13C Assignment of the D2 domain of the Human Fibroblast Growth Factor Receptor 4",\N
17621,"17621","2011-12-20",\N,"Solution structure of the EF-hand domain of Human Polycystin 2",\N
17622,"17622","2011-08-03","2012-01-27","Solution structure of the closed conformation of human U2AF65 tandem RRM1 and RRM2 domains",\N
17623,"17623","2011-08-03",\N,"MODEL OF HUMAN U2AF65 TANDEM RRM1 AND RRM2 DOMAINS WITH EIGHT-SITE URIDINE BINDING",\N
17625,"17625","2011-06-01","2011-06-30","Microvirin:mannobiose complex",\N
17626,"17626","2011-10-12","2012-03-07","Backbone 1H, 13C, and 15N Chemical Shift Assignments for Act2-EF34 in complex with palladin peptide",\N
17627,"17627","2011-06-03",\N,"1H, 13C, and 15N chemical shift assignments for apo actinin-2 C-terminal EF-hand (Act2-EF34)",\N
17628,"17628","2012-08-30","2014-02-27","NMR Structure of Alk1 extracellular domain",\N
17629,"17629","2011-06-03",\N,"Yeast Nbp2p SH3 domain in complex with a peptide from Ste20p",\N
17630,"17630","2014-02-24","2014-02-27","Backbone 1H, 13C, and 15N Chemical Shift Assignments for Human Just Another Zinc Finger Protein residues 23-117",\N
17631,"17631","2014-02-24",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for human JAZ ZF2",\N
17632,"17632","2011-06-03","2011-06-30","Solution structure of the Vav1 SH2 domain complexed with a Syk-derived doubly phosphorylated peptide",\N
17633,"17633","2012-02-03","2012-04-10","NMR structure of BC28.1",\N
17634,"17634","2011-06-22","2012-03-07","Structure of the Cytidine Repressor DNA-Binding Domain; an alternate calculation",\N
17635,"17635","2012-06-04",\N,"solution structure of FUS/TLS RRM domain",\N
17636,"17636","2011-09-13","2012-04-10","1H, 13C, and 15N NMR resonance assignments of reduced full length and shortened forms of the Grx domain of Mus musculus TGR",\N
17637,"17637","2011-09-13","2012-04-10","1H, 13C, and 15N NMR resonance assignments of reduced full length and shortened forms of the Grx domain of Mus musculus TGR",\N
17638,"17638","2011-06-22","2011-08-03","NMR Structure of the Complete Internal Fusion Loop from Ebolavirus GP2 at pH 5.5",\N
17639,"17639","2011-06-22","2011-08-03","NMR Structure of the Complete Internal Fusion Loop from Ebolavirus GP2 at pH 7.0",\N
17640,"17640","2012-06-04",\N,"EL222(14-222)",\N
17641,"17641","2012-05-09",\N,"Assigment of the 1H, 13C, and 15N resonances of the yeast frataxin (Yfh1) under heat denaturation (50 C)",\N
17642,"17642","2012-08-30","2013-08-13","Solution structure of the N-terminal domain of huntingtin (htt17) in 50 % TFE",\N
17643,"17643","2011-08-22","2012-03-07","Backbone 1H, 13C, and 15N Chemical Shift Assignments for full-length YtvA from Bacillus subtilis",\N
17644,"17644","2012-08-30","2013-08-13","Solution structure of the N-terminal domain of huntingtin (htt17) in presence of DPC micelles",\N
17645,"17645","2012-08-30","2013-01-28","Solution structure of myosin VI lever arm extension",\N
17646,"17646","2011-06-30",\N,"Solution structure of the N-terminal domain of human anamorsin",\N
17647,"17647","2011-10-12","2012-03-07","Backbone 13C, 15N, 1H chemical shift assignment of a thermostable mutant \"6B\" of a Lipase from Bacillus Subtilis",\N
17648,"17648","2011-07-07","2011-12-15","Partial 13C,15N chemical shift assignments of A30P alpha-synuclein fibrils",\N
17649,"17649","2011-07-07","2011-12-15","Partial 13C, 15N chemical shift assignments of A53T alpha-synuclein fibrils",\N
17650,"17650","2011-08-19","2012-04-10","1H, 13C, and 15N resonance assignments and secondary structure prediction of the full-length transition state regulator AbrB from Bacillus anthracis",\N
17651,"17651","2011-10-12",\N,"Solution Structure of Histidine Phosphotransfer Domain of CheA",\N
17652,"17652","2012-08-07",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments of S108C mutant of phosphomannomutase/phosphoglucomutase",\N
17653,"17653","2011-10-26",\N,"solution structure of the mSin3A PAH3-SAP30 SID complex",\N
17654,"17654","2011-07-07","2011-12-15","Partial 13C, 15N chemical shift assignments of E46K alpha-synuclein fibrils",\N
17655,"17655","2011-08-02",\N,"Structure of Human Telomeric DNA in Crowded Solution",\N
17656,"17656","2011-08-17","2012-04-10","1H, 13C and 15N NMR assignments of inactive form of P1 endolysin Lyz",\N
17657,"17657","2011-10-26",\N,"Solution structure of the estrogen receptor-binding stapled peptide SP2 (Ac-HKXLHQXLQDS-NH2)",\N
17658,"17658","2011-10-26",\N,"Solution structure of the estrogen receptor-binding stapled peptide SP1 (Ac-HXILHXLLQDS-NH2)",\N
17659,"17659","2011-10-26",\N,"Solution structure of the estrogen receptor-binding stapled peptide SP6 (Ac-EKHKILXRLLXDS-NH2)",\N
17660,"17660","2012-07-11","2012-08-23","Backbone 1H, 13C, and 15N Chemical Shift Assignments for LmrA-NBD",\N
17661,"17661","2012-05-09",\N,"Solution structure of the long sarafotoxin srtx-i3",\N
17662,"17662","2012-05-09",\N,"Solution structure of the long sarafotoxin srtx-m",\N
17663,"17663","2011-09-01",\N,"HVS ORF57 56-140 backbone assignment",\N
17664,"17664","2011-09-01",\N,"HVS ORF57 103-120 backbone assignment",\N
17665,"17665","2011-10-19","2011-10-28","human alpha synuclein construct",\N
17667,"17667","2011-06-24",\N,"1H, 13C & 13N chemical shift assignments for Toxoplasma gondii Microneme protein 4 (MIC4) residues 410-491 (apple domain 5)",\N
17668,"17668","2011-11-22","2013-03-27","NMR solution structure of ZiaAN sub mutant",\N
17669,"17669","2011-06-24","2013-08-08","1H Chemical Shift Assignments and structure of Trp-Cage mini-protein with D-amino acid",\N
17670,"17670","2011-06-24",\N,"Solution NMR Structure of Protein AAur_3427 from Arthrobacter aurescens, Northeast Structural Genomics Consortium Target AaR96","/ftp/pub/bmrb/timedomain/bmr17670"
17671,"17671","2012-01-05","2012-03-07","Solution NMR Structure of the HIV-1 Exon Splicing Silencer 3",\N
17672,"17672","2014-02-24","2014-02-27","Backbone 1H, 13C, and 15N Chemical Shift Assignments for Human Just Another Zinc Finger Protein residues 228-277",\N
17673,"17673","2012-05-09","2013-03-26","Not Available",\N
17674,"17674","2012-06-19",\N,"Solution structure of FGF1-SSR128129E",\N
17675,"17675","2011-10-12","2014-05-15","Backbone 1H,15N,13C and 13CB chemical shifts of folded state and denatured state for the N-terminal domain of ribosomal protein L9 (NTL9) V3AI4A double mutant",\N
17678,"17678","2011-09-19","2012-04-10","HRas166*GppNHp backbone chemical shift assignments",\N
17679,"17679","2014-02-24","2014-02-27","Backbone 1H, 13C, and 15N Chemical Shift Assignments for Human Just Another Zinc Finger Protein residues 168-227",\N
17680,"17680","2011-12-14","2012-02-22","Solution structure of Helix-RING domain in the Tyr363 phosphorylated form.",\N
17681,"17681","2011-08-25",\N,"Solution Structure of a Short-chain LaIT1 from the Venom of Scorpion <I>Liocheles australasiae</I>",\N
17682,"17682","2011-09-01",\N,"The 912-888 alternate conformation for helix 27 of E.coli 16S rRNA",\N
17683,"17683","2011-07-05",\N,"Solution NMR Structure of Heat shock factor protein 1 DNA binding domain from homo sapiens, Northeast Structural Genomics Consortium Target HR3023C","/ftp/pub/bmrb/timedomain/bmr17683"
17685,"17685","2012-10-01","2013-03-27","Solution structure of the C-terminal Pdr1 activating domain of Zuo1",\N
17686,"17686","2011-07-06","2012-02-22","Solution structure of the RMM-CTD domains of human LINE-1 ORF1p",\N
17687,"17687","2011-10-12",\N,"PARP BRCT Domain",\N
17688,"17688","2011-07-06",\N,"Solution NMR Structure of Tfu_2981 from Thermobifida fusca, Northeast Structural Genomics Consortium Target TfR85A",\N
17689,"17689","2011-09-13","2012-02-22","Novel dimeric structure of phage phi29-encoded protein p56: Insights into Uracil-DNA glycosylase inhibition",\N
17690,"17690","2011-10-26","2012-02-22","N-terminal regulatory segment of carnitine palmitoyltransferase 1A",\N
17691,"17691","2011-07-06",\N,"Solution structure of the HMG box DNA-binding domain of human stem cell transcription factor Sox2",\N
17692,"17692","2011-12-12","2012-02-22","backbone resonance assignment of the DMSO-d6 denatured DLC8",\N
17693,"17693","2012-06-11",\N,"RRM domain of mRNA export adaptor REF2-I bound to HVS ORF57 peptide",\N
17694,"17694","2011-09-14","2013-01-24","1H, 15N and 13C backbone and side-chain assignments of a family 32 carbohydrate-binding module (CBM32) from the Clostridium perfringens NagH",\N
17695,"17695","2012-01-04",\N,"Backbone Chemical Shift Assignments of the Extracellular domain of GLIC, a prokaryotic nAChR homologue",\N
17697,"17697","2011-08-19","2012-02-22","Structure of a dimeric all-parallel-stranded G-quadruplex stacked via the 5'-to-5' interface",\N
17698,"17698","2012-06-11",\N,"HP67 H41F",\N
17699,"17699","2012-03-02",\N,"SOLUTION NMR STRUCTURE OF THE S4S5 LINKER OF HERG POTASSIUM CHANNEL",\N
17700,"17700","2011-07-15",\N,"13C, 15N Chemical shifts of E. coli thioredoxin using solid-state nmr spectroscopy",\N
17701,"17701","2012-05-22",\N,"20 NMR solution structures of Bacillus subtilis L,D-transpeptidase refined in water",\N
17702,"17702","2012-12-17",\N,"The protein complex for DNA replication",\N
17703,"17703","2011-10-26","2013-01-24","Backbone and stereo-specific Ile(d1), Leu, Val methyl sidechain chemical shift assignments of RDE-4 (1-243)",\N
17705,"17705","2011-10-26","2012-02-22","na1",\N
17706,"17706","2011-10-26","2012-02-22","na2",\N
17707,"17707","2011-10-26","2012-02-22","na3",\N
17708,"17708","2012-03-09",\N,"Solution-state structures of monomeric and dimeric G-quadruplexes adopted by a sequence from N-myc",\N
17709,"17709","2012-03-09",\N,"Solution-state structures of monomeric and dimeric G-quadruplexes formed by a sequence from N-myc",\N
17710,"17710","2011-10-12","2012-02-20","Membrane protein complex DsbB-DsbA structure by joint calculations with solid-state NMR and X-ray experimental data",\N
17711,"17711","2012-06-05","2012-07-02","Solution structure of the core SMN-Gemin2 complex",\N
17713,"17713","2011-09-13","2013-01-24","Fpr4p PPIase domain",\N
17714,"17714","2011-08-19","2012-02-20","human prion protein mutant HuPrP(90-231, M129, V210I)",\N
17716,"17716","2011-10-12","2012-02-20","Structure of Cu(I)Cu(II)-CopK from Cupriavidus metallidurans CH34",\N
17717,"17717","2012-12-17",\N,"Monomeric Mouse ApoAI(1-216)",\N
17718,"17718","2012-01-24",\N,"Hydrogen Exchange in Unligated and Ligated Straphlococcal Nuclease",\N
17719,"17719","2012-05-09","2012-08-23","Solution structure of esophageal cancer-related gene 2",\N
17720,"17720","2012-08-30","2013-01-23","Solution Structure of N-terminal Cytosolic Domain of Rhomboid Intramembrane Protease from Escherichia Coli",\N
17721,"17721","2011-08-16","2012-02-20","Backbone (1H, 13C, 15N) Chemical Shifts for the two tandem Calcium Binding Domains (CBD12) of the Na+/Ca2+ exchanger in the absence of Calcium",\N
17722,"17722","2011-08-16","2012-02-20","Backbone (1H,13C,15N) chemical shifts for the two tandem Calcium Binding Domains (CBD12) of the Na+/Ca2+ exchanger in the Ca2+-bound state",\N
17723,"17723","2011-08-16","2012-10-12","Chemical Shift Assignment and Solution Structure of ChR145 from Cytophaga Hutchinsonii. Northeast Structural Genomics Consortium Target ChR145.",\N
17724,"17724","2013-02-11",\N,"Micelle-bound KSR1 CA1CA1a",\N
17725,"17725","2013-02-11",\N,"KSR1(1-170)",\N
17726,"17726","2011-12-12","2012-04-10","conotoxin pc16a",\N
17727,"17727","2012-06-21","2014-02-27","3D ssNMR structure of membrane embedded KcsA-Kv1.3 channel (Closed state)",\N
17728,"17728","2011-09-06",\N,"13C and 15N Chemical Shift Assignments for the fd Bacteriophage",\N
17729,"17729","2011-12-06",\N,"Structure of the DNA complex of the C-Terminal domain of Ler",\N
17731,"17731","2012-05-09","2013-03-27","Structural Plasticity of Paneth cell alpha-Defensins: Characterization of Salt-Bridge Deficient Analogues of Mouse Cryptdin-4",\N
17732,"17732","2012-01-18","2012-04-10","Complex of the C-terminal WRKY domain of AtWRKY4 and a W-box DNA",\N
17733,"17733","2012-05-09","2013-03-27","Solution structure of (R7G)-Crp4",\N
17734,"17734","2011-07-18",\N,"Solution NMR structure of N-terminal domain of Salmonella effector protein PipB2. Northeast structural genomics consortium (NESG) target stt318a",\N
17735,"17735","2011-07-18",\N,"Solution structure of sf3636, a two-domain unknown function protein from Shigella flexneri 2a, determined by joint refinement of NMR, residual dipolar couplings and small-angle X-ray scatting, NESG target SfR339/OCSP target sf3636",\N
17736,"17736","2011-07-18",\N,"Solution NMR structure of the AHSA1-like protein CHU_1110 from Cytophaga hutchinsonii, Northeast Structural Genomics Consortium Target ChR152.","/ftp/pub/bmrb/timedomain/bmr17736"
17737,"17737","2011-07-18","2014-07-15","Solution NMR structure of HopPmal_281_385 from Pseudomonas syringae pv. maculicola str. ES4326, Midwest Center for Structural Genomics target APC40104.5 and Northeast Structural Genomics Consortium target PsT2A",\N
17738,"17738","2011-10-25",\N,"Structure of a monomeric mutant of the HIV-1 capsid protein",\N
17739,"17739","2011-07-18","2014-07-15","Solution NMR structure of HopABPph1448_220_320 from Pseudomonas syringae pv. phaseolicola str. 1448A, Midwest Center for Structural Genomics target APC40132.4 and Northeast Structural Genomics Consortium target PsT3A",\N
17740,"17740","2011-09-01",\N,"Backbone 1H, 13C, 15N assignment of Hck kinase regulatory segment",\N
17741,"17741","2012-05-21","2012-08-23","Q436",\N
17742,"17742","2012-05-21","2012-08-23","R458",\N
17743,"17743","2011-07-14","2012-02-20","Backbone 1H, 13C and 15N chemical shift assignments for the N-terminal domain of insulin-like growth factor binding protein-2 (IGFBP-2)",\N
17744,"17744","2012-07-11","2014-02-27","3D ssNMR structure of membrane embedded KcsA-Kv1.3 channel (Inactivated state)",\N
17745,"17745","2012-03-27",\N,"NMR Assignment of PFV RNase H domain",\N
17746,"17746","2011-12-12","2012-02-20","Oligonucleotide duplex contaning (5'S)-8,5'-cyclo-2'-deoxyguansine",\N
17747,"17747","2011-08-03",\N,"Solution NMR Structure of Fumarate reductase flavoprotein subunit from Lactobacillus plantarum, Northeast Structural Genomics Consortium Target LpR145J",\N
17748,"17748","2011-07-18",\N,"Solution NMR Insights into Docking Interactions Involving Inactive ERK2",\N
17749,"17749","2011-08-25",\N,"Solution NMR structure of Diiron protein in presence of 2 eq Zn2+, Northeast Structural Genomics Consortium Target OR21",\N
17750,"17750","2011-08-03",\N,"Solution NMR structure of N-terminal domain of human E3 ubiquitin-protein ligase HECW2. Northeast structural genomics consortium (NESG) target ht6306a",\N
17751,"17751","2011-08-25",\N,"Solution structure of Diiron protein in presence of 8 eq Zn2+, Northeast Structural Genomics consortium target OR21",\N
17752,"17752","2012-02-13",\N,"SOLUTION STRUCTURE OF THE HUMAN PROLACTIN RECEPTOR ECD DOMAIN D2",\N
17753,"17753","2011-08-03",\N,"Solution NMR Structure of the Helix-loop-Helix Domain of Human ID3 Protein, Northeast Structural Genomics Consortium Target HR3111A",\N
17754,"17754","2011-08-03",\N,"Solution NMR structure of a MucBP domain (fragment 187-294) of the protein LBA1460 from Lactobacillus acidophilus, Northeast structural genomics consortium target LaR80A","/ftp/pub/bmrb/timedomain/bmr17754"
17755,"17755","2011-10-12","2013-02-04","1H, 13C, and 15N resonance assignments of human regenerating family I-alpha protein (Reg I-alpha)",\N
17756,"17756","2011-07-18",\N,"Backbone 1H and 13C Chemical Shift Assignments of human prion protein (residues 121-230) in its oxidized state",\N
17757,"17757","2011-07-14",\N,"Backbone 1H and 13C Chemical Shift Assignments of human prion protein (residues 121-230) in its reduced state",\N
17758,"17758","2011-07-14",\N,"Backbone 1H and 13C Chemical Shift Assignments of murine prion protein (residues 121-232) in its oxidized state",\N
17759,"17759","2011-07-14",\N,"Backbone 1H and 13C Chemical Shift Assignments of murine prion protein (residues 121-232) in its reduced state",\N
17760,"17760","2011-07-18",\N,"backbone resonance assignments of p53 N-terminal transactivation domain (1-93)",\N
17761,"17761","2012-09-20",\N,"Backbone 1H, 13C, 15N and 13CB assignment of N-terminal Domain of Ribosomal Protein L9 (NTL9) Denatured State in 8.3M Urea",\N
17762,"17762","2012-01-23","2012-01-25","Solution structure of the monomeric derivative of BS-RNase",\N
17763,"17763","2011-12-02","2012-02-20","NMR solution structure of native TdPI-short",\N
17764,"17764","2011-08-19",\N,"A partially folded structure of amyloid-beta(1 40) in an aqueous environment",\N
17765,"17765","2012-01-24","2012-04-10","Identification of the key regions that drive functional amyloid formation by the fungal hydrophobin EAS",\N
17766,"17766","2011-08-16","2012-02-16","Secondary structure of subunit E (E133-222) from Saccharomyces cerevisiae V1VO ATPase",\N
17767,"17767","2012-03-27",\N,"NMR structure of cl-BABP/SS complexed with glycochenodeoxycholic and glycocholic acids",\N
17768,"17768","2012-05-09",\N,"Structure of bacteriophage SPP1 gp17 protein",\N
17769,"17769","2011-08-16",\N,"UBIQUITIN NMR STRUCTURE",\N
17770,"17770","2012-01-05",\N,"Sequence specific backbone resonance assignment of Vitamin D receptor ligand binding domain (VDRLBD) complexed with 1,25(OH)2 D3 and LXXLL motif (DRIP205)",\N
17771,"17771","2012-09-20","2013-03-27","Resonance Assignments of Calmodulin Complexed with the Calmodulin-Binding Domain of Olfactory Nucleotide Gated Ion Channel",\N
17772,"17772","2011-12-06","2012-04-10","Solution structure of the RING finger-like domain of Retinoblastoma Binding Protein-6 (RBBP6)",\N
17773,"17773","2012-09-20","2014-02-27","Backbone (1)H, (13)C and (15)N NMR chemical shift assignments for the human DGCR8 core",\N
17774,"17774","2012-03-23",\N,"Antiparallel beta-sheet structural model for Iowa-mutant beta-amyloid fibrils",\N
17775,"17775","2011-08-16","2013-02-04","Solution structure of the chimeric Af1503 HAMP- EnvZ DHp homodimer",\N
17776,"17776","2011-08-16","2012-02-16","Solution structure of the chimeric Af1503 HAMP- EnvZ DHp homodimer; A219F variant",\N
17777,"17777","2011-08-03","2012-02-16","Solution structure of the N-terminal domain of the Shigella type III secretion protein MxiG",\N
17779,"17779","2011-12-02","2012-02-16","NMR structure of the intermediate IIIb of the TdPI-short",\N
17780,"17780","2012-06-25","2012-08-22","Human prion protein with E219K protective polymorphism",\N
17781,"17781","2011-10-25","2012-02-16","structure of",\N
17782,"17782","2011-10-25","2012-02-16","lsm57",\N
17783,"17783","2012-07-17","2013-01-30","Solution Structure of the SPOR domain from E. coli DamX",\N
17784,"17784","2012-04-18","2014-02-27","NMR structure of the PhyRSL-NepR complex from Sphingomonas sp. Fr1",\N
17785,"17785","2011-09-29","2013-09-05","KRas171*GppNHp backbone chemical shift assignments",\N
17786,"17786","2012-06-25",\N,"Structure of the duplex when (5'S)-8,5'-cyclo-2'-deoxyguanosine is placed opposite dT",\N
17787,"17787","2012-06-25",\N,"Structure of the duplex when (5'S)-8,5'-cyclo-2'-deoxyguanosine is placed opposite dA",\N
17789,"17789","2012-06-25",\N,"structure of the duplex containing (5'S)-8,5'-cyclo-2'-deoxyadenosine",\N
17790,"17790","2012-08-30",\N,"Structure of the duplex containing HNE derived (6S,8R,11S) N2-dG cyclic hemiacetal when placed opposite dT",\N
17791,"17791","2012-08-30",\N,"Structure of the duplex containing HNE derived (6S,8R,11S) gamma-HO-PdG when placed opposite dT",\N
17792,"17792","2012-08-30","2014-02-27","3D solution structure of antimicrobial peptide aurelin",\N
17793,"17793","2011-08-26",\N,"Backbone chemical shift assignments for Ab42 with Met35 in its oxidized state",\N
17794,"17794","2011-08-26",\N,"Backbone chemical shift assignments for Ab42 with Met35 in its reduced state",\N
17795,"17795","2011-08-26",\N,"Backbone chemical shift assignments for A 40 with Met35 in its oxidised state",\N
17796,"17796","2011-08-26",\N,"Backbone chemical shift assignments for A 40 with Met35 in its reduced state",\N
17797,"17797","2012-04-23",\N,"1H Chemical Shift Assignments for Chicken AvBD2 defensin",\N
17798,"17798","2012-04-23",\N,"1H Chemical Shift Assignments for chicken AvBD2-K31A mutant",\N
17799,"17799","2011-08-25",\N,"NMR structure of the protein YP_001302112.1 from Parabacteroides distasonis",\N
17803,"17803","2012-04-09",\N,"Human Insulin Mutant A22Gly-B31Arg",\N
17804,"17804","2011-11-30","2013-01-18","1H, 15N and 13C backbone resonance assignments of alpha1-antitrypsin",\N
17805,"17805","2012-08-31",\N,"THE HIGH RESOLUTION STRUCTURE OF UBIQUITIN LIKE DOMAIN OF UBLCP1",\N
17806,"17806","2011-08-26",\N,"NMR structure of the calcium-bound form of the protein YP_001302112.1 from Parabacteroides distasonis",\N
17807,"17807","2012-06-11","2012-08-28","Solution structure of Ca2+/calmodulin complexed with a peptide representing the calmodulin-binding domain of L-selectin",\N
17808,"17808","2011-12-12",\N,"Structure of PHD domain of UHRF1 in complex with H3 peptide",\N
17809,"17809","2011-08-25",\N,"Solution NMR structure of the AHSA1-like protein AHA_2358 from Aeromonas hydrophila refined with NH RDCs. Northeast Structural Genomics Consortium Target AhR99.","/ftp/pub/bmrb/timedomain/bmr17809"
17810,"17810","2011-12-02",\N,"Atomic Resolution Protein Structures using NMR Chemical Shift Tensors",\N
17811,"17811","2012-08-30",\N,"Solution structure of MsPTH",\N
17812,"17812","2011-09-01","2012-02-16","NMR STRUCTURE OF UHRF1 PHD DOMAINS IN A COMPLEX WITH HISTONE H3 PEPTIDE",\N
17813,"17813","2011-09-01","2012-02-16","NMR structure of the UHRF1 PHD domain",\N
17814,"17814","2011-12-01","2012-04-10","Structure of DNA Containing an Aristolactam II-dA Lesion.",\N
17815,"17815","2012-04-23",\N,"Backbone 1H, 13C and 15N resonance assignments for IMP1 KH34",\N
17816,"17816","2012-07-30",\N,"lactococcin 972",\N
17817,"17817","2011-10-25","2012-02-16","Green Proteorhodopsin - Deuterated",\N
17818,"17818","2011-08-17","2014-06-09","Solution NMR structure of a FKBP-type peptidyl-prolyl cis-trans isomerase from Giardia lamblia. Seattle Structural Genomics Center for Infectious Disease (SSGCID) target GilaA.00840.a",\N
17820,"17820","2011-12-12","2013-03-27","Backbone resonance assignments for IsdH-N2N3",\N
17821,"17821","2011-09-13","2012-02-16","Human C30S/C59S-Cox17 mutant",\N
17822,"17822","2012-08-29",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for QFM(Y)F",\N
17824,"17824","2012-03-26","2012-08-22","Rbx1",\N
17825,"17825","2012-01-09","2012-04-10","Solution Structure of the J Domain of HSJ1a",\N
17826,"17826","2011-09-09","2013-01-18","Galectin-7",\N
17827,"17827","2011-12-01",\N,"1H, 13C, and 15N Chemical Shift Assignments for Kindle-2 N-terminus",\N
17828,"17828","2012-04-30","2012-08-22","Ubiquitin-like domain from HOIL-1",\N
17829,"17829","2012-03-01","2013-03-26","FVIII C2 Domain",\N
17830,"17830","2011-10-25",\N,"1H, 13C and 15N Resonance Assignments for Oxidised and Reduced nDsbD fromm Escherichia coli",\N
17831,"17831","2011-10-25",\N,"1H, 13C and 15N resonance assignments for oxidised and reduced nDsbD from Escherichia coli",\N
17832,"17832","2012-01-25","2012-02-28","1H, 15N and 13C resonance assignments for the N-terminal dimeric region of budding yeast histone chaperone Rtt106",\N
17834,"17834","2011-09-13","2011-12-22","Syrian hamster prion protein with thiamine",\N
17835,"17835","2012-04-30","2013-03-26","NOT AVAILABLE",\N
17836,"17836","2012-02-28",\N,"The assigned chemical shifts for the disordered forms of apo-IscU",\N
17837,"17837","2012-02-28",\N,"The assigned chemical shifts for the structured forms of apo-IscU",\N
17838,"17838","2012-04-30","2012-08-22","Solution structure of C2B with IP6",\N
17839,"17839","2012-02-28",\N,"Ga98 solution structure",\N
17840,"17840","2012-02-28",\N,"GB98 solution structure",\N
17841,"17841","2012-02-28",\N,"GB98-T25I,L20A",\N
17842,"17842","2011-08-25","2012-02-16","Solution structure of outer membrane protein H (OprH) from P. aeruginosa in DHPC micelles.",\N
17843,"17843","2012-02-28",\N,"GB98-T25I solution structure",\N
17844,"17844","2012-02-28",\N,"The assigned chemical shifts of disordered-IscU complexed with IscS",\N
17845,"17845","2012-03-14",\N,"Backbone 1H, 13C, and 15N chemical shift assignments of oxidized yeast iso-1 cytochrome c",\N
17846,"17846","2012-03-14",\N,"Backbone 1H, 13C, and 15N chemical shift assignments of reduced yeast iso-1 cytochrome c",\N
17847,"17847","2012-03-14",\N,"Backbone 1H, 13C, and 15N chemical shift assignments of oxidized horse heart cytochrome c",\N
17848,"17848","2012-03-14",\N,"Backbone 1H, 13C, and 15N chemical shift assignments of reduced horse heart cytochrome c",\N
17849,"17849","2012-02-01","2012-04-10","Solution structure of Ca2+-bound yCaM",\N
17850,"17850","2012-02-01","2012-04-10","Solution structure of Ca2+/CNA1 peptide-bound yCaM",\N
17851,"17851","2012-04-30","2012-06-01","Backbone 1H, 15N, 13C assignments for beta phosphoglucomutase in a binary complex with BeF3-",\N
17852,"17852","2012-04-30","2012-06-01","Backbone 1H, 15N, 13C assignments for beta phosphoglucomutase in a ternary complex with glucose-6-phosphate and BeF3-",\N
17853,"17853","2012-01-18","2013-01-18","Backbone and sidechain 1H 13C and 15N chemical shift assignement of the catalytic domain from",\N
17855,"17855","2011-08-31",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for high mobility group protein-like protein NHP1 from Babesia bovis T2Bo. Seattle Structure Genomics Center for Infectious Disease (SSGCID)",\N
17856,"17856","2012-01-05",\N,"Structural analysis of a chaperone in type III secretion system",\N
17857,"17857","2012-08-01",\N,"Chemical Shift Assignments and solution structure of human apo-S100A1 E32Q mutant",\N
17858,"17858","2012-06-05","2012-06-30","RNA-binding zinc finger protein",\N
17859,"17859","2012-06-13",\N,"Solution Structure of a DNA duplex Containing an Unnatural, Hydrophobic Base Pair",\N
17860,"17860","2012-07-24","2012-09-19","high resolution NMR solution structure of helix H1 of the chimpanzee HAR1 RNA",\N
17862,"17862","2012-06-19",\N,"Solution structure of Staphylococcus aureus IsdH linker domain",\N
17863,"17863","2011-09-02","2012-02-14","Rv0899 from Mycobacterium tuberculosis contains two seperated domains",\N
17864,"17864","2011-08-31",\N,"1H, 13C, and 15N Chemical Shift Assignments for human FAIM-CTD",\N
17865,"17865","2012-07-16","2012-08-22","Solution structure of Venturia inaequalis cellophane-induced 1 protein (ViCin1) domains 1 and 2",\N
17866,"17866","2012-03-09","2013-01-18","1H,15N and 13C backbone and side chain chemical shifts of human halo S100P",\N
17867,"17867","2012-01-18","2012-04-10","Structural Insight into the Unique Cardiac Myosin Binding Protein-C Motif: A Partially Folded Domain",\N
17868,"17868","2012-03-27","2012-06-30","Mucin sequence based on MUC2 Mucin glycoprotein tandem repeat",\N
17869,"17869","2012-03-27","2012-06-30","Tri-O-GalNAc glycosylated Mucin sequence based on MUC2 Mucin glycoprotein tandem repeat",\N
17870,"17870","2012-03-27","2012-06-30","Di-O-GalNAc glycosylated Mucin sequence based on MUC2 Mucin glycoprotein tandem repeat",\N
17871,"17871","2012-03-27","2012-06-30","Di-O-GalNAc glycosylated Mucin sequence based on MUC2 Mucin glycoprotein tandem repeat",\N
17872,"17872","2012-03-27","2012-06-30","Di-O-GalNAc glycosylated Mucin sequence based on MUC2 Mucin glycoprotein tandem repeat",\N
17873,"17873","2012-03-27","2012-06-30","Mono-O-GalNAc glycosylated Mucin sequence based on MUC2 Mucin glycoprotein tandem repeat",\N
17874,"17874","2012-03-27","2012-06-30","Mono-O-GalNAc glycosylated Mucin sequence based on MUC2 Mucin glycoprotein tandem repeat",\N
17875,"17875","2012-03-27","2012-06-30","Mono-O-GalNAc glycosylated Mucin sequence based on MUC2 Mucin glycoprotein tandem repeat",\N
17876,"17876","2012-01-12","2012-02-14","STRUCTURAL AND FUNCTIONAL ANALYSIS OF A NOVEL POTASSIUM TOXI ARGENTINEAN SCORPION TITYUS TRIVITTATUS REVEALS A NEW KAPPA SUB-FAMILY",\N
17877,"17877","2012-08-22","2014-02-27","Solution structure of a shortened antiterminator hairpin from a Mg2+ riboswitch",\N
17878,"17878","2011-12-09","2012-02-14","Backbone 1H, 13C, and 15N Chemical Shift Assignments for La(4-325)",\N
17879,"17879","2011-12-02",\N,"NMR structure of Atg8-Atg7C30 complex",\N
17880,"17880","2012-04-23","2013-04-23","1H, 13C, and 15N Chemical Shift Assignments for a yeast protein",\N
17881,"17881","2011-10-10",\N,"Dynamics of isolated C domain of calmodulin apo form",\N
17882,"17882","2012-02-13",\N,"Solution Structure of CssII",\N
17883,"17883","2011-12-08","2013-04-12","The solution structure of the Lin28-ZnF domains bound to AGGAGAU of pre-let-7 miRNA",\N
17884,"17884","2011-10-24","2012-04-04","METAL BINDING DOMAIN OF RAT BETA-AMYLOID",\N
17885,"17885","2012-08-27","2014-05-15","Solution NMR structure of a DNA dodecamer containing the 7-aminomethyl-7-deaza-2'-deoxyguanosine adduct",\N
17886,"17886","2012-02-01","2013-04-30","Backbone chemical shift assignments of holo-acyl carrier protein of Leishmania major",\N
17887,"17887","2012-01-18","2012-02-14","DNA sequence context conceals alpha anomeric lesion",\N
17888,"17888","2012-08-17",\N,"NMR Structure of the Polyserine Tract of Apis mellifera Vitellogenin, residues 358-392",\N
17889,"17889","2012-05-22",\N,"The polyserine tract of Nasonia vitripennis Vg residues 351-385",\N
17890,"17890","2012-06-04",\N,"NMR structure of the lectin CCL2 (free)",\N
17891,"17891","2012-07-09","2012-08-22","Solution Structure of KKGF",\N
17892,"17892","2013-02-15","2013-03-26","NOE-based 3D structure of the CylR2 homodimer at 298K",\N
17893,"17893","2013-02-15","2013-03-26","NOE-based 3D structure of the CylR2 homodimer at 270K (-3 Celsius degrees)",\N
17894,"17894","2013-02-15","2013-03-26","NOE-based 3D structure of the predissociated homodimer of CylR2 in equilibrium with monomer at 266K (-7 Celsius degrees)",\N
17895,"17895","2013-02-15","2013-03-26","NOE-based 3D structure of the monomer of CylR2 in equilibrium with predissociated homodimer at 266K (-7 Celsius degrees)",\N
17896,"17896","2013-02-15","2013-03-26","NOE-based 3D structure of the monomeric intermediate of CylR2 at 262K (-11 Celsius degrees)",\N
17897,"17897","2013-02-15","2013-03-26","NOE-based 3D structure of the monomeric partially-folded intermediate of CylR2 at 259K (-14 Celsius degrees)",\N
17898,"17898","2013-02-15","2013-03-26","NOE-based 3D structure of the monomeric partially-folded intermediate of CylR2 at 257K (-16 Celsius degrees)",\N
17899,"17899","2011-10-25","2013-01-18","1H, 13C and 15N NMR assignments of the aciniform spidroin (AcSp1) repetitive domain of Argiope trifasciata wrapping silk",\N
17900,"17900","2011-09-19",\N,"Solution NMR Structure of BfR322 from Bacteroides fragilis, Northeast Structural Genomics Consortium Target BfR322",\N
17901,"17901","2011-09-28",\N,"Partial 1H, 13C, 15N Chemical Shift Assignments for the U6 Spliceosomal snRNA 5' Stem-Loop 30-mer Construct.",\N
17902,"17902","2012-06-04",\N,"Solution structure of CCL2 in complex",\N
17903,"17903","2011-12-06",\N,"NMR Solution Structure of Yeast Iso-1-cytochrome c Mutant P71H in oxidized states",\N
17904,"17904","2011-12-06",\N,"NMR Solution Structure of Yeast Iso-1-cytochrome c Mutant P71H in reduced states",\N
17905,"17905","2011-12-12","2013-01-18","1H, 13C and 15N resonance assignment of the Anticodon Binding Domain of Human Lysyl Aminoacyl tRNA Synthetase",\N
17906,"17906","2011-12-14","2012-04-04","NMR structure of holo-ACPI domain from CurA module from Lyngbya majuscula",\N
17907,"17907","2012-02-01","2012-04-04","NMR structure of HMG-ACPI domain from CurA module from Lyngbya majuscula",\N
17908,"17908","2012-07-23",\N,"Solution structure Analysis of the ImKTx104",\N
17909,"17909","2011-10-03","2014-05-14","Resonance assignments of human Steroidogenic acute regulatory-related lipid transfer domain protein 5",\N
17910,"17910","2012-02-28","2012-03-29","WT alpha-synuclein fibrils in the presence of phospholipid vesicles",\N
17911,"17911","2012-09-04",\N,"C-terminal domain of SARS-CoV main protease",\N
17912,"17912","2012-09-04","2014-02-27","The third SH3 domain of R85FL",\N
17913,"17913","2012-09-04","2014-02-27","The third SH3 domain of R85FL with ataxin-7 PRR",\N
17914,"17914","2012-01-17","2012-02-14","Integral membrane core domain of the mercury transporter MerF in lipid bilayer membranes",\N
17915,"17915","2011-10-07","2012-08-22","PFBD: High-throughput Strategy of Backbone fold Determination for small well-folded proteins in less than a day",\N
17916,"17916","2011-12-14",\N,"Backbone assignments for the C-terminal domain of yeast Tfg2",\N
17917,"17917","2011-12-14",\N,"Backbone chemical shift assignments for the C-terminal domain of yeast Tfg1.",\N
17918,"17918","2012-08-21",\N,"Solution structure of the TbPIN1",\N
17919,"17919","2012-07-16","2012-08-22","Description of the structural fluctuations of proteins from structure-based calculations of residual dipolar couplings",\N
17920,"17920","2011-10-24","2012-02-14","Assignment of filamentous full-length tau",\N
17921,"17921","2012-02-08",\N,"Partial 1H, 15N Chemical Shift Assignments of a GAAA Tetraloop Receptor Variant.",\N
17922,"17922","2012-09-20",\N,"Backbone 1H, 13C, 15N assignment of HIV-1 accessory protein Nef",\N
17923,"17923","2012-09-05",\N,"3D solution structure of plant defensin Lc-def",\N
17924,"17924","2012-08-23","2013-01-18","SEVI",\N
17925,"17925","2012-08-23","2013-01-18","SEVI with Zn",\N
17926,"17926","2012-04-23","2012-06-20","PARTIAL 3D STRUCTURE OF THE C-TERMINAL PART OF THE FREE ARAB THALIANA CP12-2 IN ITS OXIDIZED FORM",\N
17927,"17927","2011-10-10",\N,"Solution Structure of a putative thiol-disulfide oxidoreductase from Bacteroides vulgatus",\N
17928,"17928","2011-12-05",\N,"Structure of the influenza AM2-BM2 chimeric channel",\N
17929,"17929","2011-12-05",\N,"Structure of the influenza AM2-BM2 chimeric channel bound to rimantadine",\N
17930,"17930","2011-10-24","2012-02-14","monophosphorylated (747pY) beta3 integrin cytoplasmic tail under membrane mimetic conditions",\N
17931,"17931","2011-10-24","2012-02-14","biphosphorylated (747pY, 759pY) beta3 integrin cytoplasmic tail under membrane mimetic conditions",\N
17932,"17932","2011-10-24","2012-02-14","monophosphorylated (747pY) beta3 integrin cytoplasmic tail under aqueous conditions",\N
17934,"17934","2012-09-17","2014-02-27","AIDA1 PTB domain",\N
17935,"17935","2011-12-20","2013-01-18","1H, 13C, 15N assignment and secondary structure determination of GATase subunit of GMP Synthetase from Methanococcus jannaschii",\N
17936,"17936","2012-01-09","2012-06-30","N/A",\N
17937,"17937","2011-10-28","2011-11-04","Solid-state Chemical Shift Assignments for CAP-Gly Domain of Mammalian Dynactin",\N
17938,"17938","2011-10-28",\N,"Solution Chemical Shifts Assignments of 1H, 13C, and 15N for CAP-Gly",\N
17939,"17939","2012-10-09",\N,"a protein from Haloferax volcanii",\N
17940,"17940","2011-10-24","2012-02-14","1H, 13C and 15N backbone resonance assignment of the activated p38 mitogen-activated protein kinase",\N
17941,"17941","2012-09-17",\N,"the structure of subdomain IV-B from the CVB-3 IRES",\N
17942,"17942","2012-03-09","2013-03-26","1H, 13C and 15N resonance assignment of a complex constisting of hDlg/SAP-97 residues 318-406 and HPV type 51 E6 protein residues 141-151",\N
17943,"17943","2012-03-23","2013-03-26","1H, 13C and 15N NMR assignment of CGC-19, a single domain proteic constituent of a non ribosomal peptide synthetase.",\N
17944,"17944","2011-10-28",\N,"13C, 15N Chemical shifts of the C-terminal fragment of E. coli thioredoxin reassembly using solid-state NMR spectroscopy",\N
17945,"17945","2011-10-28","2013-03-26","NMR backbone assignment of a Tau protein fragment",\N
17946,"17946","2011-09-23","2013-04-12","Aliphatic 1H, 13C, and 15N chemical shift assignments of dihydrofolate reductase from the psychropiezophile Moritella profunda in complex with NADP+ and folate",\N
17947,"17947","2012-05-02",\N,"Partial backbone 1H assignments of the 2/2 hemoglobin from the cyanobacterium Synechococcus sp. PCC 7002 in the ferrous bis-histidine state",\N
17948,"17948","2011-10-28","2014-02-27","NMR structure of Hsp12 in the presence of DPC",\N
17949,"17949","2012-02-01",\N,"Solution Structure of CssII",\N
17950,"17950","2012-09-20","2013-01-18","Solution structure of DNA binding domain of AtTRB2",\N
17951,"17951",\N,\N,"3D solution structure of lipid transfer protein Lc-LTP2",\N
17952,"17952","2011-12-09","2012-09-05","Backbone 1H, 13C, and 15N Chemical Shift Assignments for E.coli Ribonuclease P protein",\N
17953,"17953","2012-09-24",\N,"NMR Structure of protoporphyrin-IX bound murine p22HBP",\N
17954,"17954",\N,\N,"SOLUTION STRUCTURE OF E73 PROTEIN FROM SULFOLOBUS SPINDLE- SHAPED VIRUS RAGGED HILLS, A HYPERTHERMOPHILIC CRENARCHAEAL VIRUS FROM YELLOWSTONE NATIONAL PARK",\N
17955,"17955","2012-01-09",\N,"(C9S, C14S)-leucocin A",\N
17956,"17956","2012-08-06","2012-08-28","Solution structure of MCoTI-V",\N
17957,"17957","2011-10-24","2013-05-28","1H, 13C and 15N chemical shifts assignments of BA42 from Bizionia argentinensis",\N
17958,"17958","2012-01-09",\N,"C9L,C14L-LeuA",\N
17959,"17959","2011-12-12","2013-01-18","Backbone and side chain 1H, 13C, and 15N assignments of the ubiquitin-like domain of human HOIL-1L",\N
17960,"17960","2011-11-21","2014-02-27","Complete 1H, 13C and 15N assignments of the kinetochore localisation domain of BUBR1 bound to a Blinkin motif",\N
17961,"17961","2012-02-20","2012-04-04","S. cerevisiae U2/U6 snRNA complex",\N
17962,"17962","2011-10-26",\N,"Solution structure of putative oxidoreductase from Ehrlichia chaffeensis. (Seattle Structural Genomics Center for Infectious Disease (SSGCID))",\N
17963,"17963","2012-10-01",\N,"Solution structure of Rhodostomin G50L mutant",\N
17964,"17964","2012-06-05",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignment for inactive HIV-1 protease CRF01_AE",\N
17965,"17965","2011-10-24",\N,"Solution NMR structure of Alr2454 protein from Nostoc sp. strain PCC 7120, Northeast Structural Genomics Consortium Target NsR264","/ftp/pub/bmrb/timedomain/bmr17965"
17966,"17966","2012-09-20",\N,"PDGFR beta-TM",\N
17967,"17967","2012-04-04","2012-08-28","Structure of the monomeric N-terminal domain of HPV16 E6 oncoprotein",\N
17968,"17968","2012-04-04","2012-08-28","Haddock model structure of the N-terminal domain dimer of HPV16 E6",\N
17969,"17969","2012-01-05",\N,"Solution structure and binding studies of the RanBP2-type zinc finger of RBM5",\N
17970,"17970","2012-01-05",\N,"Solution structure and binding studies of the RanBP2-type zinc finger of RBM5",\N
17971,"17971","2011-10-28",\N,"Solution NMR structure of homeobox domain (171-248) of human homeobox protein TGIF1, Northeast Structural Genomics Consortium Target HR4411B","/ftp/pub/bmrb/timedomain/bmr17971"
17972,"17972","2012-02-20","2012-04-04","U2/U6 Helix I",\N
17973,"17973","2012-03-09","2013-03-26","Onconase zymogen FLG variant",\N
17974,"17974","2012-10-09",\N,"Structural and mechanistic insights into the interaction between PAT Pyk2 and Paxillin LD motif",\N
17975,"17975","2012-01-18",\N,"PPARgamma LBD complexed with rosiglitazone",\N
17976,"17976","2012-01-18",\N,"PPARgamma LBD complexed with MRL24",\N
17977,"17977","2012-01-18",\N,"PPARgamma LBD complexed with MRL20",\N
17978,"17978","2012-06-05","2013-03-13","Backbone and sidechain 1H, 13C and 15N chemical shift assignments of the hydrophobin MPG1 from the rice blast fungus Magnaporthe oryzae",\N
17979,"17979","2011-11-02",\N,"Solution structure of the Zn(II) form of Desulforedoxin",\N
17980,"17980","2012-10-09","2013-01-18","Monomer-dimer equilibrium for 5 -5 stacking of propeller-type parallel-stranded G-quadruplexes: NMR structural study",\N
17981,"17981","2011-10-10",\N,"Dynamics of isolated C domain of calmodulin complexed with PEP-19 in the absence of Ca2+",\N
17982,"17982","2011-10-10",\N,"Dynamics of isolated C domain of calmodulin complexed with Ca2+",\N
17983,"17983","2011-10-10",\N,"Dynamics of isolated C domain of calmodulin complexed with PEP-19 in the presence of Ca2+",\N
17985,"17985","2011-12-12","2012-02-14","Structure of BST-2/Tetherin Transmembrane Domain",\N
17986,"17986","2013-04-02",\N,"Solution structure of cyclic gomesin peptide",\N
17987,"17987","2012-01-18","2012-06-30","New tricks of an old fold: structural versatility of scorpion toxins with common cysteine spacing",\N
17988,"17988","2011-11-17","2012-02-14","Evolutionary diversification of Mesobuthus {alpha}-scorpion toxins affecting sodium channels.",\N
17989,"17989","2012-01-31","2013-02-04","NMR resonance assignment of the UUP protein C-terminal domain",\N
17990,"17990","2011-11-09","2012-02-14","STRUCTURES AND INTERACTIONS ANALYSES OF THE INTEGRIN ALPHA-M BETA-2 CYTOPLASMIC TAILS",\N
17991,"17991","2012-01-09","2012-02-14","WSA major conformation",\N
17992,"17992","2012-01-09","2012-02-14","WSA minor conformation",\N
17993,"17993","2013-01-07","2013-04-12","A coiled-coil scaffold for GPCR loop investigations",\N
17994,"17994","2012-06-05","2013-03-04","Backbone 1H, 13C, and 15N Chemical Shift Assignment for inactive HIV-1 protease Bmut5",\N
17995,"17995","2011-11-17",\N,"Solution NMR structure of holo acyl carrier protein NE2163 from nitrosomonas europaea. Northeast structural genomics consortium target NET1",\N
17996,"17996","2012-06-05",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignment for inactive HIV-1 protease subtype C",\N
17997,"17997","2011-11-02",\N,"Solution structure of the Cd(II) form of Desulforedoxin",\N
17998,"17998","2012-10-01",\N,"Resonance assignments of the PPIase domain of FKBP42 from Arabidopsis thaliana",\N
17999,"17999","2012-01-18","2012-04-04","Chemical Shift Assignments from PfEMP1: Full-length",\N
18000,"18000","2012-01-17",\N,"Structural Basis for Molecular Interactions Involving MRG Domains: Implications in Chromatin Biology",\N
18001,"18001","2012-02-01","2012-10-01","1H, 13C and 15N chemical shift assignments of the PPIase domain of human aryl-hydrocarbon receptor-interacting protein (AIP)",\N
18002,"18002","2011-11-21","2013-02-15","Structural Basis of Phosphoinositide Binding to Kindlin-2 Pleckstrin Homology Domain in Regulating Integrin Activation",\N
18003,"18003","2012-03-09","2013-02-06","solution structure of apo-NmtR",\N
18004,"18004","2012-11-05",\N,"Structural and functional analysis of the DEAF-1 and BS69 MYND domains",\N
18005,"18005","2011-12-02","2012-05-01","TBA",\N
18006,"18006","2011-12-02","2012-05-01","TBA",\N
18007,"18007","2011-12-02","2012-05-01","TBA",\N
18008,"18008","2011-12-02","2012-05-01","TBA",\N
18009,"18009","2012-10-22","2013-03-12","NMR structure of the lambda 5 22-45 peptide",\N
18010,"18010","2011-11-21","2013-02-15","FF11-60",\N
18011,"18011","2012-03-27","2013-03-26","NMR assignments for TB24",\N
18012,"18012","2012-02-10","2013-02-06","Solution structure of N-terminal domain of human TIG3",\N
18013,"18013","2012-06-05","2013-02-06","Staphylococcal Nuclease PHS variant",\N
18014,"18014","2011-11-29",\N,"A Myristoylated Polyproline Type II Helix Functions as a Novel Fusion Peptide During Cell-Cell Membrane Fusion Induced by the Baboon Reovirus p15 FAST Protein",\N
18015,"18015","2011-11-28",\N,"Chemical shift assignments for the homeodomain of Pitx2 in complex with a TAATCC DNA binding site",\N
18016,"18016","2011-11-29",\N,"Solution structure of MSMEG_1053, the second DUF3349 annotated protein in the genome of Mycobacterium smegmatis. Seattle Structural Genomics Center for Infectious Disease (SSGCID) target MysmA.17112.b",\N
18017,"18017","2012-08-06","2013-02-06","The solution structure of RRM",\N
18018,"18018","2011-11-29",\N,"NMR structure of the putative ATPase regulatory protein YP_916642.1 from Paracoccus denitrificans",\N
18019,"18019","2012-10-22","2013-06-24","High-resolution solution structure of the orally active insecticidal spider venom peptide U1-TRTX-Sp1a",\N
18020,"18020","2013-02-19","2014-05-14","Backbone 1H, 13C, and 15N Chemical Shift Assignments of Apo Human Integrin Alpha1 I-domain",\N
18021,"18021","2013-02-19","2014-05-14","Backbone 1H, 13C, and 15N Chemical Shift Assignments of Mg2+ bound Human Integrin Alpha1 I-domain",\N
18022,"18022","2012-05-22","2013-02-07","Structure of the Cx43 C-terminal domain bound to tubulin",\N
18023,"18023","2012-07-16","2013-02-07","Cyclo-TC1 Trp-cage",\N
18024,"18024","2012-02-17","2013-02-07","13C and 15N chemical shift assignments of cAMP bound Cyclic Nucleotide-Binding Domain from a bacterial Cyclic Nucleotide-Gated channel",\N
18025,"18025","2011-11-29",\N,"hUBR2 ubr-box assigments",\N
18026,"18026","2012-03-09","2013-03-26","Backbone Chemical Shift Assignments for Unmyristoylated GCAP1 bound to Ca2+ ions",\N
18027,"18027","2012-05-15",\N,"Solution NMR structure of CaM bound to iNOS CaM binding domain peptide",\N
18028,"18028","2012-05-15",\N,"Solution NMR structure of CaM bound to the eNOS CaM binding domain peptide",\N
18029,"18029","2011-11-04","2011-12-12","1H, 13C, and 15N Chemical Shift Assignments for sf-ALR",\N
18031,"18031","2012-11-09",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for the ribosoaml assembly factor Fap7 from Pyrococcus horikoshii in its AP5A bound form",\N
18032,"18032","2011-12-01","2012-01-18","Solution NMR structure of the specialized holo-acyl carrier protein RPA2022 from Rhodopseudomonas palustris refined with NH RDCs. Northeast Structural Genomics Consortium Target RpR324.","/ftp/pub/bmrb/timedomain/bmr18032"
18034,"18034","2012-05-22",\N,"UNAC Tetraloops: To What Extent Can They Mimic GNRA Tetraloops",\N
18035,"18035","2012-05-22",\N,"UNAC Tetraloops: To What Extent Can They Mimic GNRA Tetraloops",\N
18036,"18036","2012-05-22",\N,"UNAC Tetraloops: To What Extent Can They Mimic GNRA Tetraloops",\N
18037,"18037","2012-05-22",\N,"NMR STRUCTURE OF THE IMIPENEM-ACYLATED L,D-TRANSPEPTIDASE FROM BACILLUS SUBTILIS",\N
18039,"18039","2012-03-09","2013-02-15","Solution structure ensemble of the two N-terminal apple domains (residues 58-231) of Toxoplasma gondii microneme protein 4",\N
18040,"18040","2012-03-02","2013-02-15","DNA TT mismatch and 2,7-BisNP",\N
18041,"18041","2012-01-23",\N,"Solution structure of the EDC3-LSm domain",\N
18042,"18042","2012-01-23",\N,"Structure of EDC3:DCP2",\N
18043,"18043","2012-03-07","2012-03-13","The Insect Defensin Lucifensin from Lucilia sericata",\N
18044,"18044","2012-03-19",\N,"Computational design of an eight-stranded (beta/alpha)-barrel from fragments of different folds",\N
18045,"18045","2012-03-09","2013-03-26","1H,13C, and 15N chemical shift assignments for human endothelial monocyte-activating polypeptide II",\N
18046,"18046","2012-11-05","2014-02-27","Sixth Gelsolin-like domain of villin",\N
18047,"18047","2011-11-28",\N,"NMR structure of the protein NP_814968.1 from Enterococcus faecalis",\N
18048,"18048","2012-06-19","2013-02-15","NPM1_C70",\N
18049,"18049","2012-03-19","2013-02-15","Low resolution structure of RNA-binding subunit of the TRAMP complex",\N
18050,"18050","2012-03-02","2013-02-15","Structure of a bis-naphthalene bound to a thymine-thymine DNA mismatch",\N
18051,"18051","2012-01-06",\N,"Solution NMR structure of the N-terminal myb-like 1 domain of the human cyclin-D-binding transcription factor 1 (hDMP1). Northeast Structural Genomics Consortium (NESG) target ID hr8011a.",\N
18052,"18052","2012-10-29",\N,"Structural analysis of the pyroglutamate modified isoform of the Alzheimer's disease related beta-amyloid using NMR spectroscopy",\N
18053,"18053","2011-12-06",\N,"Solution NMR structure of C-terminal globular domain of human Lamin-B2. Northeast Structural Genomics Consortium target HR8546A.",\N
18054,"18054","2013-01-04",\N,"NH chemical shift assignments for free AbpSH3",\N
18055,"18055","2013-01-04",\N,"NH chemical shift assignments for free AbpSH3 bound to WT Ark1p peptide",\N
18056,"18056","2013-01-04",\N,"NH chemical shift assignments for free AbpSH3 bound to WT Ark1p (ArkB) peptide",\N
18057,"18057","2013-01-04",\N,"NH chemical shift assignments for free AbpSH3 bound to mutant ArkA_H(-6)A peptide",\N
18058,"18058","2013-01-04",\N,"NH chemical shift Assignments for AbpSH3 bound to truncated ArkA peptide (SI)",\N
18059,"18059","2013-01-04",\N,"NH chemical shift Assignments for AbpSH3 bound to mutant ArkA peptide (K(-3)A)",\N
18060,"18060","2013-01-04",\N,"NH chemical shift Assignments for AbpSH3 bound to mutant ArkA peptide (K(-3)R)",\N
18061,"18061","2013-01-04",\N,"NH chemical shift Assignments for AbpSH3 bound to mutant ArkA peptide (K(-3)V)",\N
18062,"18062","2013-01-04",\N,"NH chemical shift Assignments for AbpSH3 bound to mutant ArkA peptide (K(3)A)",\N
18063,"18063","2013-01-04",\N,"NH chemical shift Assignments for AbpSH3 bound to mutant ArkA peptide (L(-7)A)",\N
18064,"18064","2013-01-04",\N,"NH chemical shift Assignments for AbpSH3 bound to mutant ArkA peptide (L(-7)V)",\N
18065,"18065","2013-01-04",\N,"NH chemical shift Assignments for AbpSH3 bound to truncated ArkA peptide (ArkA12)",\N
18066,"18066","2013-01-04",\N,"NH chemical shift Assignments for AbpSH3 bound to mutant ArkA peptide (ArkA_P(-4)A)",\N
18067,"18067","2013-01-04",\N,"NH chemical shift Assignments for AbpSH3 bound to mutant ArkA peptide (ArkA_P(2)A)",\N
18068,"18068","2013-01-04",\N,"NH chemical shift Assignments for AbpSH3 bound to mutant ArkA peptide (ArkA_P(2)V)",\N
18069,"18069","2013-01-04",\N,"NH chemical shift Assignments for AbpSH3 bound to mutant ArkA peptide (ArkA_P(0)A)",\N
18070,"18070","2013-01-03",\N,"NH chemical shift Assignments for AbpSH3 bound to mutant ArkA peptide (ArkA_P(-1)A)",\N
18071,"18071","2013-01-03",\N,"NH chemical shift Assignments for AbpSH3 bound to WT Prk1 peptide (ArkA_P(-1)A)",\N
18072,"18072","2013-01-03",\N,"NH chemical shift Assignments for AbpSH3 bound to mutant Ark1 peptide (ArkA15_H(-6)A_K(-8)A)",\N
18073,"18073","2013-01-03",\N,"NH chemical shift Assignments for AbpSH3 bound to Abp1 peptide (PRR)",\N
18074,"18074","2013-01-03",\N,"NH chemical shift Assignments for AbpSH3 bound to WT Scp1 peptide (Scp12)",\N
18075,"18075","2013-01-03",\N,"NH chemical shift Assignments for AbpSH3 bound to WT Scp1 peptide (Scp17)",\N
18076,"18076","2013-01-03",\N,"NH chemical shift Assignments for AbpSH3 bound to WT Sjl2 peptide (Sjl17)",\N
18077,"18077","2013-01-03",\N,"NH chemical shift Assignments for AbpSH3 bound to WT Srv2 peptide (Srv12)",\N
18078,"18078","2013-01-03",\N,"NH chemical shift Assignments for AbpSH3 bound to WT Srv2 peptide (Srv17)",\N
18079,"18079","2012-05-22",\N,"UNAC Tetraloops: To What Extent Can They Mimic GNRA Tetraloops",\N
18080,"18080","2012-01-25",\N,"structure of amyloid precursor protein's transmembrane domain",\N
18081,"18081","2012-06-19",\N,"Solution structure of Thermus thermophilus apo-CuA",\N
18082,"18082","2012-01-30","2013-02-15","SOLUTION NMR-DERIVED STRUCTURE OF CALMODULIN N-LOBE BOUND WITH ER alpha PEPTIDE",\N
18083,"18083","2012-08-29",\N,"Solution structure of a THP type 1 alpha 1 collagen fragment (772-786)",\N
18084,"18084","2012-01-30","2013-02-15","SOLUTION NMR-DERIVED STRUCTURE OF CALMODULIN C-LOBE BOUND WITH ER ALPHA PEPTIDE",\N
18085,"18085","2012-12-17",\N,"Alvinellacin",\N
18086,"18086","2012-09-04",\N,"GhoS (YjdK) monomer",\N
18087,"18087","2012-12-18","2013-01-08","solution structure of human apo-S100A1 C85M",\N
18088,"18088","2012-09-24","2013-02-15","Post-translational S-nitrosylation is an endogenous factor fine-tuning human S100A1 protein properties",\N
18089,"18089","2012-09-24","2013-02-15","Post-translational S-nitrosylation is an endogenous factor fine-tuning human S100A1 protein properties",\N
18090,"18090","2012-01-11","2013-02-15","Solution structure of the yeast Sti1 DP1 domain",\N
18091,"18091","2012-01-11","2013-02-15","Solution structure of the yeast Sti1 DP2 domain",\N
18092,"18092","2012-05-22",\N,"Solution structure of the N-terminal domain of human polypeptide chain release factor eRF1",\N
18093,"18093","2012-03-02","2013-02-15","NMR structures of the transmembrane domains of the nAChR a4 subunit",\N
18094,"18094","2013-01-07","2013-02-15","Solution structure of the AF4-AF9 complex",\N
18095,"18095","2011-12-01",\N,"Solution NMR Structure of Lysine-specific demethylase lid from Drosophila melanogaster, Northeast Structural Genomics Consortium Target FR824D",\N
18096,"18096","2012-03-02","2013-02-15","NMR structures of the transmembrane domains of the AChR b2 subunit",\N
18097,"18097","2012-08-06","2013-02-14","Backbone 1H, 13C, and 15N Chemical Shift Assignments for primate innate immunity protein",\N
18098,"18098","2011-12-05",\N,"Solution NMR Structure of mitochondrial succinate dehydrogenase assembly factor 2 from Saccharomyces cerevisiae, Northeast Structural Genomics Consortium Target YT682A",\N
18099,"18099","2012-02-01","2013-02-14","Solution structure of Ca2+-CIB1 in complex with the cytoplasmic domain of the integrin aIIb subunit",\N
18101,"18101","2012-02-10","2013-02-14","1H,15N and 13C backbone and side chain chemical shifts of Human Halo S100A1",\N
18102,"18102","2012-04-23","2013-03-26","Structure, Activity and Interactions of the Cysteine Deleted Analog of Tachyplesin-1 with Lipopolysaccharide Micelles",\N
18103,"18103","2012-02-01","2013-02-14","Backbone resonance assignments for G protein alpha i3 subunit in the GTP-bound state",\N
18104,"18104","2014-03-14",\N,"MARCKS MH2 Domain free and mAb 3C3 bounded",\N
18105,"18105","2014-03-14",\N,"MARCKS MH2 Domain free and mAb 3C3 bounded",\N
18106,"18106","2014-03-14",\N,"MARCKS MH2 Domain free and mAb 3C3 bounded",\N
18107,"18107","2012-08-21","2013-02-14","The NMR structure of a major allergen from dust mite",\N
18108,"18108","2012-11-09","2012-11-15","13C, 15N solid-state MAS NMR chemical shift assignment for YadA membrane anchor domain.",\N
18109,"18109","2012-01-06",\N,"1H, 13C and 15N resonance assignment of MmpS4",\N
18110,"18110","2011-12-20","2013-02-18","Solution Structure of C-terminal RAGE (ctRAGE)",\N
18111,"18111","2012-01-25",\N,"Structure of T7 transcription factor Gp2-E. coli RNAp jaw domain complex",\N
18112,"18112","2011-12-20","2012-01-18","Minimal Constraints Solution NMR Structure of Prospero Homeobox protein 1 from Homo sapiens. Northeast Structural Genomics Consortium Target HR4660B.","/ftp/pub/bmrb/timedomain/bmr18112"
18113,"18113","2013-04-02","2014-02-27","Sequence-specific 1H, 15N and 13C resonance assigments of Gad m 1: a allergenic parvalbumin from Atlantic Cod (Gadus morhua).",\N
18114,"18114","2012-01-17","2012-05-10","Solution structure of human LL-23 bound to membrane-mimetic micelles",\N
18115,"18115","2012-08-29",\N,"Solution Structure of The C-terminal Domain (537-610) of Human Heat Shock Protein 70",\N
18118,"18118","2012-01-25",\N,"NMR structure of the protein BC040485 from Homo sapiens",\N
18119,"18119","2012-12-04",\N,"ITK-SH3",\N
18121,"18121","2012-03-09","2013-03-26","1H, 13C, and 15N chemical shift assignments for CdnLNt from Myxoccoccus xanthus",\N
18122,"18122","2011-12-16","2013-03-26","1H, 13C, and 15N resonance assignments of Photoactive Yellow Protein",\N
18123,"18123","2012-03-09","2013-03-26","Resonance assignments of the 56 kDa chimeric avidin in the biotin-bound and free forms",\N
18125,"18125","2012-03-09","2013-03-26","Resonance assignments of the 56 kDa chimeric avidin in the biotin-bound and free forms",\N
18126,"18126","2012-09-10","2014-02-27","Backbone Chemical Shifts of the designed protein Z-L2LBT",\N
18127,"18127","2012-01-05","2012-01-11","Structural Model for a 40-Residue Beta-Amyloid Fibril with Two-Fold Symmetry, Positive Stagger",\N
18128,"18128","2012-01-05","2012-01-11","Structural Model for a 40-Residue Beta-Amyloid Fibril with Two-Fold Symmetry, Negative Stagger",\N
18129,"18129","2012-01-05","2012-01-11","Structural Model for a 40-residue Beta-Amyloid Fibril with Three-Fold Symmetry, Positive Stagger",\N
18130,"18130","2013-04-15","2014-02-27","1H, 13C and 15N chemical shift assignments of thioredoxin 2 from Pseudomonas aeruginosa PAO1 in its reduced form",\N
18131,"18131","2012-01-05","2012-01-11","'Structural Model for a 40-residue Beta-Amyloid Fibril with Three-Fold Symmetry, Negative Stagger",\N
18132,"18132","2012-03-23","2012-05-10","THERMOSTABLE PROTEIN FROM HYPERTHERMOPHILIC VIRUS SSV-RH",\N
18133,"18133","2012-06-21","2014-02-27","1H, 13C, 15N backbone and sidechain of human AK1 from Escherichia coli",\N
18134,"18134","2012-02-17","2012-05-10","SOLUTION STRUCTURE OF THE FIRST SAM DOMAIN OF ODIN",\N
18135,"18135","2012-12-04","2013-03-12","A single GalNAc residue on Threonine-106 modifies the dynamics and the structure of Interferon alpha-2a around the glycosylation site.",\N
18137,"18137","2012-01-09","2014-02-27","NMR assignment of the monomeric DUF59 domain of human Fam96a",\N
18138,"18138","2012-09-19","2014-02-27","Backbone 1H, 13C, and 15N Chemical Shift Assignments for the Multi-Drug Resistant HIV-1 Protease Variant, MDR 769",\N
18141,"18141","2012-03-19","2012-05-10","Solution NMR structure of the novel conotoxin im23a from Conus imperialis",\N
18142,"18142","2012-06-26",\N,"MOZ",\N
18145,"18145","2012-01-31","2012-12-12","Solution NMR Structure of DE NOVO DESIGNED PROTEIN, IF3-like fold, Northeast Structural Genomics Consortium Target OR135 (CASD target)","/ftp/pub/bmrb/timedomain/bmr18145"
18146,"18146","2012-11-15","2013-02-13","Insight into the antimicrobial activities based on the Structure-activity relationships of coprisin isolated from the Dung Beetle, Copris tripartitus",\N
18147,"18147","2012-03-07","2012-05-10","Assigned NMR chemical shift of Escherichia coli Ribosome binding factor A",\N
18148,"18148","2012-03-02",\N,"VEGFR2-Integrin B3 interaction",\N
18151,"18151","2012-03-09","2013-03-26","1H, 13C, and 15N chemical shift assignments for CdnL from Myxoccoccus xanthus",\N
18152,"18152","2012-09-19","2013-02-13","Backbone 1H, 13C, and 15N Chemical Shift Assignments for the catalytic domain of B. anthracis SrtD",\N
18153,"18153","2012-02-28",\N,"The solution structure of thermomacin",\N
18155,"18155","2012-03-27","2013-03-26","1H, 13C, and 15N chemical shift assignments of the second immunoglobulin domain of the membrane receptor Neurolin from Carassius auratus",\N
18156,"18156","2012-02-06",\N,"Solution NMR Structure of the mitochondrial inner membrane domain (residues 164-251), FtsH_ext, from the paraplegin-like protein AFGL32 from Homo sapiens, Northeast Structural Genomics Consortium Target HR6741A","/ftp/pub/bmrb/timedomain/bmr18156"
18157,"18157","2012-01-04","2014-05-14","Backbone 1H, 13C, and 15N Chemical Shift Assignments for the Avirulence homolog-5",\N
18158,"18158","2012-01-26",\N,"Solution NMR structure of N-terminal domain (6-74) of human ZBP1 protein, Northeast Structural Genomics Consortium Target HR8174A.","/ftp/pub/bmrb/timedomain/bmr18158"
18159,"18159","2013-07-08",\N,"Solution NMR structure of the C-terminal extension of two bacterial light, oxygen, voltage (LOV) photoreceptor proteins from Pseudomonas putida",\N
18160,"18160","2013-07-08",\N,"Solution NMR structure of the C-terminal extension of two bacterial light, oxygen, voltage (LOV) photoreceptor proteins from Pseudomonas putida",\N
18161,"18161","2012-02-06",\N,"Solution NMR Structure of DE NOVO DESIGNED PROTEIN, PFK fold, Northeast Structural Genomics Consortium Target OR134","/ftp/pub/bmrb/timedomain/bmr18161"
18162,"18162","2012-08-16",\N,"Neurotensin 40 structures in water pH 5.5 298 K. NMR data & structures",\N
18163,"18163","2012-08-16",\N,"Neurotensin 40 structures in DMPC:CHAPS bicelle pH 5.5 298 K, NMR data & structures",\N
18164,"18164","2012-08-16",\N,"Neurotensin 40 structures in DMPC:CHAPS:GM1 bicelle pH 5.5 298 K, NMR data & structures",\N
18165,"18165","2012-08-27","2013-02-13","Enterohaemorrhagic E. coli (EHEC) exploits a tryptophan switch to hijack host F-actin assembly",\N
18166,"18166","2012-02-17",\N,"Solution NMR Structure of Stress-induced-phosphoprotein 1 STI1 from Homo sapiens, Northeast Structural Genomics Consortium Target HR4403E",\N
18167,"18167","2012-03-23","2013-02-13","Solution Structure of Cyanobacterial PsbP (CyanoP) from Synechocystis sp. PCC 6803",\N
18169,"18169","2012-04-23",\N,"Solution structure of Ca-bound S100A4 in complex with non-muscle myosin IIA",\N
18170,"18170","2012-10-15","2013-02-13","Structure of human CXCR1 in phospholipid bilayers",\N
18171,"18171","2012-09-14","2013-02-13","Solution structure of atTic-hip/hop domain (Residue 310-371)",\N
18175,"18175","2012-02-06","2013-03-26","40-residue D23N beta amyloid fibril",\N
18176,"18176","2012-06-18","2013-02-13","Backbone chemical shift assignments for the oxidized form of cVIMP-Cys",\N
18177,"18177","2012-06-18","2013-02-13","Backbone chemical shift assignments for the reduced form of cVIMP-Cys",\N
18178,"18178","2013-01-07","2013-03-12","Solution structure of AGR2 residues 41-175",\N
18179,"18179","2013-01-07","2013-03-12","Solution structure of E60A mutant AGR2",\N
18180,"18180","2012-01-12",\N,"Solution NMR Structure of the uncharacterized protein from gene locus rrnAC0354 of Haloarcula marismortui. Northeast Structural Genomics Consortium Target HmR11.","/ftp/pub/bmrb/timedomain/bmr18180"
18181,"18181","2012-03-09","2012-05-10","Solution structure of GspC-HR of typeII secretion system",\N
18182,"18182","2012-11-19",\N,"Identification and structural basis for a novel interaction between Vav2 and Arap3",\N
18183,"18183","2012-11-19",\N,"Identification and structural basis for a novel interaction between Vav2 and Arap3",\N
18184,"18184","2012-08-06","2013-02-13","ShB peptide structure bound to negatively charged lipid-bilayer after Molecular Dynamics refinement",\N
18185,"18185","2012-04-05","2013-03-26","Backbone 1H and 15N Chemical Shift Assignments of the VHS-UIM domains of STAM2",\N
18186,"18186","2012-02-10","2012-05-10","Solution structure of the Get5 carboxyl domain from S. cerevisiae",\N
18187,"18187","2012-02-10","2012-05-10","Solution structure of the Get5 carboxyl domain from A. fumigatus",\N
18188,"18188","2012-03-27","2013-03-25","CohA2",\N
18189,"18189","2012-03-27","2013-03-25","DocA",\N
18190,"18190","2012-02-13",\N,"NMR structure of the protein BC008182, a DNAJ-like domain from Homo sapiens",\N
18191,"18191","2012-03-23",\N,"Solution structure of Sgf11(63-99) zinc finger domain",\N
18192,"18192","2012-03-23",\N,"Solution structure of Sgf73(59-102) zinc finger domain",\N
18193,"18193","2012-07-30",\N,"1H, 13C, and 15N chemical shift assignments for the N-terminal domain of Thermus thermophilus CdnL",\N
18194,"18194","2013-11-11",\N,"1H, 13C, and 15N chemical shift assignments for the 72-residue N-terminal domain of Myxococcus xanthus CarD",\N
18195,"18195","2013-01-22",\N,"NMR Solution Structure of Optineurin Zinc-finger Domain",\N
18196,"18196","2012-05-22","2014-02-27","Backbone assignment for an intracellular proteinase inhibitor of Bacillus Subtilis",\N
18197,"18197","2012-05-11","2013-03-25","rat Angiogenin",\N
18198,"18198","2012-09-14","2013-02-13","Chemical Shift Assignment of the PP1 Binding Domain of NIPP1",\N
18199,"18199","2012-05-08","2012-05-10","Structural Basis for Bifunctional Zn(II) Macrocyclic Complex Recognition of Thymine Bulges in DNA. Structure of a Thymine bulge.",\N
18200,"18200","2012-05-08","2013-03-25","Resonance assignments for C-terminal DNA-binding domain of RstA protein from Klebsiella pneumonia",\N
18201,"18201","2012-03-23","2013-03-25","1H, 13C and 15N resonance assignments of the periplasmic signaling domain of HasR, a TonB-dependent outer membrane heme transporter",\N
18202,"18202","2012-05-02","2013-02-18","Backbone and partial sidechain assignment (13C only) of hNaa50p assignment",\N
18203,"18203","2013-01-22","2014-02-27","NMR solution structure of Mu-contoxin BuIIIB",\N
18204,"18204","2012-03-02","2013-02-13","Backbone 1H, 13C, and 15N Chemical Shift Assignments for human PEBP1",\N
18205,"18205","2012-03-02",\N,"PDZ Domain of CAL (Cystic Fibrosis Transmembrane Regulator-Associated Ligand)",\N
18206,"18206","2013-01-22","2014-02-27","Conotoxin analogue [D-Ala2]BuIIIB",\N
18207,"18207","2013-04-02",\N,"A53T alpha-synuclein fibrils",\N
18208,"18208","2013-04-02",\N,"Chemical shift assignments of the E46K alpha-synuclein fibrils",\N
18209,"18209","2012-05-08","2013-02-13","Solution-state structure of an intramolecular G-quadruplex w th propeller, diagonal and edgewise loops",\N
18210,"18210","2012-05-08",\N,"Structure of the Plasmodium 6-cysteine s48/45 Domain",\N
18211,"18211","2012-03-13","2013-03-25","1H, 15N and 13C resonance assignments for the LOTUS2 and LOTUS3 RNA binding domains of mouse TDRD7",\N
18214,"18214","2012-03-19",\N,"Solution NMR structure of TSTM1273 from Salmonella typhimurium LT2, NESG target STT322, CSGID target IDP01027 and OCSP target TSTM1273",\N
18215,"18215","2012-02-03",\N,"Solution NMR Structure of the uncharacterized protein from gene locus VNG_0733H of Halobacterium salinarium, Northeast Structural Genomics Consortium Target HsR50.","/ftp/pub/bmrb/timedomain/bmr18215"
18216,"18216","2012-02-10","2013-02-13","NMR structure of an acyl-carrier protein from Rickettsia prowazekii.(Seattle Structural Genomics Center for Infectious Disease (SSGCID))",\N
18217,"18217","2012-05-22","2013-07-15","Backbone structure of human membrane protein HIGD1A",\N
18218,"18218","2012-05-22","2013-07-15","Backbone structure of human membrane protein HIGD1B",\N
18219,"18219","2012-05-22","2013-07-15","Backbone structure of human membrane protein TMEM14A from NOE data",\N
18220,"18220","2012-05-22","2013-07-15","Backbone structure of human membrane protein TMEM14A",\N
18221,"18221","2012-05-22","2013-07-15","Backbone structure of human membrane protein FAM14B (Interferon alpha-inducible protein 27-like protein 1)",\N
18222,"18222","2012-05-22","2013-02-13","Backbone structure of human membrane protein TMEM141",\N
18223,"18223","2012-05-22","2013-07-15","Backbone structure of human membrane protein TMEM14C",\N
18224,"18224","2013-01-14",\N,"AR55 solubilised in SDS micelles",\N
18225,"18225","2013-01-14",\N,"AR55 solubilised in DPC micelles",\N
18226,"18226","2013-01-14",\N,"AR55 solubilised in LPPG micelles",\N
18227,"18227","2013-01-14",\N,"Solution structure of AR55 in 50% HFIP",\N
18228,"18228","2012-03-08","2013-03-15","Backbone and side chain assignment of TpbA",\N
18229,"18229","2012-03-02","2013-02-13","NMR structure of the complex between the PH domain of the Tfb1 subunit from TFIIH and Rad2",\N
18230,"18230","2013-02-18","2014-02-27","Solution structure and dynamics of human S100A1 protein modified at cysteine 85 with homocysteine disulfide bond formation in calcium saturated form.",\N
18231,"18231","2013-02-18","2014-02-27","Solution structure of S100A1 Ca2+",\N
18232,"18232","2012-04-23","2012-06-18","Solid-state NMR assignments for mouse alpha-synuclein fibrils",\N
18234,"18234","2012-10-22",\N,"Solution structure of P1-CheY/P2 complex in bacterial chemotaxis",\N
18235,"18235","2012-06-14",\N,"Solution Structure Of The N-Terminal Domain Of The Yeast Protein Dre2",\N
18237,"18237","2013-02-05","2014-05-14","Structure of gp41-M-MAT, a membrane associated MPER trimer from HIV-1 gp41.",\N
18238,"18238","2012-04-16","2012-06-14","SOLUTION STRUCTURE OF AN APOPTOSIS ACTIVATING PHOTOSWITCHABLE BAK PEPTIDE BOUND to BCL-XL",\N
18239,"18239","2012-03-13","2012-05-10","Pseudo-triloop from the sub-genomic promoter of Brome Mosaic Virus",\N
18240,"18240","2012-03-13","2012-06-14","Mutant of the sub-genomic promoter from Brome Mosaic Virus",\N
18242,"18242","2012-06-05","2014-02-27","Backbone and sidechain 1H, 15N and 13C assignments of NLRP10 (PYNOD) pyrin domain",\N
18243,"18243","2012-09-24","2013-02-13","WT AS fibrils (1H detection experiments)",\N
18244,"18244","2012-03-28",\N,"Structure of the complex of the central activation doamin of Gcn4 bound to the mediator co-activator domain 1 of Gal11/med15",\N
18245,"18245","2012-11-28",\N,"Backbone assignment of porcine pepsin",\N
18246,"18246","2012-11-28",\N,"Backbone assignment of porcine pepsin complex with pepstatin",\N
18248,"18248","2012-08-27","2015-06-01","Assignments for the dually targeting peptide from Thr-tRNA synthetase",\N
18249,"18249","2013-02-20","2013-03-15","1H, 13C and 15N backbone and side-chain resonance assignments of reduced CcmG from Escherichia coli",\N
18250,"18250","2012-03-12","2012-06-14","NMR STRUCTURE of Bcl-XL",\N
18253,"18253","2012-03-23",\N,"1H, 13C and 15N NMR assignments of inactive form of P1 endolysin Lyz at pH 7.5",\N
18254,"18254","2012-09-14",\N,"1H and 15N resonance assignments for Pseudomonas aeruginosa apo-azurin",\N
18255,"18255","2012-03-19",\N,"\"Solution structure of a MbtH-like protein from Burkholderia pseudomallei, the etiological agent responsible for melioidosis. Seattle Structural Genomics Center for Infectious Disease (SSGCID) target BupsA.13472.b.\"",\N
18256,"18256","2013-02-11","2014-02-25","R state structure of monomeric phospholamban (C36A, C41F, C46A)",\N
18257,"18257","2012-09-14","2014-02-25","E. coli DmsD",\N
18260,"18260","2012-05-22","2013-02-13","1H, 13C and 15N resonance assignment of chicken brain alpha spectrin repeat 17",\N
18261,"18261","2012-06-26","2013-02-13","NMR structure of a monomeric mutant (A72R) of major ampullate spidroin 1 N-terminal domain",\N
18262,"18262","2012-06-26","2013-02-13","NMR structure of major ampullate spidroin 1 N-terminal domain at pH 7.2",\N
18263,"18263","2012-03-19",\N,"Solution NMR of the specialized apo-acyl carrier protein (RPA2022) from Rhodopseudomonas palustris, Northeast Structural Genomics Consortium Target RpR324","/ftp/pub/bmrb/timedomain/bmr18263"
18266,"18266","2012-06-05","2014-02-25","Backbone assignment of Dengue Virus NS2B/NS3 in complex with Aprotinin",\N
18267,"18267","2012-03-27","2012-05-10","Substrate-dependent millisecond domain motions in DNA polymerase beta",\N
18268,"18268","2012-05-08","2012-06-14","Unliganded (apo) C-terminal EF-hand domain from human polycystin-2",\N
18269,"18269","2012-06-13",\N,"Solution Structure of N-Terminal domain of human Conserved Dopamine Neurotrophic Factor (CDNF)",\N
18276,"18276","2012-03-23","2013-06-19","1H, 13C and 15N chemical shifts for Salmonella Typhimurium PrgI Type three secretion system needle subunit",\N
18277,"18277","2012-06-13","2013-02-13","Solution structures of KmAtg10",\N
18278,"18278","2013-02-05",\N,"Solution Structure of FKBP12 from Aedes aegypti",\N
18279,"18279","2012-03-22","2013-02-13","human CEB25 minisatellite G-quadruplex",\N
18280,"18280","2013-02-18",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for CD81LEL",\N
18281,"18281","2012-03-22","2013-02-13","Solution Structure of Strawberry Allergen Fra a 1e",\N
18282,"18282","2012-08-21","2013-02-13","SOLUTION STRUCTURE OF THE M-PMV MYRISTOYLATED MATRIX PROTEIN",\N
18283,"18283","2013-04-15",\N,"Assignment of E coli periplasmic protein YmgD",\N
18284,"18284","2012-10-22",\N,"Solution structure of de novo designed antifreeze peptide 1m",\N
18286,"18286","2012-10-22",\N,"Solution structure of de novo designed antifreeze peptide 3",\N
18287,"18287","2012-03-22","2012-05-10","Backbone and sidechain 1H chemical shifts for PAP248-286 (SEVI) in solution at pH 6",\N
18288,"18288","2012-03-22","2014-02-25","1H, 13C and 15N chemical shift assignments of Ninjurin1 ENT domain",\N
18289,"18289","2012-10-22",\N,"Solution structure of de novo designed peptide 4m",\N
18290,"18290","2012-03-22",\N,"Solution NMR Structure of syc0711_d from Synechococcus sp., Northeast Structural Genomics Consortium (NESG) Target SnR212",\N
18291,"18291","2012-08-21","2012-11-20","Backbone 1HN, 13C, and 15N Chemical Shift Assignments for Granulocyte colony-stimulating factor",\N
18292,"18292","2012-03-22",\N,"NMR structure of the RNA binding motif 39 (RBM39) from Mus musculus",\N
18293,"18293","2012-08-21","2012-11-20","Backbone 1HN, 13C, and 15N Chemical Shift Assignments for Granulocyte colony-stimulating factor A29G",\N
18294,"18294","2012-08-21","2012-11-20","Backbone 1HN, 13C, and 15N Chemical Shift Assignments for Granulocyte colony-stimulating factor A30G",\N
18295,"18295","2012-08-21","2012-11-20","Backbone 1HN, 13C, and 15N Chemical Shift Assignments for Granulocyte colony-stimulating factor A37G",\N
18296,"18296","2012-10-22","2013-02-18","Solution structure of BRD1 PHD2 finger",\N
18297,"18297","2012-08-29","2013-02-13","E2 binding surface on Uba3 beta-grasp domain undergoes a conformational transition",\N
18298,"18298","2013-01-22","2014-05-14","Domain interaction in Thermotoga maritima NusG",\N
18299,"18299","2013-03-25",\N,"Solution structure of the K60A mutant of Atox1",\N
18300,"18300","2013-02-05",\N,"Solution NMR structure of asteropusin A from marine sponge Asteropus sp.",\N
18301,"18301","2013-07-01",\N,"Metal binding repeat 2 of the Wilson disease protein (ATP7B)",\N
18302,"18302","2012-06-04","2012-06-14","Solution structure of the calcium-bound CaM N-terminal domain in a complex.",\N
18303,"18303","2012-03-29","2013-03-15","1H, 13C, and 15N Chemical Shift Assignments for PfPMT, a Phosphoethanolamine Methyltransferase from Plasmodium falciparum",\N
18304,"18304","2012-06-13","2013-02-13","Order parameters for HEWL",\N
18305,"18305","2012-06-13","2013-02-13","Order parameters for HEWL-chitotriose",\N
18306,"18306","2012-03-28",\N,"Human APOBEC2 chemical shifts, RDC, NOE, and T1/T2 data",\N
18307,"18307","2012-03-28",\N,"Human APOBEC2 chemical shifts",\N
18309,"18309","2012-06-13","2013-02-13","Chemical Shift 1H, 13C, 15N Assignments of N-terminal domain of Thermotoga Maritima flagellar motor protein FliG",\N
18310,"18310","2012-06-13","2013-02-13","Chemical Shift 1H, 13C, 15N Assignments of N-terminal domain of Thermotoga Maritima flagellar motor protein FliG bound to unlabeled FliF C-terminal peptide",\N
18312,"18312","2012-06-18","2014-02-25","1H, 13C and 15N assignments of Cyclophilin A from Piriformospora indica, a plant root-colonizing basidiomycete fungus",\N
18313,"18313","2013-02-11",\N,"Solution Structure of the A domain of talin",\N
18314,"18314","2012-05-08",\N,"NMR structure of FOXO3a transactivation domains (CR2C-CR3) in complex with CBP KIX domain (2b3l conformation)",\N
18315,"18315","2012-05-08",\N,"NMR structure of FOXO3a transactivation domains (CR2C-CR3) in complex with CBP KIX domain (2l3b conformation)",\N
18316,"18316","2012-04-11","2013-03-12","Solution structure of the C-terminal domain of the MgtC protein from Mycobacterium tuberculosis",\N
18317,"18317","2012-06-18","2014-02-25","Chemical shift assignments of the canecystatin-1 from Saccharum officinarum",\N
18318,"18318","2012-09-14","2013-02-13","Solution structure of CHCH5",\N
18319,"18319","2012-09-14",\N,"1H, 13C and 15N full assignment of transmembrane domain TM12 from human Y4 receptor",\N
18320,"18320","2012-05-15","2013-02-13","Solution Structures of RadA intein from Pyrococcus horikoshii",\N
18321,"18321","2012-08-29",\N,"Solution structure of CRKL",\N
18322,"18322","2012-09-14","2013-04-16","Mrx1 reduced",\N
18323,"18323","2012-05-08",\N,"Solution structure of the calcium-bound CaM C-terminal domain in a complex",\N
18324,"18324","2012-09-14","2014-02-25","Backbone Resonance Assignments of the Micro-RNA Interaction Region of Human TRBP2",\N
18325,"18325","2012-09-14","2013-07-15","Mrx1 oxidized",\N
18326,"18326","2012-06-05","2014-02-25","1H, 13C, and 15N resonance assignments of Ni(II)-NmtR",\N
18327,"18327","2013-01-03","2013-04-16","Solution structure of the atypical SH3 domain of DOCK180",\N
18328,"18328","2012-09-14","2013-02-13","Solution structure of CHCHD7",\N
18329,"18329","2013-01-15",\N,"Structure of decorbin-binding protein A from Borrelia burgdorferi",\N
18331,"18331","2012-09-14","2014-02-25","1H, 13C and 15N assignments of the holo-acyl carrier protein of Pseudomonas aeruginosa",\N
18332,"18332","2012-06-05","2013-02-13","E. coli Protein",\N
18333,"18333","2012-08-29",\N,"Solution structure of phosphorylated CRKL",\N
18334,"18334","2012-05-29","2013-02-13","NMR spatial structure of the trypsin inhibitor BWI-2c from the buckwheat seeds",\N
18335,"18335","2012-04-16","2012-06-14","Structure and orientation of the gH625-644 membrane interacting region of herpes simplex virus type 1 in a membrane mimetic system.",\N
18336,"18336","2012-07-30","2013-02-13","Structure of the RNA claw of the DNA packaging motor of bacteriophage 29",\N
18337,"18337","2012-04-16",\N,"SOLUTION NMR STRUCTURE OF DE NOVO DESIGNED PROTEIN, P-LOOP NTPASE FOLD, NORTHEAST STRUCTURAL GENOMICS CONSORTIUM TARGET OR136","/ftp/pub/bmrb/timedomain/bmr18337"
18338,"18338","2013-01-03","2013-02-13","C-terminal propeptide (PPc) region of vibrio extracellular metalloprotease",\N
18339,"18339","2012-04-11","2012-06-14","1H, 15N and 13C backbone resonance assignments of FTSA",\N
18340,"18340","2012-12-04","2013-02-13","Structural Mechanism for Bax Inhibition by Cytomegalovirus Protein vMIA",\N
18341,"18341","2012-11-15","2014-02-25","Sgt2_NT",\N
18342,"18342","2012-11-15","2014-02-25","Backbone and sidechain assignments for Get5_UBL domain",\N
18344,"18344","2013-01-03","2013-03-25","Gal-GalNac-Interferon Alpha-2a",\N
18345,"18345","2012-04-30",\N,"Solution structure of the anti-fungal defensin DEF4 (MTR_8g070770) from Medicago truncatula (barrel clover)",\N
18346,"18346","2012-04-30",\N,"NMR structure of the protein NP_390037.1 from Bacillus subtilis.",\N
18347,"18347","2012-05-22","2013-02-13","1H chemical shift assignments for micasin",\N
18348,"18348","2012-11-15","2013-02-13","Backbone 1H, 13C, and 15N Chemical Shift Assignments for EB1 CH domain",\N
18349,"18349","2012-07-02",\N,"NMR structure of a LINE-1 type transposase domain-containing protein 1 (L1TD1) from HOMO SAPINES",\N
18350,"18350","2013-03-25",\N,"cathelicidin-PY",\N
18351,"18351","2013-06-04","2014-02-25","Solution structure of the Class II hydrophobin NC2",\N
18352,"18352","2012-04-30",\N,"Solution NMR Structure of CASP8-associated protein 2 from Homo sapiens, Northeast Structural Genomics Consortium (NESG) Target HR8150A","/ftp/pub/bmrb/timedomain/bmr18352"
18353,"18353","2012-06-11","2014-02-25","1H, 15N and 13C backbone resonance assignments of the Kelch domain of mouse Keap1",\N
18354,"18354","2012-04-30","2014-05-14","High-resolution solution NMR structure of the rho-conotoxin TIA.",\N
18355,"18355","2013-05-20",\N,"NMR Structure of Signal Sequence Deleted (SSD) Rv0603 Protein from Mycobacterium tuberculosis without N-terminal His-tag",\N
18356,"18356","2013-05-20",\N,"Solution Structure of ADF like UNC-60A Protein of Caenorhabditis elegans",\N
18357,"18357","2012-05-01",\N,"The solution structure of the monomeric Acanthaporin",\N
18358,"18358","2012-05-01",\N,"The solution structure of the dimeric Acanthaporin",\N
18359,"18359","2012-09-14",\N,"The chemical shifts and T1, T2, and 1H-15N NOE data for apo-IscU(D39V)",\N
18360,"18360","2012-09-14",\N,"The chemical shifts and T1, T2, and 1H-15N NOE data for apo-IscU(E111A)",\N
18361,"18361","2012-09-14",\N,"The chemical shifts and T1, T2, and 1H-15N NOE data for apo-IscU(N90A)",\N
18362,"18362","2012-09-14",\N,"The chemical shifts and T1, T2, and 1H-15N NOE data for apo-IscU(S107A)",\N
18363,"18363","2013-04-01",\N,"'Backbone Chemical Shift Assignments for Scylla Serrata anti lipopolysaccharide Factor-24 (SsALF-24) peptide'",\N
18364,"18364","2012-04-30",\N,"NMR structure of the protein YP_001300941.1 from Bacteroides vulgatus",\N
18365,"18365","2012-04-18","2013-02-13","Backbone and side chain 1H, 13C, and 15N Chemical Shift Assignments for Hen Egg White Lysozyme mutant WT-ALA",\N
18366,"18366","2012-04-18","2013-02-13","Backbone 1H and 15N Chemical Shift Assignments for Hen Egg White Lysozyme mutant W28G.",\N
18367,"18367","2012-04-18","2013-02-13","Backbone 1H and 15N Chemical Shift Assignments for Hen Egg White Lysozyme mutant W62G.",\N
18368,"18368","2012-04-18","2013-02-13","Backbone 1H and 15N Chemical Shift Assignments for Hen Egg White Lysozyme mutant W108G.",\N
18369,"18369","2012-04-18","2013-02-13","Backbone 1H and 15N Chemical Shift Assignments for Hen Egg White Lysozyme mutant W111G.",\N
18370,"18370","2012-04-18","2013-02-13","Backbone 1H and 15N Chemical Shift Assignments for Hen Egg White Lysozyme mutant W123G.",\N
18371,"18371","2012-11-15","2013-02-13","Backbone 1H, 13C, and 15N Chemical Shift Assignments for EB1 C-terminal domain",\N
18372,"18372","2012-05-01",\N,"SOLUTION NMR STRUCTURE OF DE NOVO DESIGNED PROTEIN, P-LOOP NTPASE FOLD, NORTHEAST STRUCTURAL GENOMICS CONSORTIUM TARGET OR137","/ftp/pub/bmrb/timedomain/bmr18372"
18373,"18373","2012-05-01",\N,"bLac - Oceanobacillus iheyensis",\N
18374,"18374","2012-10-15","2013-02-13","NMR structure of the second PHD finger of AIRE (AIRE-PHD2)",\N
18375,"18375","2012-05-01",\N,"NMR solution structure of staphyloxanthin biosynthesis protein",\N
18376,"18376","2012-04-16","2013-03-25","Free MTIP(61-204) from Plasmodium falciparum",\N
18377,"18377","2012-04-16","2013-03-25","MTIP(61-204) from Plasmodium falciparum bound to peptide MyoA(799-818)",\N
18378,"18378","2013-07-08",\N,"Liraglutide",\N
18379,"18379","2012-05-14","2013-02-13","Solution Structures of the IIA(Chitobiose)-HPr complex of the N,N'-Diacetylchitobiose Branch of the Escherichia coli Phosphotransferase System",\N
18380,"18380","2012-04-26","2013-02-13","Backbone 1H, 13C, and 15N Chemical Shift Assignments and Complete 15N Relaxation Analysis of the Soluble C-terminal Domain of CcmE Heme Chaperone from Desulfovibrio vulgaris, dvCcmE(44-137). Northeast Structural Genomics Target DvR115.","/ftp/pub/bmrb/timedomain/bmr18380"
18381,"18381","2012-09-14",\N,"The backbone chemical shifts of IscU complexed with HscA",\N
18385,"18385","2012-05-21","2012-06-14","Characterization of the chromoshadow domain-mediated binding of heterochromatin protein 1 alpha (HP1 alpha) to histone H3: Backbone 1H, 15N chemical shift assignments for histone H3 (1-59)",\N
18386,"18386","2012-05-21","2012-06-14","Characterization of the chromoshadow domain-mediated binding of heterochromatin protein 1 alpha (HP1 alpha) to histone H3: Backbone 1H, 15N chemical shift assignments for HP1 CSDalpha(109-185)",\N
18387,"18387","2012-05-21",\N,"Solution structure of a thiol:disulfide interchange protein from Bacteroides sp.",\N
18388,"18388","2013-02-05","2013-04-16","Solution structure, dynamics and binding studies of CtCBM11",\N
18389,"18389","2013-02-05","2013-04-16","Solution structure, dynamics and binding studies of CtCBM11",\N
18390,"18390","2012-05-15","2012-06-30","Chemical Shift Assignment and Solution Structure of ChR145 from Drosophila melanogaster. Northeast Structural Genomics Consortium Target Fr822A",\N
18391,"18391","2012-10-22",\N,"Solution structure of the R3H domain from human Smubp-2 in complex with 2'-deoxyguanosine-5'-monophosphate",\N
18392,"18392","2012-09-14",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for the C-terminal Domain of E. coli Enzyme I",\N
18393,"18393","2013-01-22","2014-05-14","The second dsRBD domain from A. thaliana DICER-LIKE 1",\N
18394,"18394","2012-04-24",\N,"Solution structure of the uncharacterized thioredoxin-like protein BVU_1432 from Bacteroides vulgatus",\N
18395,"18395","2012-09-24","2013-02-13","Chemical shift assignments of deuterated DsbB by 1H-detected solid-state NMR",\N
18396,"18396","2012-09-24","2013-02-13","nanocrystalline DsbA 1H, 13C, 15N chemical shifts",\N
18397,"18397","2012-09-24","2013-02-13","nanocrystalline GB1 1H, 13C, 15N assignments",\N
18398,"18398","2012-04-24","2013-04-19","Solution Structure of the WNK1 Autoinhibitory Domain",\N
18399,"18399","2013-04-22",\N,"Solution structure of a ubiquitin-like protein from Trypanosoma brucei",\N
18400,"18400","2012-05-31",\N,"RNA structural dynamics are modulated through anti-folding by chaperones",\N
18403,"18403","2012-07-17","2013-07-10","1H,13C and 15N resonance assignment of the UIM-SH3 construct of the STAM2 protein",\N
18404,"18404","2012-12-04",\N,"Solution Structure of the Target Recognition Domain of Zoocin A",\N
18405,"18405","2012-08-30",\N,"Structure of Sviceucin, an type I lasso peptide from Streptomyces sviceus",\N
18406,"18406","2014-02-11",\N,"Solid-state NMR sequential assignments of Sup35NM",\N
18407,"18407","2014-02-11",\N,"Solid-state NMR sequential assignments of full-length Sup35p",\N
18408,"18408","2012-05-22","2013-02-12","1H Chemical Shift Assignments for the first transmembrane domain from human copper transport 1",\N
18409,"18409","2012-05-22","2013-02-12","1H Chemical Shift Assignments for the second transmembrane domain from human copper transport 1",\N
18410,"18410","2012-05-22","2013-02-12","1H Chemical Shift Assignments for the third transmembrane domain from the human copper transport 1",\N
18411,"18411","2012-05-22",\N,"Solution structure of a putative protein disulfide isomerase from Bacteroides thetaiotaomicron",\N
18412,"18412","2012-08-06",\N,"High Definition Solution Structure of PED/PEA-15 Death Effector Domain",\N
18413,"18413","2012-05-22","2014-05-14","Apo-AdcR",\N
18414,"18414","2013-01-03","2014-05-14","Zn(II)-AdcR",\N
18415,"18415","2012-05-22",\N,"Solution structure of human C-type lectin domain family 4 member D",\N
18416,"18416","2012-09-14","2014-02-25","1H,15N and 13C backbone and side chain chemical shifts of the ubiquitin homology domain of mouse BAG-1",\N
18417,"18417","2012-12-13","2014-02-25","1H, 13C and 15N resonance assignments of human BASP1",\N
18418,"18418","2013-04-01",\N,"Pleurocidin-NH2",\N
18419,"18419","2013-01-03",\N,"B2 domain of Neisseria meningitidis Pilus assembly protein PilQ",\N
18420,"18420","2013-04-01",\N,"magainin",\N
18421,"18421","2012-04-26","2014-02-25","Capsid protein from Equine Infectious Anemia Virus",\N
18422,"18422","2012-05-02","2014-05-13","Backbone dynamics of the truncated (2/2) hemoglobin from Synechococcus sp. PCC 7002 (ferrous form with heme PTM, carbonmonoxy complex)",\N
18423,"18423","2012-05-02","2014-05-13","Backbone dynamics of the truncated (2/2) hemoglobin from Synechococcus sp. PCC 7002 (ferric form with heme PTM, cyanide complex)",\N
18424,"18424","2012-05-02","2014-05-13","Backbone dynamics of the truncated (2/2) hemoglobin from Synechococcus sp. PCC 7002 (ferric form without heme PTM, cyanide complex)",\N
18425,"18425","2012-09-14","2014-02-25","Resonance Assignments of Ca2+-bound human S100A11",\N
18426,"18426","2012-06-18","2013-02-12","Solution-state NMR structure of the human prion protein",\N
18427,"18427","2012-07-16","2013-02-15","Solution structure of 2'F-ANA and ANA self-complementary duplex",\N
18428,"18428","2013-01-03",\N,"N0N1 domains of Neisseria meningitidis Pilus assembly protein PilQ",\N
18429,"18429","2012-08-30",\N,"Solution NMR Structure of De Novo Designed Four Helix Bundle Protein, Northeast Structural Genomics Consortium (NESG) Target OR188",\N
18430,"18430","2012-09-10","2013-03-11","Structure and Stability of Duplex DNA Containing (5 S) 5 ,8-Cyclo-2 -Deoxyadenosine: An Oxidative Lesion Repair by NER.",\N
18431,"18431","2012-06-18","2013-02-12","Solution structure of the mouse Rev1 C-terminal domain",\N
18432,"18432","2013-04-02","2013-05-21","Solution structure of polymerase-interacting domain of human Rev1 in complex with translesional synthesis polymerase kappa",\N
18433,"18433","2012-06-18","2013-02-08","Solution structure of the mouse Rev1 CTD in complex with the Rev1-interacting Region (RIR)of Pol Kappa",\N
18434,"18434","2012-06-18","2013-02-08","C-terminal domain of human REV1 in complex with DNA-polymerase H (eta)",\N
18435,"18435","2012-06-18","2013-02-15","Solution structure of the C-terminal domain of Tetrahymena telomerase protein p65",\N
18437,"18437","2012-07-23","2013-02-15","Solution structure of gpFI C-terminal domain",\N
18438,"18438","2012-06-06",\N,"Solution NMR Structure of the Globular Domain of Human Histone H1x, Northeast Structural Genomics Consortium (NESG) Target HR7057A",\N
18439,"18439","2012-06-05","2013-02-08","solution structures of BRD4 second bromodomain with NF-kB-K310ac peptide",\N
18440,"18440","2013-05-03",\N,"Analog of the fragment 197-221 of 1- adrenoreceptor",\N
18441,"18441","2012-08-13","2013-02-08","Solution structure of harmonin N terminal domain in complex with a exon68 encoded peptide of cadherin23",\N
18442,"18442","2012-06-05","2013-05-23","Solution structure of the R. rickettsii cold shock-like protein",\N
18443,"18443","2012-06-05",\N,"Solution structure of a thioredoxin from Thermus thermophilus",\N
18445,"18445","2013-05-20","2014-02-25","NMR high resolution structures of free Tah1 and Tah1 bound to the Hsp90 C-terminal tail explain how Hsp90 recognizes the R2TP complex",\N
18446,"18446","2012-09-14","2014-02-25","Sequence specific 1H, 13C and 15N resonance assignments of an intrinsically unstructured -Crystallin from Hahella chejuensis",\N
18447,"18447","2013-05-20","2014-02-25","NMR high resolution structures of free Tah1 and Tah1 bound to the Hsp90 C-terminal tail explain how Hsp90 recognizes the R2TP complex",\N
18448,"18448","2013-02-14",\N,"Chemical Shift Assignment of the NIPP1 FHA Domain",\N
18449,"18449","2012-09-17","2013-02-08","Structure, sulfatide-binding properties, and inhibition of platelet aggregation by a Disabled-2-derived peptide",\N
18452,"18452","2012-10-15","2013-02-08","Solution structure of a mini i-motif",\N
18453,"18453","2012-06-11",\N,"NMR structure of duplex DNA containing the -OH-PdG dA base pair: A mutagenic intermediate of acrolein",\N
18454,"18454","2012-06-11",\N,"NMR structure of duplex DNA containing the -OH-PdG dA base pair: A mutagenic intermediate of acrolein",\N
18455,"18455","2012-06-18","2013-02-08","Structure of the C-terminal domain from human REV1",\N
18458,"18458","2012-06-12",\N,"1H, 13C, 15N Chemical shift assignment of HIRAN domain of human HLTF",\N
18459,"18459","2013-01-03",\N,"N0 domain of Neisseria meningitidis Pilus assembly protein PilQ",\N
18461,"18461","2012-06-26",\N,"Chemical shift assignments and backbone dynamics of H-Ras-GppNHp bound to Ras-binding domain of cRaf1.",\N
18462,"18462","2012-09-04","2013-02-18","Solution NMR structure of Kaiso zinc finger DNA binding domain in complex with Kaiso binding site DNA",\N
18463,"18463","2012-10-29","2013-02-08","Eurocin solution structure",\N
18464,"18464","2012-07-30","2013-02-07","The solution structure of Ca2+ binding domain 2B of the third isoform of the Na+/Ca2+ exchanger",\N
18465,"18465","2012-06-11","2012-12-12","SOLUTION NMR STRUCTURE OF DE NOVO DESIGNED PROTEIN, ROSSMANN 3x1 FOLD, NORTHEAST STRUCTURAL GENOMICS CONSORTIUM TARGET OR157","/ftp/pub/bmrb/timedomain/bmr18465"
18466,"18466","2013-08-15","2014-05-13","Wild-type FAS1-4",\N
18467,"18467","2013-08-15","2014-05-13","FAS1-4, R555W",\N
18468,"18468","2012-07-11",\N,"Solution NMR structure of the specialized acyl carrier protein PA3334 (apo) from Pseudomonas aeruginosa. Northeast Structural Genomics Consortium Target PaT415.","/ftp/pub/bmrb/timedomain/bmr18468"
18469,"18469","2012-06-04",\N,"Solution NMR Structure of apo YdbC from Lactococcus lactis, Northeast Structural Genomics Consortium (NESG) Target KR150","/ftp/pub/bmrb/timedomain/bmr18469"
18471,"18471","2012-08-29","2014-02-25","Backbone 1H, 13C, and 15N Chemical Shift Assignments for PWWP domain from Trypanosoma brucei",\N
18473,"18473","2012-06-18","2014-05-13","1H, 13C, and 15N resonance assignment of mouse lipocalin-type prostaglandin D synthase/substrate analog complex.",\N
18474,"18474","2012-08-29","2014-02-25","the pwwp domain of TFIIS2-1 from Trypanosoma brucei",\N
18475,"18475","2013-05-20","2014-02-25","The solution structure of Phage P2 gpX",\N
18477,"18477","2012-11-26","2013-03-25","NMR dynamics in the C-terminal globular domain of oligosaccharyltransferase",\N
18478,"18478","2013-02-27","2013-04-15","P75/LEDGF PWWP Domain",\N
18479,"18479","2013-02-28",\N,"HRas166*GDP backbone chemical shift assignments",\N
18480,"18480","2013-11-26","2014-02-25","NMR structure of major ampullate spidroin 1 N-terminal domain at pH 5.5",\N
18481,"18481","2012-09-04","2013-02-08","STRUCTURE OF LASSO PEPTIDE ASTEXIN1",\N
18484,"18484","2012-11-27","2013-02-07","Conformational analysis of StrH, the surface-attached exo- -D-N-acetylglucosaminidase from Streptococcus pneumoniae.",\N
18485,"18485","2013-04-02","2013-04-18","Solution structure of a monomeric truncated mutant of Trypanosoma brucei 1-C-Grx1",\N
18486,"18486","2012-07-02",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for reduced form of sulfiredoxin extract from Saccharomyces cerevisiae",\N
18487,"18487","2012-07-02",\N,"Solution NMR Structure of NifU-like protein from Saccharomyces cerevisiae, Northeast Structural Genomics Consortium (NESG) Target YR313A","/ftp/pub/bmrb/timedomain/bmr18487"
18488,"18488","2012-07-02",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments of an oxidizied and mutant form of sulfiredoxin from Saccharomyces cervisiae",\N
18489,"18489","2012-07-23",\N,"Solution NMR Structure of NFU1 Iron-Sulfur Cluster Scaffold Homolog from Homo sapiens, Northeast Structural Genomics Consortium (NESG) Target HR2876B","/ftp/pub/bmrb/timedomain/bmr18489"
18490,"18490","2012-11-02","2013-02-07","TDRD3 complex",\N
18493,"18493","2013-02-27","2014-02-25","High resolution structure of DsbB C41S by joint calculation with solid-state NMR and X-ray data",\N
18494,"18494","2013-01-03","2014-02-25","Assignment of the -Helical Membrane Protein TM0026 from Thermotoga maritima.",\N
18496,"18496","2012-07-02",\N,"Solution NMR Structure of YdbC:dT19G1 complex. Northeast Structural Genomics Consortium (NESG) Target KR150","/ftp/pub/bmrb/timedomain/bmr18496"
18497,"18497","2013-06-10",\N,"Solution Structure of autoinhibitory domain of human AMP-activated protein kinase catalytic subunit",\N
18498,"18498","2012-11-19",\N,"YAP WW2 in complex with a Smad7 derived peptide.",\N
18499,"18499","2012-11-19",\N,"YAP WW1 in complex with a Smad7 derived peptide.",\N
18500,"18500","2012-11-19",\N,"Smurf1 WW2 domain in complex with a Smad7 derived peptide.",\N
18501,"18501","2012-11-19",\N,"NEDD4L WW2 domain in complex with a Smad7 derived peptide.",\N
18502,"18502","2012-11-19",\N,"Smurf2 WW3 domain in complex with a Smad7 derived peptide.",\N
18503,"18503","2013-02-14","2013-02-21","NMR solution structure of the kappa-zeta region of S.cerevisiae group II intron ai5(gamma)",\N
18504,"18504","2012-10-01","2013-02-21","pfsub2 solution NMR structure",\N
18505,"18505","2012-07-10",\N,"Backbone and side chain assignments of MHV N protein NTD (aa60-197)",\N
18506,"18506","2012-08-21","2013-02-21","MIC5 regulates the activity of Toxoplasma subtilisin 1 by mimicking a subtilisin prodomain",\N
18507,"18507","2012-07-10","2014-02-25","Solution NMR structure of the apo-form of the beta2 carbohydrate module of AMP-activated protein kinase",\N
18508,"18508","2012-07-10","2014-02-25","Solution NMR structure of the beta2 carbohydrate module of AMP-activated protein kinase bound to glucosyl-cyclodextrin",\N
18509,"18509","2012-08-29",\N,"Structure and chemical shifts of Cu(I),Zn(II) superoxide dismutase by solid-state NMR",\N
18510,"18510","2012-06-26","2013-02-21","NMR solution structure of Midi peptide designed based on m-conotoxins",\N
18511,"18511","2012-08-21",\N,"Solution NMR Structure of Ig like domain (1277-1357) of Obscurin-like protein 1 from Homo sapiens, Northeast Structural Genomics Consortium (NESG) Target HR8578D","/ftp/pub/bmrb/timedomain/bmr18511"
18513,"18513","2013-12-09",\N,"RECOMBINANT TAMAPIN NMR solution structure.",\N
18514,"18514","2012-10-15",\N,"Solution structure of CXC domain of MSL2",\N
18515,"18515","2012-07-24","2012-09-19","high resolution NMR solution structure of helix H1 of the human HAR1 RNA",\N
18517,"18517","2012-08-29","2014-02-19","Solution structure of EDK-delta-Bd37 from Babesia divergens",\N
18518,"18518","2013-07-15","2014-02-19","LC3B OPTN-LIR Ptot complex structure",\N
18519,"18519","2012-07-13","2013-12-05","Retro Trp-cage peptide",\N
18520,"18520","2012-09-17","2013-02-20","Chemical shift assignments of a S72-S107 peptide of 18.5kDa murine myelin basic protein (MBP) in association with dodecylphosphocholine micelles",\N
18521,"18521","2012-11-05","2013-02-20","The NMR structure of the Vta1-Vps60 complex",\N
18522,"18522","2013-06-17",\N,"Chemical Shift Assignments for the PICK1 PDZ domain fused to the C10 DAT ligand",\N
18523,"18523","2012-08-06",\N,"NMR structure of Hsp12, a protein induced by and required for dietary restriction-induced lifespan extension in yeast.",\N
18524,"18524","2012-07-23","2013-02-20","Solution structure of a parallel-stranded oligoisoguanine DNA pentaplex formed by d(T(iG)4T) in the presence of Cs ions",\N
18526,"18526","2012-08-13",\N,"Solution NMR Structure of PH Domain of Tyrosine-protein kinase Tec from Homo sapiens, Northeast Structural Genomics Consortium (NESG) Target HR3504C",\N
18527,"18527","2012-07-13",\N,"1H chemical shifts for the C-terminal beta-tubulin 394-455 fragment",\N
18528,"18528","2012-07-13",\N,"1H chemical shifts for the C-terminal alfa-tubulin 404-451 fragment",\N
18529,"18529","2012-08-29","2014-02-19","1H, 13C and 15N resonance assignment for the human K-Ras at physiological pH",\N
18530,"18530","2012-11-02","2014-02-19","1H, 13C and 15N resonance assignment of the pair of complement control protein modules of human C7",\N
18531,"18531","2012-07-13","2013-02-20","Three-State Ensemble obtained from eNOEs of the Third Immunoglobulin Binding Domain of Protein G (GB3)",\N
18532,"18532","2013-12-16",\N,"RNA Aptamer for B. anthracis Ribosomal Protein S8",\N
18533,"18533","2012-08-13",\N,"NMR solution structure of apo-MptpA",\N
18534,"18534","2012-08-29","2013-02-20","RDC REFINED SOLUTION STRUCTURE OF DOUBLE-STRANDED RNA BINDING DOMAIN OF S. CEREVISIAE RNASE III (RNT1P) IN COMPLEX WITH THE TERMINAL RNA HAIRPIN OF SNR47 PRECURSOR",\N
18535,"18535","2012-08-29",\N,"SOLUTION STRUCTURE OF DOUBLE-STRANDED RNA BINDING DOMAIN OF S.CEREVISIAE RNASE III (RNT1P)",\N
18536,"18536","2012-08-28",\N,"KB1[GHRW;23-28]",\N
18537,"18537","2012-12-21",\N,"1H and 13C chemical shifts for collagelin",\N
18538,"18538","2012-12-21",\N,"1H and 13C NMR of GPVI mimetic",\N
18539,"18539","2012-07-09","2012-09-24","NMR structure of Carcinoscorpius rotundicauda thioredoxin related protein 16 and its role in regulating transcription factor NF-kB activity",\N
18540,"18540","2013-04-02","2013-04-18","NMR solution structure of midkine-a",\N
18541,"18541","2013-04-02","2013-04-18","NMR solution structure of midkine-b, mdkb",\N
18542,"18542","2012-07-20","2013-02-20","Structure and Binding Interface of the Cytosolic Tails of aXb2 Integrin",\N
18543,"18543","2013-04-02","2013-06-05","Chemical shift assignments of DsbA(C33S) by solid-state NMR",\N
18544,"18544","2013-04-02","2013-06-05","Chemical shift assignments of DsbA(C33S)/DsbB by solid-state NMR",\N
18545,"18545","2013-06-24",\N,"Calcium saturated form of human C85M S100A1 mutant",\N
18546,"18546","2013-05-06","2013-05-23","Solution structure of the tandem zinc finger domain of fission yeast Stc1",\N
18547,"18547","2012-08-27",\N,"Solution NMR Structure of CalU16 from Micromonospora echinospora, Northeast Structural Genomics Consortium (NESG) Target MiR12",\N
18548,"18548","2013-09-12",\N,"1H, 13C, and 15N resonance assignments of the monomeric human Fam96a",\N
18549,"18549","2013-06-24",\N,"Solution Structure of Helix-35 Stem-loop from E. coli 23S rRNA",\N
18550,"18550","2012-09-17","2013-02-20","Solution-state NMR of prion protein mutant V210I at pH 7",\N
18551,"18551","2012-09-17","2013-02-20","Solution NMR structure of C2H2-type Zinc-fingers 4 and 5 from human Insulinoma-associated protein 1 (fragment 424-497), Northeast Structural Genomics Consortium Target HR7614B.",\N
18552,"18552","2012-07-11","2014-02-19","TM4-Cx43CT",\N
18553,"18553","2012-08-21","2013-02-20","ZirS C-terminal Domain",\N
18555,"18555","2013-06-28",\N,"NMR solution structure of PA1075 from Pseudomonas Aeruginosa",\N
18556,"18556","2013-02-01","2013-02-20","The complex between Ca-Calmodulin and skeletal muscle myosin light chain kinase from combination of NMR and aqueous and contrast-matched SAXS data",\N
18557,"18557","2012-09-25","2014-02-19","Solution structure of Ca2+-bound CaBP7 N-terminal doman",\N
18558,"18558","2012-07-31","2012-12-12","Solution NMR Structure de novo designed rossmann 2x2 fold protein, Northeast Structural Genomics Consortium (NESG) Target OR16",\N
18559,"18559","2012-07-31","2014-02-19","Solution NMR structure of the PHD domain of human MLL5. Northeast structural genomics consortium target HR6512A.",\N
18560,"18560","2012-07-31",\N,"NMR solution structure of the N-terminal domain of human USP28. Northeast structural genomics consortium target HT8470A",\N
18561,"18561","2012-07-10","2012-12-12","Solution NMR Structure DE NOVO DESIGNED PFK fold PROTEIN, Northeast Structural Genomics Consortium (NESG) Target OR250","/ftp/pub/bmrb/timedomain/bmr18561"
18562,"18562","2014-02-11",\N,"Backbone and side-chain assignments of an effector membrane localization domain from Vibrio vulnificus MARTX toxin",\N
18563,"18563","2013-01-03",\N,"Solution NMR Structure of Ig like domain (805-892) of Obscurin-like protein 1 from Homo sapiens, Northeast Structural Genomics Consortium (NESG) Target HR8578K","/ftp/pub/bmrb/timedomain/bmr18563"
18565,"18565","2014-02-11","2014-05-13","Backbone and side-chain resonance assignments of the membrane localization domain from Pasteurella multocida toxin",\N
18566,"18566","2012-11-02","2014-02-19","Telokin-like domain (TL-domain) from P22 coat protein",\N
18567,"18567","2013-02-28","2014-05-13","Overexpression, purification and structural characterization of S114A mutant of UVI31+ from chlamydomonas reinhardtii",\N
18568,"18568","2013-06-17","2014-10-14","ns4b40",\N
18569,"18569","2012-07-18",\N,"13C, 15N and 1H backbone and sidechain assignments of the ENA-VASP homology 1 (EVH1) domain of the human vasodilator-stimulated phosphoprotein (VASP)",\N
18570,"18570","2013-01-28",\N,"Solution structure of the zinc finger AFV1p06 protein from the hyperthermophilic archaeal virus AFV1",\N
18571,"18571","2012-10-01","2013-02-20","Solution structure of apo-Phl p 7",\N
18572,"18572","2012-10-01","2013-02-20","solution structure of hemi-Mg-bound Phl p 7",\N
18573,"18573","2012-10-01","2013-02-20","Solution structure of Ca-bound Phl p 7",\N
18574,"18574","2012-08-29",\N,"1H,13C,15N resonance assignment of wild-type Lipase A from Bacillus subtilis",\N
18575,"18575","2012-08-29",\N,"1H, 13C and 15N resonance assignments of Bacillus subtilis Lipase A mutant evolved towards thermostability",\N
18576,"18576","2012-08-21","2013-02-20","Griffithsin assignment",\N
18577,"18577","2012-10-18","2014-02-19","Chemical Shift Assignments of the Connexin45 Carboxyl Terminal Domain: Dimer Conformation",\N
18578,"18578","2012-10-18","2014-02-19","Chemical shift assignments of the connexin45 carboxyl terminal domain: monomer and dimer conformations.",\N
18579,"18579","2012-12-06",\N,"Methylated Histone Complex",\N
18580,"18580","2013-02-08","2014-02-19","1H, 13C, and 15N backbone and side chain resonance assignments of the C-terminal DNA binding and dimerization domain of v-Myc",\N
18581,"18581","2012-11-19","2013-02-20","Solution structure of gp78 CUE domain",\N
18582,"18582","2012-11-19","2013-02-20","1H, 13C, 15N chemical shifts of gp78CUE bound to ubiquitin AND backbone amide shifts of ubiquitin bound to gp78CUE",\N
18583,"18583","2012-11-19","2013-02-20","Solution structure of the gp78CUE/K48-Ub2 complex",\N
18584,"18584","2012-11-19","2013-02-20","Solution structure of gp78CUE/K48-Ub2 complex",\N
18585,"18585","2012-08-21","2013-02-20","Griffithsin assignment",\N
18586,"18586","2012-07-16","2014-02-19","Solution structures of Miz-1 zinc fingers 8 to 10",\N
18587,"18587","2013-02-28",\N,"MHV nsp3a",\N
18588,"18588","2012-10-18",\N,"Backbone 1H, 15N, 13C Assignments of the N-terminal Part of Tyrosine tRNA Synthase from Bacillus stearothermophilus",\N
18589,"18589","2013-01-16","2014-02-19","NMR solution structure of Cbp2",\N
18591,"18591","2013-05-28",\N,"Solution NMR studies of the dimeric regulatory subunit IlvN of the E.coli Acetohydroxyacid synthase I (AHAS I)",\N
18592,"18592","2013-04-29","2013-07-10","MRH domain of the Glucosidase II beta subunit from S. pombe",\N
18593,"18593","2013-04-08",\N,"Solution Structure of a RNA Duplex Containing a 2'-O-Pivaloyloxymethyl Modification",\N
18595,"18595","2012-08-29",\N,"Solid-state NMR 13C and 15N resonance assignments of a seven-transmembrane helical protein Anabaena Sensory Rhodopsin",\N
18596,"18596","2013-07-29",\N,"Solution structure of a Eosinophil Cationic Protein-trisaccharide heparin mimetic complex",\N
18598,"18598","2013-02-28",\N,"Backbone resonance assignments for AgrA LytTR domain",\N
18599,"18599","2012-10-18","2013-02-20","Solution structure of CCP modules 11-12 of complement factor H",\N
18600,"18600","2013-01-09","2013-02-20","S67",\N
18601,"18601","2012-08-27",\N,"GGBP Ecoli unliganded solution structure",\N
18602,"18602","2013-03-11",\N,"Solution structure of the soluble domain of MmpS4 from Mycobacterium tuberculosis",\N
18604,"18604","2012-10-18","2013-02-20","Solution structure of CCP modules 10-11 of complement factor H",\N
18605,"18605","2012-08-27",\N,"Solution NMR Structure of Human Transcription Elongation Factor A protein 2, Central Domain, Northeast Structural Genomics Consortium (NESG) Target HR8682B",\N
18606,"18606","2013-02-14",\N,"Solution structure of anti-CRISPR protein Acr30-35 from Pseudomonas aeruginosa Phage JBD30",\N
18607,"18607","2013-02-14",\N,"Solution structure of an avirulence protein AvrPzi-t from pathogen Magnaportheoryzae",\N
18608,"18608","2012-10-18","2013-02-20","Backbone resonance assignment of ASC pyrin domain",\N
18610,"18610","2013-02-12",\N,"1H, 13C and 15N assignments of Ubiquitin for both folded and denatured states at 258K and 2500 bar",\N
18611,"18611","2013-02-12",\N,"Pressure & methanol-induced A-state of Ubiquitin",\N
18612,"18612","2013-09-03",\N,"NMR solution structure of human HisRS splice variant",\N
18613,"18613","2013-07-22","2014-05-13","NMR solution structure of Eph receptor",\N
18614,"18614","2012-09-24","2013-02-19","NMR solution structure of Myo10 anti-CC",\N
18617,"18617","2012-12-04","2013-01-16","Conformational ensemble for the G8A mutant of the influenza hemagglutinin fusion peptide",\N
18618,"18618","2013-07-29","2014-02-19","Structural model of BAD-1 repeat loop by NMR",\N
18619,"18619","2013-08-05",\N,"Met-enkephaline in DPMC SUV",\N
18620,"18620","2013-02-14","2014-05-13","NMR Chemical Shift Assignments of N terminal RRM domain of La protein",\N
18621,"18621","2013-02-14","2014-05-13","NMR Chemical Shift Assignments of N terminal La motif domain of La protein",\N
18622,"18622","2012-10-19","2013-02-19","Solution structure of second CARD of human RIG-I.",\N
18623,"18623","2012-10-19","2013-02-19","Solution structure of mutant (T170E) second CARD of human RIG-I",\N
18624,"18624","2013-05-20",\N,"Structure of N-terminal domain of a plant Grx",\N
18625,"18625","2013-01-22","2013-02-19","NMR Structure of the Self-Complementary 10 mer DNA Oligonucleotide 5'-GGATATATCC-3'.",\N
18626,"18626","2013-01-22","2013-02-19","NMR Structure of the Self-Complementary 10 mer DNA Duplex 5'-GGATATATCC-3' in Complex with Netropsin",\N
18627,"18627","2013-02-14","2014-05-13","1H, 13C, and 15N Chemical Shift Assignments for Calcium free, Myristoylated Visinin-like protein 3",\N
18628,"18628","2013-02-12",\N,"1H, 13C, and 15N Backbone and Sidechain Resonance Assignments for Cyclophilin A from Geobacillus Kaustophilus",\N
18629,"18629","2013-05-20",\N,"Solution structure of H-RasT35S mutant protein in complex with Kobe2601",\N
18630,"18630","2012-11-28","2013-02-19","Backbone Chemical Shifts for N-terminal domain of sulfhydryl oxidase ALR",\N
18631,"18631","2012-11-28","2013-02-19","N-terminal of Sulfydryl Oxidase of ALR reduced",\N
18632,"18632","2013-02-12","2014-05-13","Resonance assignment of As-p18, a structurally unusual fatty acid binding protein secreted by developing larvae of the parasitic nematode Ascaris suum",\N
18633,"18633","2012-08-27","2014-02-19","solution structure of small molecule-influenza RNA complex, Seattle Structural Genomics Center for Infectious Disease (SSGCID)",\N
18634,"18634","2013-08-26",\N,"Structural basis for the interaction of human -defensins 1 and 6 and its receptors CCR2 corresponding peptide and breast cancer cells",\N
18636,"18636","2012-10-18","2014-02-19","1H, 13C and 15N resonance assignment of the soluble form of the Lipid-modified Azurin from Neisseria gonorrhoeae",\N
18637,"18637","2013-02-12","2015-01-13","1H, 13C and 15N chemical shift assignments of Na-FAR-1, a helix-rich fatty acid and retinol binding protein of the parasitic nematode Necator americanus",\N
18638,"18638","2013-02-18",\N,"Solution Structure of Duplex DNA Containing a b-Carba-Fapy-dG Lesion",\N
18639,"18639","2013-02-18",\N,"Solution Structure of Duplex DNA Containing a b-Carba-Fapy-dG Lesion",\N
18640,"18640","2013-02-18",\N,"Solution Structure of Duplex DNA Containing a b-Carba-Fapy-dG Lesion",\N
18641,"18641","2013-08-15","2014-05-13","NMR solution structure of PawS derived peptide 11 (PDP-11)",\N
18642,"18642","2013-06-10","2013-07-10","Protein structure",\N
18643,"18643","2013-08-15","2014-05-13","NMR solution structure of PawS Derived Peptide 4 (PDP-4)",\N
18644,"18644","2013-08-15","2014-05-13","NMR solution structure of PawS Derived Peptide 5 (PDP-5)",\N
18645,"18645","2013-08-15","2014-05-13","NMR solution structure of PawS Derived Peptide 7 (PDP-7)",\N
18647,"18647","2012-10-18","2014-02-19","1H, 13C, and 15N backbone resonance assignments of the L124D mutant of StAR-related lipid transfer domain protein 4 (StARD4)",\N
18648,"18648","2012-09-07","2014-02-19","APPTM V44M",\N
18649,"18649","2012-09-07","2014-02-19","Transmembrane domain of Amyloid precursor protein WT",\N
18650,"18650","2013-09-10","2014-02-19","NMR structure of RelA-TAD/CBP-TAZ1 complex",\N
18651,"18651","2013-02-14","2013-07-23","13C and 15N chemical shifts for Shigella Flexneri MxiH Type three secretion system needle subunit",\N
18653,"18653","2013-05-06","2013-07-10","Solution Structure of Bacterial Intein-Like domain from Clostridium thermocellum",\N
18654,"18654","2012-09-07",\N,"NMR Structures of Single-chain Insulin",\N
18655,"18655","2012-09-04",\N,"Arced helix (ArcH) NMR structure of the reovirus p14 fusion-associated small transmembrane (FAST) protein transmembrane domain (TMD) in dodecyl phosphocholine (DPC) micelles",\N
18656,"18656","2012-11-20","2013-02-19","Major Conformation of the Internal Loop 5'GAGU/3'UGAG",\N
18657,"18657","2013-02-12","2013-02-19","1H,13C,15N assignments for an isoform of the type III antifreeze protein from notched-fin eelpout",\N
18658,"18658","2013-01-18","2013-03-25","NMR solution structure of peptide a2N(1-17) from Mus musculus V-ATPase",\N
18659,"18659","2013-08-12",\N,"NMR solution structure of peptide epsilon(103-120) from Mycobacterium tuberculosis F-ATPsynthase",\N
18661,"18661","2013-01-03","2013-02-19","STRUCTURE OF LASSO PEPTIDE CAULOSEGNIN I",\N
18662,"18662","2012-10-09",\N,"Solution NMR structure of SH3 domain of growth arrest-specific protein 7 (GAS7)(fragment 1-60)from Homo sapiens, Northeast Structural Genomics Consortium (NESG) Target HR8574A","/ftp/pub/bmrb/timedomain/bmr18662"
18663,"18663","2013-02-28","2013-03-11","The third member of the eIF4E family represses gene expression via a novel mode of recognition of the methyl-7 guanosine cap moiety",\N
18664,"18664","2013-02-14","2013-02-28","Chemical shift assignments of human NSD3 PHD5-C5HCH domain",\N
18665,"18665","2013-02-12","2014-05-13","Human dUTPase",\N
18666,"18666","2013-02-12","2014-05-13","Human dUTPase",\N
18668,"18668","2012-11-12","2013-02-19","Solution Structure of Escherichia coli Ferrous Iron transport protein A (FeoA)",\N
18669,"18669","2012-11-20","2013-02-19","Solution structure of the Get5 ubiquitin-like domain",\N
18670,"18670","2012-11-20","2013-02-19","Solution structure of the Sgt2 homodimerization domain",\N
18671,"18671","2012-11-20","2013-02-19","Solution structure of the complex between the Sgt2 homodimerization domain and the Get5 UBL domain",\N
18672,"18672","2013-11-18",\N,"S4WYILD",\N
18673,"18673","2012-09-25",\N,"Solution NMR structure of a potential acylphosphatase from Giardia lamblia, Seattle Structural Genomics Center for Infectious Disease target GilaA.01396.a",\N
18676,"18676","2012-09-17","2014-02-19","Regulation of a potassium channel by the pro-domain of a matrix metalloprotease",\N
18677,"18677","2013-08-26","2014-02-19","1H, 13C and 15N Assignments of the RING domain in ubiquitin ligase gp78",\N
18678,"18678","2012-09-17",\N,"NMR structure of the N-terminal RNA Binding domain 1 (RRM1) of the protein RBM10 from Homo sapiens",\N
18679,"18679","2013-08-05",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for cold shock protein, LmCsp with dT7",\N
18680,"18680","2013-08-05",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for cold shock protein, LmCsp",\N
18681,"18681","2012-11-27","2013-02-19","LIP5(MIT)2",\N
18682,"18682","2012-11-27","2013-02-19","LIP5-CHMP5",\N
18683,"18683","2012-10-18",\N,"1H and 15N backbone resonance assignments of Escherichia coli Adenylate kinase: wild type",\N
18684,"18684","2013-08-12",\N,"Identification of the Structural Traits Mediating the Antimicrobial Activity of a Chimeric Peptide of HBD2 and HBD3",\N
18686,"18686","2012-10-18",\N,"1H and 15N backbone resonance assignments of Escherichia coli Adenylate kinase: E170A",\N
18687,"18687","2012-10-18",\N,"1H and 15N backbone resonance assignments of Escherichia coli Adenylate kinase: wild type with 0.35 M TMAO.",\N
18688,"18688","2013-08-26","2014-02-19","Backbone amide chemical shifts of gp78 RING bound to Ube2g2:G2BR",\N
18689,"18689","2012-10-18","2014-02-19","Backbone 1H, 13C, and 15N backbone resonance assignments of the TPR2A domain of mouse STI1",\N
18690,"18690","2012-11-02","2013-02-19","MOMERIC PIL-E G-QUADRUPLEX DNA FROM NEISSERIA GONORRHOEAE",\N
18691,"18691","2012-10-18","2014-02-19","Backbone 1H, 13C, and 15N backbone resonance assignments of the TPR1 domain of mouse STI1",\N
18692,"18692","2012-10-01","2013-08-07","Solution structure of HP1264 from Helicobacter pylori",\N
18693,"18693","2013-02-12","2014-05-13","1H, 13C, and 15N resonance assignments of mouse peptide ESP4",\N
18694,"18694","2013-06-04","2014-02-19","Allosteric communication in the KIX domain proceeds through dynamic re-packing of the hydrophobic core",\N
18695,"18695","2013-06-04","2014-02-19","Allosteric communication in the KIX domain proceeds through dynamic re-packing of the hydrophobic core",\N
18696,"18696","2012-10-18","2014-02-19","1H, 13C and 15N resonance assignment of the N-terminal domain of human lysyl aminoacyl tRNA synthetase",\N
18697,"18697","2012-10-18","2014-02-19","1H, 13C and 15N resonance assignment of the N-terminal domain of human lysyl aminoacyl tRNA synthetase complexed with anticodon stem-loop of tRNALys,3",\N
18698,"18698","2012-10-29",\N,"Solution NMR Structure of the eukaryotic RNA recognition motif, RRM1, from the heterogeneous nuclear ribonucleoprotein H from Homo sapiens, Northeast Structural Genomics Consortium (NESG) Target HR8614A","/ftp/pub/bmrb/timedomain/bmr18698"
18699,"18699","2012-11-02","2013-02-19","DIMERIC PIL-E G-QUADRUPLEX DNA FROM NEISSERIA GONORRHOEAE, N STRUCTURES",\N
18700,"18700","2013-02-12",\N,"The solution structure of XIAP(RING)-binding domain of human XAF1",\N
18701,"18701","2013-10-08",\N,"Solution struture of cofilin like UNC-60B protein from Caenorhabditis elegans",\N
18702,"18702","2012-11-05","2013-02-28","RNA BINDING PROTEIN Solution structure of the third KH domain of KSRP in complex with the G-rich target sequence.",\N
18703,"18703","2013-02-12",\N,"Backbone, sidechain and ligand chemical shift assignments for 2-mercaptophenol-alpha3C",\N
18704,"18704","2012-09-07",\N,"human Siglec5 Carbohydrate Recognition Domain Chemical Shifts",\N
18705,"18705","2012-11-27","2013-04-12","Solution Structure of the Antimicrobial Peptide Human Defensin 5",\N
18706,"18706","2013-01-07","2013-02-19","Solution NMR structure of the influenza A virus S31N mutant (19-49) in presence of drug M2WJ332",\N
18707,"18707","2014-03-10",\N,"Solution structure of TamA POTRA domain I",\N
18708,"18708","2013-02-12",\N,"Structure of Co-substituted microcrystalline SOD using PCS and PRE restraints by solid-state NMR",\N
18709,"18709","2012-10-29","2013-02-19","HMGB1-facilitated p53 DNA binding occurs via HMG-box/p53 transactivation domain interaction and is regulated by the acidic tail",\N
18710,"18710","2012-10-15","2013-05-29","Refined solution structure of recombinant brazzein at low temperature",\N
18711,"18711","2013-06-10",\N,"TBA",\N
18712,"18712","2014-03-10",\N,"b-flap domain of RNA polymerase (B. subtilis)",\N
18713,"18713","2012-12-10",\N,"The budding yeast chaperone Scm3 recognizes the partially unfolded dimer of the centromere-specific Cse4/H4 histone variant",\N
18714,"18714","2012-11-12",\N,"Solution NMR Structure of Homeobox 2 Domain from Human ZHX1 repressor, Northeast Structural Genomics Consortium (NESG) Target HR7907F",\N
18715,"18715","2013-02-11",\N,"Structure of HIV-1 myr(-) matrix protein in complex with 1,2-dioctanoyl-sn-phosphatidylcholine",\N
18716,"18716","2013-02-11",\N,"Structure of HIV-1 myr(-) matrix protein in complex with 1,2-dioctanoyl-sn-phosphatidyl-L-serine",\N
18717,"18717","2012-10-22","2014-12-02","Structure of C-terminal domain of Ska1",\N
18718,"18718","2013-07-25","2014-02-18","Alpha4 Integrin Cytoplasmic Tail 1H and 15N Chemical Shift",\N
18719,"18719","2013-07-25","2014-02-18","Beta2 Integrin Cytoplasmic Tail 1H and 15N Chemical Shift",\N
18720,"18720","2012-10-15","2014-02-19","The solution structure of the Dm DCP1 EVH1 domain in complex with the XRN1 DBM peptide",\N
18721,"18721","2012-10-10","2014-02-18","(1)H, (13)C, and (15)N backbone chemical shift assignments of StAR-related lipid transfer domain protein 5 (STARD5) in complex with cholic acid",\N
18722,"18722","2012-11-27","2013-02-19","High resolution NMR solution structure of a symmetrical theta-defensin, BTD-2.",\N
18723,"18723","2012-11-27","2013-02-19","High resolution NMR solution structure of the theta-defensin RTD-1",\N
18724,"18724","2012-10-18",\N,"FUC_TBA",\N
18725,"18725","2013-04-29","2013-07-30","Structure of Faap24 residues 141-215",\N
18726,"18726","2013-01-15",\N,"Repetitive domain (RP) of aciniform spidroin 1 from Nephila antipodiana",\N
18728,"18728","2013-01-03","2013-02-19","SOLUTION STRUCTURE",\N
18729,"18729","2013-01-09","2013-02-19","S64",\N
18730,"18730","2013-02-12",\N,"Chemical shift assignment of West Nile Virus NS2B-NS3 protease in a complex with 4-phenyl-phenyl-KKR-aldehyde.",\N
18731,"18731","2013-02-12",\N,"Solid-state NMR sequential assignments of the C-terminal oligomerization domain of human C4b-binding protein",\N
18732,"18732","2012-10-22",\N,"NMR structure of the protein NP_390345.1 from Bacilus subtilis",\N
18733,"18733","2012-10-22",\N,"NMR structure of the protein NB7890A from Shewanella sp",\N
18734,"18734","2012-10-25",\N,"NMR structure of the hypothetical protein ZP_02034617.1 from Bacteroides capillosus ATCC 29799",\N
18735,"18735","2012-11-21",\N,"Solution NMR Structure of the DNA-Binding Domain of Human NF-E2-Related Factor 2, Northeast Structural Genomics Consortium (NESG) Target HR3520O",\N
18736,"18736","2012-12-04","2013-02-19","Solution structure of a Novel Alpha-Conotoxin TxIB",\N
18737,"18737","2013-09-30",\N,"DISTINCT UBIQUITIN BINDING MODES EXHIBITED BY SH3 DOMAINS: M DETERMINANTS AND FUNCTIONAL IMPLICATIONS",\N
18738,"18738","2013-02-12",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for the HEAT1 domain of the human translation initiation factor 4G, isoform I (eIF4GI-HEAT1)",\N
18740,"18740","2013-02-11",\N,"LMPG micelle-bound KSR1 CC-SAM",\N
18741,"18741","2013-02-12",\N,"The backbone 1H, 13C, 15N resonance assignment of FGFR1 kinase domain in its free form",\N
18748,"18748","2012-11-02",\N,"Backbone chemical shift assignments of the C-terminal SH3 domain of Grb2",\N
18749,"18749","2012-11-02","2013-02-19","Ligase 10C",\N
18750,"18750","2013-02-12",\N,"Chemical shift of E coli. IscU Prolyl residues in S-states",\N
18753,"18753","2013-09-10",\N,"Structure of the biofilm matrix promoter AbbA from B. subtilis",\N
18754,"18754","2013-02-12",\N,"Chemical shift of E coli. IscU Prolyl residues in D-states",\N
18755,"18755","2012-11-02","2014-07-02","NMR Structure of Mdm2 (6-125) with Pip-1",\N
18756,"18756","2013-02-12","2013-02-28","Backbone 15N, 1H, and CA Chemical Shift Assignments for WT IkappaBalpha (67-287)",\N
18757,"18757","2012-11-27","2013-02-19","High resolution NMR structure of the theta-defensin HTD-2 (retrocyclin 2)",\N
18758,"18758","2013-09-16","2014-05-13","Refined solution structure and dynamics of First Catalytic Cysteine Half-domain from mouse E1 enzyme",\N
18759,"18759","2013-02-07","2013-02-28","Backbone 15N, 1H, and CA Chemical Shift Assignments for C186P/A220P IkappaBalpha (67-287)",\N
18760,"18760","2013-02-07","2013-02-28","Backbone 15N, 1H, and CA Chemical Shift Assignments for Y254L/T257A IkappaBalpha (67-287)",\N
18761,"18761","2013-02-07",\N,"1H, 13C, and 15N chemical shift assignments for the phosphotyrosine binding domain 2 (PTB2) of human FE65",\N
18762,"18762","2012-11-20","2013-02-19","NMR solution structure of an N2-guanine DNA adduct derived from the potent tumorigen dibenzo[a,l]pyrene: Intercalation from the minor groove with ruptured Watson-Crick base pairing",\N
18763,"18763","2013-10-04","2014-02-18","FGFR3tm",\N
18764,"18764","2012-10-29","2013-02-19","Phf19 links methylated lysine 36 of histone H3 to regulation of Polycomb activity",\N
18765,"18765","2013-01-16","2014-02-18","Backbone and side-chain assignments of 1H, 15N and 13C chemical shifts of RNA recognition motif 1 (RRM1) of TAR DNA-binding protein (TDP-43)",\N
18766,"18766","2013-07-01","2014-02-18","Spatial stucture of PI-AnmTX Ugr 9a-1",\N
18770,"18770","2013-03-18","2013-03-21","TatA T22P",\N
18771,"18771","2013-03-18","2013-03-21","TatA oligomer",\N
18772,"18772","2013-01-29","2013-02-19","Backbone 1H, 13C, and 15N Chemical Shift Assignments for Staphylococcal Complement Inhibitor SCIN-A",\N
18773,"18773","2013-01-29","2013-02-19","Backbone 1H, 13C, and 15N Chemical Shift Assignments for Staphylococcal Complement Inhibitor SCIN-B",\N
18774,"18774","2013-01-29",\N,"Backbone 1H-13C-15N NMR assignments of yeast OMP synthase",\N
18775,"18775","2013-01-29",\N,"Backbone 1H-13C-15N NMR assignments of yeast OMP synthase in complex with orotidine 5 -monophosphate",\N
18776,"18776","2013-01-22","2014-02-18","1H, 13C, 15N backbone NMR resonance assignments for N-terminal RNA recognition motif of HvRBP1 from Hordeum vulgare L. (barley)",\N
18777,"18777","2012-11-08",\N,"1H, 13C, and 15N backbone chemical shift assignments of StAR-related lipid transfer domain protein 6 (STARD6)",\N
18779,"18779","2013-01-29",\N,"Backbone resonance assignments of FrpD from Neisseria meningitidis",\N
18780,"18780","2013-10-14",\N,"DNA duplex containing mispair-aligned O4U-heptylene-O4U interstrand cross-link",\N
18781,"18781","2013-10-14",\N,"DNA duplex containing mispair-aligned O6G-heptylene-O6G interstrand cross-link",\N
18783,"18783","2013-10-21","2014-05-12","SOLUTION NMR STRUCTURE OF ASTEROPSIN B FROM A MARINE SPONGE ASTEROPUS SP.",\N
18784,"18784","2013-10-21","2014-02-18","SOLUTION NMR STRUCTURE OF ASTEROPSIN C FROM A MARINE SPONGE ASTEROPUS SP.",\N
18785,"18785","2013-01-29",\N,"Erbin PDZ Domain (Wild Type)",\N
18786,"18786","2013-01-29",\N,"Erbin PDZ Domain (S47 Designed Mutant)",\N
18787,"18787","2013-01-28","2013-07-10","Solution structure of a mutant of the triheme cytochrome PpcA from Geobacter sulfurreducens sheds light on the role of the conserved aromatic residue F15",\N
18788,"18788","2013-02-21","2013-07-10","Solution structure of staphylococcal nuclease E43S mutant in the presence of ssDNA and Cd2+",\N
18789,"18789","2013-11-11",\N,"Solution structure of Kunitz-type neurotoxin LmKKT-1a from scorpion venom",\N
18791,"18791","2013-01-29",\N,"Sequence-specific backbone 1H, 13C and 15N assignments of the catalytic domain of the Escherichia coli protein tyrosine kinase, Wzc",\N
18792,"18792","2013-01-22","2014-07-01","Solution structure of BCL-xL determined with selective isotope labelling of I,L,V sidechains",\N
18793,"18793","2013-01-22","2014-07-01","Solution structure of BCL-xL in complex with PUMA BH3 peptide",\N
18794,"18794","2013-10-21","2014-07-01","Structure of module 2 from the E1 domain of C. elegans APL-1",\N
18795,"18795","2013-04-02",\N,"NMR assignments of Amylin in DMSO",\N
18796,"18796","2012-12-10","2013-02-19","NMR structure of OmpX in phopspholipid nanodiscs",\N
18797,"18797","2012-12-10","2013-02-19","NMR structure of OmpX in DPC micelles",\N
18802,"18802","2013-01-28",\N,"Structure, phosphorylation and U2AF65 binding of the Nterminal domain of splicing factor 1 during 3 splice site recognition",\N
18803,"18803","2013-01-29","2013-02-28","SR-linker peptide",\N
18804,"18804","2013-10-22",\N,"Homodimeric transmembrane domain of the human receptor tyrosine kinase ErbB1 (EGFR, HER1) in micelles",\N
18805,"18805","2012-11-21",\N,"Solution NMR Structure of Homeobox Domain of Human ALX4, Northeast Structural Genomics Consortium (NESG) Target HR4490C",\N
18806,"18806","2012-12-07","2014-05-12","Solution Structure of Miz-1 zinc fingers 5 to 7",\N
18808,"18808","2013-01-28",\N,"Structure, phosphorylation and U2AF65 binding of the Nterminal domain of splicing factor 1 during 3 splice site recognition",\N
18811,"18811","2013-02-21",\N,"Structural Characterization of Minor Ampullate Spidroin Domains and their Distinct Roles in Fibroin Solubility and Fiber Formation",\N
18812,"18812","2012-11-30",\N,"Solution structure of a DUF3349 annotated protein from Mycobacterium abscessus, MAB_3403c. Seattle Structural Genomics Center for Infectious Disease target Myab.17112.a",\N
18813,"18813","2013-01-15","2013-02-18","The solution structure of human PHF1 in complex with H3K36me3",\N
18814,"18814","2014-02-14",\N,"13C and 15N NMR chemical shifts of E. coli full-length H-NS protein",\N
18815,"18815","2012-11-07",\N,"N-histidine-tagged EIAV-CA",\N
18816,"18816","2013-01-07","2013-03-25","Solution structure of the tenth complement type repeat of human megalin",\N
18818,"18818","2013-01-22","2013-02-18","Solution structure and dynamics of human S100A14",\N
18819,"18819","2012-12-04","2014-02-18","1H, 13C and 15N assignments of the Apo-acyl carrier protein-3 of Pseudomonas aeruginosa.",\N
18820,"18820","2012-12-04","2014-02-18","1H, 13C and 15N assignments of the Apo-acyl carrier protein-1 of Pseudomonas aeruginosa.",\N
18821,"18821","2012-12-04","2014-02-18","1H, 13C and 15N assignments of Apo-acyl carrier protein of Pseudomonas aeruginosa.",\N
18822,"18822","2013-02-21","2013-04-12","Solution Structure of the trans-membrane domain of the NS2A of dengue virus",\N
18823,"18823","2013-01-29",\N,"1H, 13C and 15N resonance assignments of the C-terminal domain of PpdD",\N
18824,"18824","2013-04-22","2013-07-09","Structural characterization of the extended PDZ1 domain from NHERF1.",\N
18825,"18825","2013-04-22","2013-07-09","Complex structure of C-terminal CFTR peptide and extended PDZ1 domain from NHERF1.",\N
18826,"18826","2013-04-22","2013-07-09","Complex structure of C-terminal CFTR peptide and extended PDZ2 domain from NHERF1.",\N
18828,"18828","2014-02-14",\N,"NMR Assignment of Arabidopsis thaliana cytochrome c in its reduced state",\N
18829,"18829","2013-08-14","2014-02-17","NMR restraints for the C-terminal RRM domain (RRM3) of TIA-1 protein.",\N
18830,"18830","2013-11-26",\N,"Solution structure of ALPS-23 peptide in SDS micelles",\N
18831,"18831","2013-06-24","2013-08-07","Solution structure of U14Ub1, an engineered ubiquitin variant with increased affinity for USP14",\N
18832,"18832","2012-12-18","2013-04-12","Solution structure of the SH3 domain of DOCK180",\N
18833,"18833","2013-07-01","2014-05-12","cis form of a photoswitchable PDZ domain crosslinked with an azobenzene derivative",\N
18834,"18834","2013-07-01","2014-05-12","trans form of a photoswitchable PDZ domain crosslinked with an azobenzene derivative",\N
18835,"18835","2013-06-10","2014-02-17","Structure of perimidinone-derived synthetic nucleoside paired with guanine in DNA duplex",\N
18837,"18837","2013-02-28",\N,"15N, 13C and 1H Resonance Assignments and Secondary Structure Determination of a Variable Heavy Chain Antibody",\N
18838,"18838","2013-10-21","2014-02-17","Solution structure of the ID3 stem loop of domain 1 in the ai5gamma group II intron",\N
18839,"18839","2012-11-19","2014-02-17","Chemical shift assignments of the monomeric canecystatin-1 from Saccharum officinarum",\N
18840,"18840","2013-04-01","2013-05-21","The ZZ domain of cytoplasmic polyadenylation element binding protein 1 (CPEB1)",\N
18841,"18841","2014-01-13","2014-05-12","E. coli O157 ParE2-associated antitoxin 2 (PaaA2)",\N
18842,"18842","2013-01-22","2013-02-28","NMR structure of the complex between the PH domain of the Tfb1 subunit from TFIIH and Rad4",\N
18843,"18843","2013-01-29",\N,"1H, 13C and 15N assignments of the four N-terminal domains of human fibrillin-1",\N
18844,"18844","2013-05-30",\N,"ubiquitin-like domain-containing C-terminal domain phosphatase (UBLCP1)",\N
18845,"18845","2013-01-29","2013-12-06","SUP-12",\N
18846,"18846","2013-01-29",\N,"SUP-12 + GGUGUGC",\N
18847,"18847","2013-03-01","2013-04-25","Structure of stacked G-quadruplex formed by human TERRA sequence in potassium solution",\N
18848,"18848","2013-05-30",\N,"LTBP1 EGF3-cbEGF15",\N
18849,"18849","2012-11-26","2014-02-18","Chemical shift assignments and secondary structure prediction of the C-terminal domain of the response regulator BfmR from Acinetobacter baumannii",\N
18850,"18850","2013-08-05","2014-02-17","Solution structure of the Haloferax volcanii HVO_2177 protein",\N
18851,"18851","2013-09-04",\N,"HIV-1 Rev ARM peptide (residues T34-R50)",\N
18852,"18852","2013-09-04",\N,"HIV-1 Rev ARM peptide (residues T34-R50)",\N
18853,"18853","2014-02-14",\N,"Backbone and side-chain 1H, 13C, 15N NMR assignment of the N-terminal domain of Escherichia coli LpoA",\N
18854,"18854","2014-02-14",\N,"1H,15N and 13C backbone chemical shifts of Human Halo S100A6 C3S",\N
18855,"18855","2014-02-14",\N,"Backbone assignments of 8M urea denatured YibK from Haemophilus influenzae (HI0766)",\N
18856,"18856","2013-03-25","2014-02-17","HADDOCK structure of GtYybT PAS Homodimer",\N
18857,"18857","2013-12-09","2014-11-19","Backbone 1H, 13C,and 15N chemical shift assignments for alpha-synuclein at different pH and temperature",\N
18858,"18858","2013-02-21","2013-04-12","Biosynthetic engineered B28K-B29P human insulin monomer structure in in water/acetonitrile solutions.",\N
18859,"18859","2013-02-21","2013-04-12","Biosynthetic engineered B28K-B29P human insulin monomer structure in in water solutions.",\N
18860,"18860","2013-06-04",\N,"solid-state NMR assignment of a-synuclein fibrils",\N
18861,"18861","2012-12-04","2014-02-17","NMR Structure of Antiamoebin I (peptaibol antibiotic) bound to DMPC/DHPC bicelles",\N
18862,"18862","2013-05-06",\N,"Parallel human telomeric quadruplex containing 2'F-ANA substitutions",\N
18863,"18863","2013-08-26","2014-02-17","The Solution Structure of Monomeric Hepatitis C Virus p7 Yields Potent Inhibitors of Virion Release",\N
18864,"18864","2013-12-02",\N,"High resolution structure and dynamics of CsPinA parvulin at physiological temperature",\N
18865,"18865","2013-10-14",\N,"Ovine Doppel Signal peptide (1-30)",\N
18866,"18866",\N,\N,"Backbone and side chain assignments for collagen peptide (GLOGEN)-bound integrin alpha1I-domain",\N
18867,"18867","2013-10-15",\N,"CD79a cytosolic domain",\N
18869,"18869","2013-01-24",\N,"Solution NMR Structure of Cyclin-dependent kinase 2-associated protein 2 (CDK2AP2, DOC-1R) from Homo sapiens, Northeast Structural Genomics Consortium (NESG) Target HR8910C",\N
18870,"18870","2013-12-02",\N,"Solution structure of the dimerization domain of Aux/IAA transcription factor Ps-IAA4 from pea (Pisum sativum)",\N
18871,"18871","2013-04-08",\N,"Solution structure of a chaperone in type III secretion system",\N
18872,"18872","2012-12-13",\N,"ID3 stem",\N
18873,"18873","2013-09-26",\N,"Chemical shift assignment for Lewisx with a (CH2)3NH2 spacer",\N
18874,"18874","2012-12-13",\N,"PHD domain of ING4 N214D mutant",\N
18875,"18875","2013-02-27","2013-04-18","[Aba5,14]BTD-2",\N
18877,"18877","2014-02-14",\N,"1H,13C,15N chemical shift assignment of Ca2+_bound CaBP4",\N
18878,"18878","2013-06-04",\N,"Solution structure of the Hs. PSIP1 PWWP domain",\N
18879,"18879","2013-12-16",\N,"SP-B C-terminal (residues 59-80) peptide in DPC micelles",\N
18880,"18880","2013-12-09","2014-05-12","SOLUTION STRUCTURE OF THE SMALL DICTYOSTELIUM DISCOIDEIUM MYOSIN LIGHT CHAIN MlcB PROVIDES INSIGHTS INTO IQ-MOTIF RECOGNITION OF CLASS I MYOSIN MYO1B",\N
18882,"18882","2014-01-13",\N,"TICAM-2 TIR domain",\N
18883,"18883","2014-01-13",\N,"TICAM-1 TIR domain structure",\N
18884,"18884","2013-10-15",\N,"CD79b cytosolic domain",\N
18885,"18885","2013-02-15","2013-05-23","S. cerevisiae proteasome regulatory particle ATPase Rpt6 C-terminal domain",\N
18887,"18887","2012-12-21",\N,"Solution structure of hypothetical protein lmo0427",\N
18888,"18888","2013-02-05","2013-02-14","EGFR transmembrane - juxtamembrane (TM-JM) segment in bicelles: MD guided NMR refined structure.",\N
18889,"18889","2013-10-15",\N,"CD3e cyt",\N
18890,"18890","2013-10-15",\N,"CD3g cytosolic domain",\N
18891,"18891","2013-01-24",\N,"Solution structure of the Tetrahymena telomerase RNA stem IV terminal loop",\N
18892,"18892","2013-01-24",\N,"Solution structure of the helix II template boundary element from Tetrahymena telomerase RNA",\N
18893,"18893","2013-12-16","2014-02-17","NMR solution structure of the d3'-hairpin of the group II intron Sc.ai5gamma including EBS1 bound to IBS1",\N
18894,"18894","2013-12-16","2014-02-17","NMR solution structure of the d3'-hairpin including the exon binding site 1 (EBS1) of the group II intron Sc.ai5gamma",\N
18895,"18895","2013-01-29",\N,"Backbone and partial sidechain assignment of the microtubule binding domain of the MAP1B light chain",\N
18896,"18896","2013-11-26",\N,"NMR STRUCTURE OF A BI-FUNCTIONAL LYSOZYME-PROTEASE INHIBITOR FROM THE DEFENSE GLAND OF COPTOTERMES FORMOSANUS SHIRAKI SOLDIERS",\N
18897,"18897","2013-01-29",\N,"NMR structure of the glycosylated conotoxin CcTx from Conus consors",\N
18898,"18898","2013-02-21","2013-07-31","Backbone and side-chain assignments of a tethered complex between LMO4 and DEAF-1",\N
18899,"18899","2013-10-16",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for the bacterial toxin Doc",\N
18900,"18900","2013-05-28","2014-02-17","NMR STRUCTURE OF THE CATALYTIC DOMAIN FROM E. FAECIUM L,D- TRANSPEPTIDASE",\N
18901,"18901","2013-02-15",\N,"NMR structure of the C-terminal domain of the protein HCFC1 from MUS MUSCULUS",\N
18902,"18902","2013-09-16","2013-12-12","Solution structure of the major G-quadruplex formed in the human VEGF promoter: Insights into loop interactions of the parallel G-quadruplexes",\N
18904,"18904","2013-12-16",\N,"NMR solution structure of the two domain PPIase SlpA from Escherichia coli",\N
18905,"18905","2013-02-01",\N,"NMR structure of the RRM2 domain of the protein RBM10 from homo sapiens",\N
18906,"18906","2013-02-20",\N,"1H, 13C and 15N resonance assignments of an N-terminal domain of CHD4",\N
18907,"18907","2013-01-11",\N,"Solution structure of Duplex DNA",\N
18908,"18908","2013-02-21","2013-05-08","Human programmed cell death 1 receptor",\N
18909,"18909","2013-02-08",\N,"Solution NMR structure of the SANT domain of human DNAJC2; Notrheast structural genomics consortium target HR8254a",\N
18910,"18910","2014-01-06",\N,"NMR solution structure of the AVR3a11 from Phytophthora Capsici",\N
18911,"18911","2013-04-22","2014-02-17","NMR STRUCTURE OF THE CATALYTIC DOMAIN FROM E. FAECIUM L,D- TRANSPEPTIDASE ACYLATED BY ERTAPENEM",\N
18912,"18912","2013-04-08",\N,"The membran-proximal domain of ADAM17",\N
18913,"18913","2013-02-27","2013-04-25","[Aba3,16]BTD-2",\N
18914,"18914","2013-02-27","2013-04-25","[Aba3,7,12,16]BTD-2",\N
18916,"18916","2013-01-22","2014-02-17","NMR solution structure of BRCT domain of yeast REV1",\N
18917,"18917","2013-02-15","2013-03-21","Solution NMR structure of the N-terminal domain of STM1478 from Salmonella typhimurium LT2: Target STR147A of the Northeast Structural Genomics consortium (NESG), and APC101565 of the Midwest Center for Structural Genomics (MCSG).",\N
18918,"18918","2013-05-30",\N,"Chemical shifts assignment for the unfolded state of the N-terminal domain of ribosomal protein L9 (NTL9) V3AI4A double mutant in 8.3 M urea",\N
18919,"18919","2013-02-05","2014-02-17","Backbone 1H, 13C, and 15N Chemical Shift Assignments for Full-Length Rabbit Cytochrome b5",\N
18921,"18921","2013-03-01","2013-04-25","Structure of [L-HisB24] insulin analogue at pH 1.9",\N
18923,"18923","2013-03-01","2013-04-25","Structure of [L-HisB24] insulin analogue at pH 8.0",\N
18924,"18924","2013-03-01","2013-04-25","Structure of [D-HisB24] insulin analogue at pH 1.9",\N
18925,"18925","2013-03-01","2013-04-25","Structure of [D-HisB24] insulin analogue at pH 8.0",\N
18926,"18926","2013-10-14",\N,"Solution structure of MCh-1: A novel inhibitor cystine knot peptide from Momordica charantia",\N
18927,"18927","2014-02-14",\N,"Solution NMR assignments of V5 domain from Protein Kinase C alpha",\N
18928,"18928","2014-02-14",\N,"Solution NMR assignments of the phosphorylation-mimicking mutant of V5 domain from Protein Kinase C alpha",\N
18929,"18929","2014-02-14",\N,"Solution NMR assignments of V5 domain from Protein Kinase C alpha, in complex with DPC micelles",\N
18930,"18930","2014-02-14",\N,"Solution NMR assignments of the phosphorylation-mimicking mutant of V5 domain from Protein Kinase C alpha, in complex with DPC micelles",\N
18931,"18931","2013-02-27","2013-04-25","[Aba5,7,12,14]BTD-2",\N
18937,"18937","2013-02-27","2013-04-25","[Aba3,5,7,12,14,16]BTD-2",\N
18938,"18938","2013-02-27","2013-04-25","BTD-2[3,4]",\N
18939,"18939","2013-01-24",\N,"Solution Structure of C-terminal AbrB",\N
18941,"18941","2013-01-24",\N,"Backbone 1H, 13C, and 15N chemical shift assignments for the LFA-1 wild type I-domain",\N
18942,"18942","2013-11-08","2014-02-17","alpha-1 integrin I-domain in complex with GLOGEN triple helical peptide",\N
18943,"18943","2013-11-18","2014-02-17","N-terminal domain of pneumococcal PhtD protein with bound Zn(II)",\N
18944,"18944","2013-02-01",\N,"NMR Structure of the homeodomain transcription factor Gbx1 from Homo sapiens",\N
18945,"18945","2014-01-13",\N,"k-Ssm1a",\N
18946,"18946","2013-03-25",\N,"Solution structure of the insecticidal spider-venom peptide Aps III",\N
18947,"18947","2013-05-30","2014-02-17","SpnDE1",\N
18948,"18948","2014-02-14",\N,"STRUCTURE OF LASSO PEPTIDE ASTEXIN-1(19)",\N
18949,"18949","2013-06-04","2013-07-09","The H/D-exchange Kinetics of the Escherichia coli Co-chaperonin GroES studied by 2D-NMR and DMSO-Quenched Exchange Methods",\N
18952,"18952","2013-10-24","2013-12-04","Serine 16 phosphorylated phospholamban pentamer, Hybrid solution and solid-state NMR structural ensemble",\N
18953,"18953","2013-06-04","2013-12-12","Solution Structure of gammaM7-Crystallin",\N
18954,"18954","2013-01-28",\N,"NMR structure of the GUCT domain from human DEAD box polypeptide 21",\N
18955,"18955","2013-08-29","2013-12-12","STRUCTURE OF NAB2P TANDEM ZINC FINGER 12",\N
18956,"18956","2013-08-29","2013-12-12","STRUCTURE OF NAB2P TANDEM ZINC FINGER 34",\N
18958,"18958","2014-01-27","2014-02-17","The Integrin L Transmembrane Domain in Bicelles: Structure and Interaction with Integrin 2",\N
18959,"18959","2013-11-26","2014-02-17","NMR structure of Rsa1p238-259 from S. Cerevisiae",\N
18961,"18961","2014-02-14",\N,"NMR assignments of a hypothetical pseudo-knotted protein HP0242 from H. pylori",\N
18963,"18963","2013-08-05",\N,"1H, 13C, 15N chemical shift assignments of Dido PHD domain",\N
18964,"18964","2013-12-02","2014-02-11","Characterization of a Novel Alpha4/6-Conotoxin TxIC from Conus textile that Potently Blocks alpha3beta4 Nicotinic Acetylcholine Receptors",\N
18965,"18965","2014-03-10","2014-06-30","Solution Structure of Marine Sponge-Derived Asteropsin E Which is Highly Resistant to Gastrointestinal Proteases",\N
18966,"18966","2013-02-11","2013-02-28","Global folded of the type IV pilin ComP from Neisseria meningitidis",\N
18967,"18967","2013-05-13",\N,"Solution structure of the C-terminal zinc-binding domain of HPV51 oncoprotein E6",\N
18969,"18969","2014-02-14",\N,"1H, 13C and 15N resonance assignments of S55A mutant of UVI31+ from Chlamydomonas reinhardtii",\N
18970,"18970","2013-09-10","2013-12-12","peptide leucine arginine",\N
18971,"18971","2013-06-04","2013-07-09","Structure and dynamics of a human Nedd4 WW domain-ENaC complex",\N
18973,"18973","2014-01-06","2014-02-17","DNA containing a cluster of 8-oxo-guanine and abasic site lesion : alpha anomer",\N
18974,"18974","2014-01-02","2014-02-17","Modified Helix 69",\N
18975,"18975","2014-01-02","2014-02-17","Unmodified Helix 69",\N
18976,"18976","2013-07-22",\N,"CALMODULIN, I85L, F92E, H107I, L107I, A128T, M144R MUTANT","/ftp/pub/bmrb/timedomain/bmr18976"
18977,"18977","2014-02-14",\N,"Assignment of Tyrosine Phosphatase Related to Biofilm formation A (TpbA) from Pseudomonas Aeruginosa bound to phosphate",\N
18978,"18978","2013-03-01","2014-02-11","Solution structure of Ph1500: a homohexameric protein centered on a 12-bladed beta-propeller",\N
18979,"18979","2014-01-06","2014-05-06","DNA containing a cluster of 8-oxo-guanine and abasic site lesion : beta anomer",\N
18980,"18980","2013-02-21","2014-02-11","NMR solution structure of HIV-1 nucleocapsid protein in complex with an inhibitor displaying a 2 inhibitors:1 NC stoichiometry",\N
18981,"18981","2014-01-06","2014-05-06","DNA containing a cluster of 8-oxo-guanine and THF lesion",\N
18982,"18982","2013-12-09",\N,"Transcriptional regulatory protein",\N
18984,"18984","2014-01-06","2014-05-06","DNA containing a cluster of 8-oxo-guanine and abasic site lesion : alpha anomer (AP6, 8OG 14)",\N
18985,"18985","2014-01-06","2014-05-06","DNA containing a cluster of 8-oxo-guanine and abasic site lesion : beta anomer (6AP, 8OG14)",\N
18986,"18986","2013-09-30","2014-02-17","1H, 13C, and 15N Chemical Shift Assignments for the C-terminus of the minichromosome maintenance protein MCM from Sulfolobus solfataricus",\N
18987,"18987","2013-02-01",\N,"Solution NMR structure of SACOL0876 from Staphylococcus aureus COL, NESG target ZR353 and CSGID target IDP00841",\N
18988,"18988","2013-03-04","2013-03-19","Backbone 1H, 13C, and 15N Chemical Shift Assignments for Pseudomonas Aeruginosa heme oxyengase apo and in presence of selected compounds",\N
18989,"18989","2013-02-11",\N,"Solution NMR structure of the Polyketide_cyc-like protein Cgl2372 from Corynebacterium glutamicum, Northeast Structural Genomics Consortium Target CgR160.","/ftp/pub/bmrb/timedomain/bmr18989"
18990,"18990","2013-05-13","2013-06-21","protein structure",\N
18991,"18991","2014-02-14",\N,"Backbone resonance assignment of [2Fe-2S]-ferredoxin in its oxidized state",\N
18992,"18992","2014-02-14",\N,"Backbone resonance assignment of [2Fe-2S]-ferredoxin in its reduced state",\N
18993,"18993","2013-02-21","2014-02-17","Backbone resonance assignment of Alt a 1, the major allergen of Alternaria alternata",\N
18994,"18994","2014-02-03","2014-02-17","1H, 13C and 15N chemical shift assignments for the N-terminal domain of the KCNH channel from Zebrafish",\N
18995,"18995","2013-12-16",\N,"Structural Insights into Human S100B and Basic Fibroblast Growth Factor (FGF2) Interaction",\N
19000,"19000","2013-02-20",\N,"Solution NMR structure of VV2_0175 from Vibrio vulnificus, NESG target VnR1 and CSGID target IDP91333",\N
19001,"19001","2013-05-13","2014-06-30","OspE",\N
19002,"19002","2013-03-21","2013-04-29","Solution structure of the Core Domain (11-85) of the Murine Norovirus VPg protein.",\N
19003,"19003","2013-03-21","2013-04-29","Solution structure of the Core Domain (10-76) of the Feline Calicivirus VPg protein.",\N
19004,"19004","2013-04-02","2014-07-29","1H, 13C, and 15N backbone chemical shift assignments of the low-spin CN-bound yeast cytochrome c peroxidase with the C-terminal His-tag",\N
19005,"19005","2013-04-02","2014-07-29","1H, 13C, and 15N backbone chemical shift assignments of the low-spin CN-bound yeast cytochrome c peroxidase with the N-terminal His-tag",\N
19006,"19006","2013-08-14","2014-05-06","1H, 13C and 15N backbone and side chain resonance assignment of the phosphorelay protein VanU from Vibrio anguillarum",\N
19007,"19007","2014-03-03","2014-05-12","Solution structure of Bacillus subtilis MinC N-terminal domain",\N
19008,"19008","2013-03-13","2014-05-06","Chemical Shift Assignments for SinR from Bacillus subtilis",\N
19009,"19009","2013-09-23",\N,"40-residue beta-amyloid fibril derived from Alzheimer's disease brain",\N
19010,"19010","2014-02-13",\N,"1H, 15N and 13C backbone chemical shift assignment of the titin A59-A60 domain tandem",\N
19011,"19011","2014-02-13",\N,"1H, 15N and 13C backbone chemical shift assignment of the titin A60 domain",\N
19012,"19012","2013-03-21",\N,"NMR structure of hypothetical protein BT_0846 from Bacteroides thetaiotaomicron VPI-5482 (NP_809759.1)",\N
19013,"19013","2013-03-06",\N,"Solution structure of the RRM domain of the hypothetical protein CAGL0M09691g from Candida glabrata",\N
19014,"19014","2013-03-04",\N,"Solution structure of the putative Ras interaction domain of AFD-1, isoform a from Caenorhabditis elegans",\N
19015,"19015","2013-06-28",\N,"Backbone resonance assignments for G protein alpha i3 subunit in the GDP-bound state",\N
19017,"19017","2013-05-30","2014-02-14","Solution structure of an intramolecular propeller-type G-quadruplex containing a single bulge",\N
19018,"19018","2013-03-13",\N,"NMR structure of E. coli ribosomela decoding site with apramycin",\N
19023,"19023","2013-04-11","2013-06-21","Solution structure and sigma factor interactions of Mycobacterium tuberculosis RNA polymerase binding protein A",\N
19024,"19024","2014-03-03",\N,"single G-bulge in a conserved regulatory region of the HEV genome",\N
19025,"19025","2013-05-30","2014-06-16","Solid-state Chemical Shift Assignments for CAP-Gly Domain of Mammalian at 19.9 T",\N
19026,"19026","2013-06-17","2013-08-07","Analysis of the structural and molecular basis of voltage-sensitive sodium channel inhibition by the spider toxin, Huwentoxin-IV ( -TRTX-Hh2a).",\N
19027,"19027","2013-03-12",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for rubredoxin type protein from Mycobacterium ulcerans",\N
19030,"19030","2013-06-17","2013-08-07","Analysis of the structural and molecular basis of voltage-sensitive sodium channel inhibition by the spider toxin, Huwentoxin-IV ( -TRTX-Hh2a).",\N
19031,"19031","2013-06-04","2014-06-16","Solid-state Chemical Shift Assignments for p150Glued CAP-Gly Domain in complex with EB1 at 19.9 T",\N
19032,"19032","2013-06-17","2013-08-07","Analysis of the structural and molecular basis of voltage-sensitive sodium channel inhibition by the spider toxin, Huwentoxin-IV ( -TRTX-Hh2a).",\N
19033,"19033","2013-03-21",\N,"NMR structure of the SH3 domain of human RAS p21 protein activator (GTPase activating protein) 1",\N
19034,"19034","2013-03-21",\N,"NMR Structure of the third RNA Recognition Motif (RRM) of U2 small nuclear ribonucleoprotein auxiliary factor (U2AF) 2",\N
19035,"19035","2013-08-14","2013-12-09","G-rich VEGF aptamer with LNA modifications",\N
19036,"19036","2013-05-06","2013-12-09","NMR structure of the complex of an N-terminally acetylated alpha-synuclein peptide with calmodulin",\N
19037,"19037","2013-03-04","2013-03-12","1H, 13C, and 15N Chemical Shift Assignments of h-prune C-terminal domain",\N
19038,"19038","2013-08-14","2013-10-30","The structure of the complex of cytochrome P450cam and its electron donor putidaredoxin determined by paramagnetic NMR spectroscopy",\N
19039,"19039","2014-02-24",\N,"NMR solution structure of domain 5 from Azotobacter vinelandii Intron 5 at pH 7.8",\N
19040,"19040","2013-04-01",\N,"structure of 2'-5' AG1 lariat forming ribozyme in its inactive state",\N
19041,"19041","2014-03-10",\N,"Spatial structure of dimeric VEGFR2 membrane domain in DPC micelles",\N
19042,"19042","2013-08-14","2014-05-06","Complete 1H, 13C, and 15N Chemical Shift Assignments for Burkholderia pseudomallei Frataxin like protein",\N
19043,"19043","2013-08-14","2013-10-30","Protein A binding by an engineered Affibody molecule",\N
19044,"19044","2013-03-18",\N,"Backbone and Side Chain 1H, 13C and 15N Chemical Shift Assignments for Domain 4 of Phosphomannomutase/Phosphoglucomutase from Pseudomonas aeruginosa",\N
19045,"19045","2013-04-15","2013-05-08","The NMR structure of the BID-BAK complex",\N
19046,"19046","2013-05-30","2014-05-06","Sequence-specific backbone 1H, 13C and 15N assignments of the 34 kDa catalytic domain of PTPN5",\N
19047,"19047","2013-08-14",\N,"Solution Structure of the Bacillus cereus Metallo-Beta-Lactamase BcII",\N
19048,"19048","2013-08-14",\N,"Solution Structure of the Bacillus cereus Metallo-Beta-Lactamase BcII in Complex with R-Thiomandelic Acid",\N
19049,"19049","2013-08-14",\N,"Solution structure of chicken Engrailed 2 homeodomain",\N
19051,"19051","2013-09-11","2014-02-14","1H, 13C, 15N assignment of Voltage-gated calcium channel beta 4 subunit core domains",\N
19052,"19052","2014-02-24","2014-05-09","NMR Structure of the Complete Internal Fusion Loop mutant L529A/I544A from Ebolavirus GP2 at pH 5.5",\N
19053,"19053","2013-11-11","2014-02-14","Solution structure of FimA wt",\N
19054,"19054","2013-11-11","2014-02-14","NMR structures of human apoptotic protein tBid in LPPG micelle",\N
19056,"19056","2013-05-30","2014-05-06","1H, 13C, 15N backbone and side chain NMR resonance assignments of the N-terminal NEAr iron Transporter (NEAT 1) domain of the IsdB hemoglobin receptor of Staphylococcus aureus",\N
19058,"19058","2013-12-02",\N,"Atomic-resolution structure of a doublet cross-beta amyloid fibril",\N
19059,"19059","2014-03-03",\N,"ns5a308",\N
19060,"19060","2013-12-02",\N,"Atomic-resolution structure of a triplet cross-beta amyloid fibril",\N
19061,"19061","2013-05-30",\N,"1H,13C and 15N resonance assignments of Ca2+ - bound human S100A15",\N
19062,"19062","2013-05-30","2013-09-04","Atomic-resolution structure of a cross-beta protofilament",\N
19063,"19063","2014-02-13",\N,"TIAR RRM2 chemical shifts in the apo state",\N
19064,"19064","2014-02-13",\N,"TIAR RRM2 chemical shifts in bound to RNA 5'-UUAUUU-3'",\N
19066,"19066","2014-02-10","2014-03-04","Solution structure of the FimH adhesin carbohydrate-binding domain",\N
19067,"19067","2013-06-24",\N,"Solution structure of latherin",\N
19068,"19068","2013-04-29",\N,"Solution NMR Structure CTD domain of NFU1 Iron-Sulfur Cluster Scaffold Homolog from Homo sapiens, Northeast Structural Genomics Consortium (NESG) Target HR2876C","/ftp/pub/bmrb/timedomain/bmr19068"
19069,"19069","2013-04-02",\N,"1H,13C,15N Assignement of EFGP fluorescent protein",\N
19070,"19070","2013-03-25","2014-02-14","SOLUTION STRUCTURE OF LIPIDATED GLUCAGON ANALOG IN WATER",\N
19071,"19071","2013-03-25","2014-02-14","SOLUTION STRUCTURE OF LIPIDATED GLUCAGON ANALOG IN D-TFE",\N
19072,"19072","2013-03-13","2014-02-14","Backbone 1H, 13C, and 15N Chemical Shift Assignment for inactive HIV-1 protease Bmut5",\N
19074,"19074","2013-05-30","2013-08-07","1H, 13C, 15N chemical shift assignments of Dido PHD domain in complex with peptide H3K4me3",\N
19075,"19075","2013-09-10","2014-07-29","1H, 13C, and 15N backbone chemical shift assignments of the iron-free protoporphyrin IX yeast cytochrome c peroxidase with the C-terminal His-tag",\N
19076,"19076","2013-09-10","2014-07-29","1H, 13C, and 15N backbone chemical shift assignments of the resting-state yeast cytochrome c peroxidase with the N-terminal His-tag",\N
19077,"19077","2014-02-13",\N,"1H, 13C and 15N backbone and side-chain resonance assignments of the N-terminal ubiquitin-binding domain of the human deubiquitinase USP28",\N
19079,"19079","2014-03-14","2014-06-30","Solution structure of the 2A proteinase from a common cold agent, human rhinovirus RV-C02, strain W12",\N
19080,"19080","2013-06-04",\N,"Backbone assignment of an unlinked NS2B and NS3 protease complex of dengue virus 2",\N
19082,"19082","2013-06-04","2014-05-06","Backbone and ILV methyl resonance assignments of E. coli thymidylate synthase bound to cofactor and a nucleotide analogue",\N
19083,"19083","2013-06-04","2014-04-02","Backbone 1H, 13C, and 15N; and VL 13CH3 Side-chain Chemical Shift Assignments for Mutant SENP1 C603S Catalytic Domain",\N
19084,"19084","2013-04-17","2014-10-07","The Mengovirus Leader protein",\N
19085,"19085","2014-03-10",\N,"Novel method of protein purification for structural research. Example of ultra high resolution structure of SPI-2 inhibitor by X-ray and NMR spectroscopy.",\N
19087,"19087","2014-02-24",\N,"The NMR chemical shift assignments for backbone 1H, 13C, and 15N of VirR (Rv0431)",\N
19088,"19088","2013-08-14","2013-10-30","Backbone chemical shift assignment of Rv2140c, a phosphatidylethanolamine binding protein from Mycobacterium tuberculosis",\N
19094,"19094","2013-06-03","2013-06-12","Enterocin 7A",\N
19099,"19099","2013-04-18","2014-02-14","1H, 13C and 15N chemical shifts of human beta-2-microglobulin in solution",\N
19101,"19101","2013-06-10","2013-06-12","Enterocin 7B",\N
19106,"19106","2014-02-12","2014-05-06","The protease-resistant N-terminal domain of TIR-domain containing adaptor molecule-1, TICAM-1",\N
19108,"19108","2013-05-20","2013-05-28","NMR structure of human restriction factor APOBEC3A",\N
19109,"19109","2013-08-15",\N,"Chemical Shift Assignments of the C-terminal Eps15 Homology Domain-3 EH Domain",\N
19110,"19110","2013-08-15",\N,"NMR assignments of PI3-SH3 aided by protonless NMR spectroscopy",\N
19111,"19111","2013-08-16",\N,"USP25",\N
19112,"19112","2013-05-03",\N,"Structural characterization by NMR of a double phosphorylated chimeric peptide vaccine for treatment of Alzheimer's disease",\N
19113,"19113","2013-04-18","2014-02-14","Chemical shifts of human beta-2 microglobulin bound to HLA-B2709 complexed with the nonamer peptide pVIPR (RRKWRRWHL)",\N
19114,"19114","2014-02-12","2015-02-27","4E-BP2",\N
19115,"19115","2013-07-01",\N,"Full-length mercury transporter protein MerF in lipid bilayer membranes",\N
19116,"19116","2013-04-18","2014-02-14","Chemical shifts of human beta-2 microglobulin bound to HLA-B2709 complexed with the nonamer peptide TIS (RRLPIFSRL)",\N
19118,"19118","2013-04-18","2014-02-14","Chemical shifts of human beta-2 microglobulin bound to HLA-B2709 complexed with the nonamer peptide pLMP2 (RRRWRRLTV)",\N
19119,"19119","2013-04-18","2014-02-14","Chemical shifts of human beta-2 microglobulin bound to HLA-B2709 complexed with the nonamer peptide pGR (RRRWHRWRL)",\N
19120,"19120","2013-04-18","2014-02-14","Chemical shifts of human beta-2 microglobulin bound to HLA-B2705 complexed with the nonamer peptide pVIPR (RRKWRRWHL)",\N
19121,"19121","2013-04-18","2014-02-14","Chemical shifts of human beta-2 microglobulin bound to HLA-B2705 complexed with the nonamer peptide TIS (RRLPIFSRL)",\N
19122,"19122","2013-04-18","2014-02-14","Chemical shifts of human beta-2 microglobulin bound to HLA-B2705 complexed with the nonamer peptide pLMP2 (RRRWRRLTV)",\N
19123,"19123","2013-04-18","2014-02-14","Chemical shifts of human beta-2 microglobulin bound to HLA-B2705 complexed with the nonamer peptide pGR (RRRWHRWRL)",\N
19125,"19125","2014-02-12","2014-05-06","Molecular Basis of Histone Acetyllysine Recognition by the BRPF1 Bromodomain.",\N
19126,"19126","2013-09-03",\N,"Structure of full-length transmembrane domains of human glycine receptor 1 monomer subunit",\N
19127,"19127","2013-08-15",\N,"The Dynamics of Lysozyme from Bacteriophage Lambda in Solution probed by NMR and MD simulations",\N
19128,"19128","2013-10-28",\N,"cIn936W",\N
19129,"19129","2013-10-28",\N,"NMR SOLUTION STRUCTURE OF trans (MAJOR) FORM OF In936",\N
19130,"19130","2013-10-28",\N,"NMR SOLUTION STRUCTURE OF cis (MINOR) FORM OF In936 in Methanol",\N
19131,"19131","2013-10-28",\N,"SOLUTION NMR STRUCTURE OF trans (MAJOR) FORM OF In937 in Methanol",\N
19132,"19132","2013-10-28",\N,"SOLUTION STRUCTURE OF cis(C2-P3) trans (D5-P6) FORM OF lO959 IN WATER",\N
19133,"19133","2013-10-28",\N,"SOLUTION STRUCTURE OF trans(C2-P3) trans (D5-P6) of LO959 IN METHANOL",\N
19135,"19135","2013-08-15","2013-12-09","Efficient Protocol for Assignment of Large, Intrinsically Disordered Proteins. 49.2kDa MAP2c, a case study",\N
19136,"19136","2013-08-15",\N,"ERG Ets Domain Backbone Chemical Shifts",\N
19137,"19137","2013-08-15",\N,"ERGi Backbone Chemical Shifts",\N
19138,"19138","2013-08-15",\N,"ERG DNA Complex",\N
19140,"19140","2013-05-06","2013-08-07","Dynorphin A R6W",\N
19141,"19141","2013-05-06","2013-08-07","Dynorphin A L5S",\N
19144,"19144","2013-05-30","2013-07-09","A structural model of CAP mutant (T127L and S128I) in the apo state",\N
19145,"19145","2013-05-30","2013-07-09","A STRUCTURAL MODEL OF CAP MUTANT (T127L AND S128I) IN CGMP- BOUND STATE",\N
19147,"19147","2013-05-28",\N,"ZINC Binding Domain",\N
19148,"19148","2013-05-06","2013-06-21","The actinobacterial transcription factor RbpA binds to the principal sigma subunit of RNA polymerase",\N
19149,"19149","2013-05-06","2013-06-21","The actinobacterial transcription factor RbpA binds to the principal sigma subunit of RNA polymerase",\N
19150,"19150","2013-08-15",\N,"1H, 15N, and 13C Chemical Shift Assignments of the Light-activated State of a Cyanobacterial GAF Domain (NpF2164-GAF3)",\N
19151,"19151","2013-08-15",\N,"apo_YqcA",\N
19152,"19152","2013-08-15",\N,"holo_YqcA",\N
19154,"19154","2013-05-13","2013-05-30","Sungsanpin",\N
19156,"19156","2014-02-12",\N,"1H, 13C, and 15N NMR Assignments of a Hedgehog Autoprocessing Domain",\N
19157,"19157","2013-05-14",\N,"ATOMIC-RESOLUTION STRUCTURE OF A CROSS-BETA QUADRUPLET AMYLOID FIBRIL DETERMINED BY SOLID-STATE MAGIC ANGLE SPINNING NMR AND CRYO-EM",\N
19160,"19160","2013-05-14","2013-10-17","Ligand binding promiscuity of human liver fatty acid binding protein: structural and dynamic insights from an interaction study with glycocholate and oleate",\N
19161,"19161","2014-02-12","2014-05-02","Backbone chemical shift assignment of porcine amelogenin in the presence of SDS micelles",\N
19162,"19162","2013-06-10","2013-07-09","Structure of the p7 channel of Hepatitis C virus, genotype 5a",\N
19163,"19163","2013-06-24","2014-05-07","The solution structure of the J-domain of human DnaJA1",\N
19164,"19164","2013-08-15",\N,"solution structure of cerebral dopamine neurotrophic factor (CDNF)",\N
19165,"19165","2013-12-12","2014-02-14","Backbone and side chain chemical shift assignments of bacterial acid-stress chaperone HdeA at pH 6","/ftp/pub/bmrb/timedomain/bmr19165"
19168,"19168","2013-05-13",\N,"Solution structure of the a C-terminal domain of translation initiation factor IF-3 from Campylobacter jejuni",\N
19169,"19169","2013-05-13",\N,"Solution structure of uncharacterized thioredoxin-like protein PG_2175 from Porphyromonas gingivalis",\N
19172,"19172","2013-08-15",\N,"PTPN11 C-SH2 domain free form",\N
19173,"19173","2013-08-15",\N,"PTPN11 C-SH2 domain bound form",\N
19174,"19174","2013-09-10","2014-02-14","Structure of the Regulatory Domain of Human Brain Carnitine Palmitoyltransferase 1",\N
19175,"19175","2014-02-03","2014-02-05","[Asp2]RTD-1",\N
19176,"19176","2014-02-03","2014-02-05","[Asp11]RTD-1",\N
19177,"19177","2014-02-03","2014-02-05","[Asp2,11]RTD-1",\N
19178,"19178","2013-06-10","2013-12-09","Enteropathogenic Escherichia coli 0111:H- str. 11128 ORF EC0111_1119 similar to bacteriophage lambda ea8.5",\N
19179,"19179","2013-06-10","2013-12-09","ORF PP_3909 from Pseudomonas putida KT2440 encoding a protein similar to bacteriophage lambda ea8.5",\N
19180,"19180","2013-12-23","2014-02-14","Trp-cage Circular Permutant",\N
19181,"19181","2013-09-25","2013-12-09","1H, and 15N Chemical Shift Assignments for mycoloylated PorH in DMSO solution",\N
19182,"19182","2013-05-17","2013-09-27","Backbone 1H, 13C, and 15N Chemical Shift Assignments for the catalytic domain of human Aprataxin",\N
19183,"19183","2013-12-23","2014-02-14","Trp-cage 16b P12W: a Hyperstable Miniprotein",\N
19185,"19185","2013-08-26","2013-10-17","Structure of the Type IVa Major Pilin from the Electrically Conductive Bacterial Nanowires of Geobacter sulfurreducens",\N
19186,"19186","2013-08-16",\N,"Chemical shift assignments of a S72-S107 peptide of 18.5kDa murine myelin basic protein (MBP)",\N
19187,"19187","2013-09-30","2014-05-07","1H, 13C, and 15N Chemical Shift Assignments for the C-terminus of the minichromosome maintenance protein MCM from Methanothermobacter thermautotrophicus",\N
19188,"19188","2013-05-21","2013-10-17","Ligand binding promiscuity of human liver fatty acid binding protein: structural and dynamic insights from an interaction study with glycocholate and oleate",\N
19189,"19189","2013-05-21","2013-10-17","Ligand binding promiscuity of human liver fatty acid binding protein: structural and dynamic insights from an interaction study with glycocholate and oleate",\N
19190,"19190","2013-08-16","2013-10-17","Solution structure of a Beta-Hairpin Peptidomimetic antibiotic that target LptD in Pseudomonas sp.",\N
19191,"19191","2013-05-21",\N,"4EBP1 contains a pre-populated eIF4E-binding helix",\N
19192,"19192","2013-08-16","2013-10-17","Solution Structure of a Beta-Hairpin Peptidomimetic antibiotic that target LptD in Pseudomonas sp.",\N
19193,"19193","2013-07-08","2013-10-17","NMR solution structure of N-terminal domain of (Y81F)-EhCaBP1",\N
19194,"19194","2013-08-13",\N,"Backbone resonance assignment of the alpha-subunit within the megadalton proteasome-activator complex",\N
19195,"19195","2013-06-04",\N,"alfa-actinin from parasite Entamoeba histolytica",\N
19196,"19196","2013-06-17","2013-10-14","N-terminal domain of (Y81F)-EhCaBP1 structure",\N
19197,"19197","2013-06-17","2013-10-14","C-terminal structure of (Y81F)-EhCaBP1",\N
19198,"19198","2013-05-13",\N,"NMR Structure of the protein NP_346341.1 from Streptococcus pneumoniae",\N
19200,"19200","2013-08-12","2013-10-14","RXFP1 utilises hydrophobic moieties on a signalling surface of the LDLa module to mediate receptor activation",\N
19201,"19201","2013-12-02","2014-02-10","TAX1BP1 UBZ1+2",\N
19203,"19203","2013-05-13",\N,"NMR structure of RNA recognition motif 2 (RRM2) of Homo sapiens splicing factor, arginine/serine-rich 1",\N
19204,"19204","2013-05-14","2013-12-09","Backbone 1H, 13C, and 15N Chemical Shift Assignments for BAF155 SWIRM",\N
19206,"19206","2014-02-13",\N,"1H, 13C and 15N backbone and side-chain resonance assignments of a family 36 carbohydrate binding module of Xylanase from Paenibacillus campinasensis",\N
19207,"19207","2013-05-29",\N,"backbone NMR assignments for human apo-HDHD4",\N
19208,"19208","2013-11-18","2014-05-07","Backbone resonance assignments of the 42 kDa enzyme arginine kinase in the transition state analogue form",\N
19209,"19209","2013-05-29",\N,"Backbone NMR assignments for human HDHD4 in complex with calcium and N-acetylneuraminate-9-phosphate",\N
19210,"19210","2013-05-14",\N,"The C-terminal Region of Disintegrin Modulate its 3D Conformation and Cooperate with RGD Loop in Regulating Recognitions of Integrins",\N
19211,"19211","2013-05-14",\N,"The C-terminal Region of Disintegrin Modulate its 3D Conformation and Cooperate with RGD Loop in Regulating Recognitions of Integrins",\N
19212,"19212","2013-05-14",\N,"The C-terminal Region of Disintegrin Modulate its 3D Conformation and Cooperate with RGD Loop in Regulating Recognitions of Integrins",\N
19213,"19213","2014-01-02","2014-02-10","Blue Light-Absorbing State of TePixJ, an Active Cyanobacteriochrome Domain","/ftp/pub/bmrb/timedomain/bmr19213"
19214,"19214","2014-01-02","2014-02-10","Green Light-Absorbing State of TePixJ, an Active Cyanobacteriochrome Domain","/ftp/pub/bmrb/timedomain/bmr19214"
19215,"19215","2013-05-13","2014-02-10","Independently verified structure of gp41-M-MAT, a membrane associated MPER trimer from HIV-1 gp41",\N
19216,"19216","2013-06-04","2013-10-14","Structural and Functional Analysis of Transmembrane Segment IV of the Salt Tolerance Protein Sod2",\N
19217,"19217","2014-01-21","2014-05-06","SmTSP2EC2",\N
19222,"19222","2013-06-06","2015-03-30","31P Chemical shifts, RDCS and distances for four DNA oligomers",\N
19227,"19227","2013-07-29","2013-10-14","Human Pdx1 Homeodomain in the Unbound State",\N
19228,"19228","2013-07-29","2013-10-14","Human Pdx1 Homeodomain in the DNA-Bound State",\N
19229,"19229","2013-08-12","2013-10-14","PHD Domain from Human SHPRH",\N
19230,"19230","2013-07-29","2013-08-09","Solution structure of Hdm2 with engineered cyclotide",\N
19231,"19231","2014-01-21","2014-05-06","Structural Basis of DNA Recognition by the Effector Domain of Klebsiella pneumoniae PmrA",\N
19233,"19233","2014-02-10",\N,"1H, 13C, 15N assignments for P. yoelii Merozoite Surface Protein 1",\N
19234,"19234","2014-02-10",\N,"1H, 13C, 15N assignments for P. yoelii Merozoite Surface Protein 1, E28K variant",\N
19235,"19235","2013-09-03",\N,"Solution structure of the Aha1 dimer from Colwellia psychrerythraea",\N
19236,"19236","2013-06-10",\N,"Backbone (1H, 15N, CA, CB) assignments of D. crassirhizoma Plastocyanin (Zn)",\N
19239,"19239","2013-07-23",\N,"2C TCR",\N
19240,"19240","2013-07-15","2014-08-06","Human FKBP12-Major Form",\N
19241,"19241","2013-07-15","2014-08-06","Human FKBP12-Minor Form",\N
19242,"19242","2013-09-30","2013-12-09","The solution NMR structure of E. coli apo-HisJ",\N
19243,"19243","2013-09-30","2013-12-09","Backbone chemical shifts of isolated Domain 1 from E. coli HisJ",\N
19244,"19244","2013-09-30","2013-12-06","Backbone chemical shifts of isolated Domain 2 from E. coli HisJ",\N
19245,"19245","2013-09-30","2013-12-06","Backbone chemical shifts from E. coli HisJ complexed with Histidine",\N
19247,"19247","2013-06-04",\N,"Backbone (1H,15N, CA, CB) assignments of Populus nigra Plastocyanin (Zn)",\N
19248,"19248","2013-07-08","2013-08-09","Structure of SRSF1 RRM2 in complex with the RNA 5'-UGAAGGAC-3'",\N
19249,"19249","2013-12-16","2014-02-10","NMR structure of the PAI subdomain of Sleeping Beauty transposase",\N
19250,"19250","2013-07-29","2013-10-14","STRUCTURE OF LASSO PEPTIDE ASTEXIN3",\N
19251,"19251","2013-08-26","2013-10-14","Structure, function, and tethering of DNA-binding domains in 54 transcriptional activators",\N
19253,"19253","2014-02-13",\N,"Backbone and Cbeta assignments for tau K18 in free and SDS micelle-bound states",\N
19254,"19254","2014-02-13","2014-03-04","NMR assignments and backbone amide relaxation data (T1-T2) for the complex of the Y48A mutant of the FimH adhesin carbohydrate-binding domain with heptyl-mannose",\N
19255,"19255","2014-02-13","2014-03-04","Backbone amide chemical shifts and relaxation data (T1-T2) for the Y48A mutant of the FimH adhesin carbohydrate-binding domain",\N
19256,"19256","2014-02-13","2014-03-04","NMR assignments and backbone amide relaxation data (T1-T2) for the complex of the FimH adhesin carbohydrate-binding domain with heptyl-mannose",\N
19257,"19257","2014-02-13",\N,"1H, 13C, and 15N chemical shift assignments for alpha-synuclein in living E. coli cells",\N
19260,"19260","2013-06-17",\N,"A pyrimidine motif triple helix in the Kluyveromyces lactis telomerase RNA pseudoknot is essential for function in vivo",\N
19261,"19261","2013-12-09","2014-02-05","HIV capsid dimer structure",\N
19262,"19262","2014-01-21",\N,"NMR assignment and structure of a peptide derived from the membrane proximal external region of HIV-1 gp41 in the presence of hexafluoroisopropanol",\N
19263,"19263","2014-01-21",\N,"NMR assignment and structure of a peptide derived from the membrane proximal external region of HIV-1 gp41 in DPC",\N
19264,"19264","2013-11-18","2014-02-05","The structure of the W184AM185A mutant of the HIV-1 capsid protein",\N
19266,"19266","2013-11-11","2013-12-03","Pre-Fusion Solution NMR Structure of Neuronal SNARE Syntaxin 1A",\N
19267,"19267","2014-02-13",\N,"Backbone Assignment of Outer Envelope Protein 16kDa",\N
19268,"19268","2013-09-10",\N,"SOLUTION NMR STRUCTURE OF THE V209M VARIANT OF THE HUMAN PRION PROTEIN (RESIDUES 90-231)",\N
19269,"19269","2014-02-13",\N,"1H and 13C chemical shift assignment of the N-terminal intrinsically disordered domain of the oncoportein E7 from the Human Papilloma Virus",\N
19270,"19270","2014-02-13",\N,"Backbone assignment of the Sigma-1 receptor chaperone domain",\N
19271,"19271","2014-02-13",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments for CRABPI",\N
19272,"19272","2013-05-29",\N,"1H, 15N, 13C resonance assignments of Yersinia phosphatase YopH",\N
19273,"19273","2014-02-13",\N,"Structural characterization of E. coli ISC-type Ferredoxin",\N
19276,"19276","2013-07-08","2013-10-09","Structure of d[CGCGAAGCATTCGCG] hairpin",\N
19277,"19277","2013-07-08","2013-10-09","Structure of d[GGTTGGCGCGAAGCATTCGCGGGTTGG] duplex-quadruplex hybrid",\N
19278,"19278","2013-07-08","2013-10-09","Structure of d[GCGCGAAGCATTCGCGGGGAGGTGGGGAAGGG] duplex-quadruplex hybrid",\N
19279,"19279","2013-07-08","2013-10-09","Structure of d[GGGAAGGGCGCGAAGCATTCGCGAGGTAGG] duplex-quadruplex hybrid",\N
19280,"19280","2013-07-08","2013-10-09","Structure of d[AGGGTGGGTGCTGGGGCGCGAAGCATTCGCGAGG] duplex-quadruplex hybrid",\N
19281,"19281","2013-07-08","2013-10-09","Structure of d[TTGGGTGGGCGCGAAGCATTCGCGGGGTGGGT] duplex-quadruplex hybrid",\N
19284,"19284","2013-10-14",\N,"Relaxation data of the delta subunit of RNA polymerase from Bacillus subtilis",\N
19285,"19285","2014-01-02","2014-02-05","Optimized Ratiometric Calcium Sensors For Functional In Vivo Imaging of Neurons and T-Lymphocytes",\N
19286,"19286","2014-01-27",\N,"NMR Structure of BeF3 Activated Sma0114",\N
19287,"19287","2013-10-14",\N,"Solution structure of a chymotrypsin inhibitor from the Taiwan cobra",\N
19288,"19288","2013-07-22",\N,"Solution NMR Structure of E3 ubiquitin-protein ligase ZFP91 from Homo sapiens, Northeast Structural Genomics Consortium (NESG) Target HR7784A","/ftp/pub/bmrb/timedomain/bmr19288"
19290,"19290","2013-11-11","2014-02-05","NMR structure of human TDP-43 tandem RRMs in complex with UG-rich RNA",\N
19291,"19291","2013-06-24",\N,"NMR solution structure of Pin1 WW domain mutant 5-1",\N
19292,"19292","2013-06-24",\N,"NMR solution structure of Pin1 WW domain mutant 5-1g",\N
19293,"19293","2014-02-13",\N,"Solution structure of calcium-bound human S100A12",\N
19295,"19295","2013-06-24",\N,"NMR solution structure of Pin1 WW domain variant 6-1",\N
19296,"19296","2013-06-24",\N,"NMR solution structure of Pin1 WW domain mutant 6-1g",\N
19297,"19297","2013-06-28","2014-02-05","Chemical shift assignments of the human C-type lectin DC-SIGNR (Dendritic Cell-Specific Intercellular adhesion molecule-3-Grabbing Non-integrin related) carbohydrate recognition domain in the holo (calcium bound) form.",\N
19299,"19299","2013-12-16",\N,"Analysis of target DNA binding sites through NMR structural analysis of the MLV IN CTD and homology modeling of the CCD domains.",\N
19301,"19301","2014-02-13",\N,"Redox-linked domain movements in the catalytic cycle of cytochrome P450 reductase",\N
19302,"19302","2013-09-16","2013-10-09","Solution Structure of ERCC4 domain of human FAAP24",\N
19303,"19303","2013-09-16","2013-10-09","Solution Structure of (HhH)2 domain of human FAAP24",\N
19304,"19304","2013-11-18","2014-02-04","Solution structure of kalata B7",\N
19307,"19307","2014-02-13",\N,"Magnesium bound form of UVI31+ from C. reinhardtii",\N
19308,"19308","2014-02-13",\N,"Biochemical effect of S-67 phosphorylation on UVI31+ from C. reinhardtii",\N
19309,"19309","2013-09-10",\N,"3D NMR structure of a complex between the amyloid beta peptide (1-40) and the polyphenol epsilon-viniferin glucoside",\N
19311,"19311","2013-12-16","2014-02-04","Chemical shifts and structural restraints for Saccharomyces cerevisiae Est3 protein",\N
19312,"19312","2013-07-08",\N,"Solution NMR Structure of Transcription Factor GATA-4 from Homo sapiens, Northeast Structural Genomics Consortium (NESG) Target HR4783B",\N
19314,"19314","2013-07-08",\N,"Solution NMR Structure of Microtubule-associated serine/threonine-protein kinase 1 from Homo sapiens, Northeast Structural Genomics Consortium (NESG) Target HR9151A",\N
19315,"19315","2013-11-11",\N,"Solution Structure of the Catalytic Domain of HHARI",\N
19317,"19317","2013-07-08","2013-10-09","Solution structure of HRDC1 domain of RecQ helicase from Deinococcus radiodurans",\N
19318,"19318","2013-09-13","2013-12-06","Chemical shifts of the CPAP-interacting epitope of Danio rerio STIL",\N
19319,"19319","2013-08-26",\N,"Solution structure of RasGRP2 EF hands bound to calcium",\N
19321,"19321","2013-09-18",\N,"1H,15N,13C resonance assignments of cerato populin, a fungal PAMP from Ceratocystis populicola",\N
19322,"19322","2014-02-13",\N,"LTBP1 cbEGF14-TB3-EGF3",\N
19323,"19323","2014-02-13","2014-08-06","Human FKBP12.6-Major Form",\N
19324,"19324","2014-02-13","2014-08-06","Human FKBP12.6-Minor Form",\N
19325,"19325","2014-02-13",\N,"1H, 13C, and 15N Chemical Shift Assignments for a proteasome related subunit",\N
19327,"19327","2013-08-26",\N,"Solution NMR Structure of yahO protein from Salmonella typhimurium, Northeast Structural Genomics Consortium (NESG) Target StR106",\N
19328,"19328","2013-08-02",\N,"Solution NMR structure of PHD type Zinc finger domain of Lysine-specific demethylase 5B (PLU-1/JARID1B) from Homo sapiens, Northeast Structural Genomics Consortium (NESG) Target HR7375C","/ftp/pub/bmrb/timedomain/bmr19328"
19329,"19329","2013-07-19",\N,"Solution NMR Structure of the RING finger domain from the Kip1 ubiquitination-promoting E3 complex protein 1 (KPC1/RNF123) from Homo sapiens, Northeast Structural Genomics Consortium (NESG) Target HR8700A","/ftp/pub/bmrb/timedomain/bmr19329"
19330,"19330","2013-08-15","2013-10-09","Sequence Specific Backbone 1H, 15N and 13C assignments of the MAPK binding domain of DUSP 16",\N
19331,"19331","2013-09-03",\N,"Solution NMR Structure of Zinc finger protein Eos from Homo sapiens, Northeast Structural Genomics Consortium (NESG) Target HR7992A","/ftp/pub/bmrb/timedomain/bmr19331"
19332,"19332","2013-07-11","2014-06-30","Backbone 1H, 13C, and 15N Chemical Shift Assignments for p15(PAF)",\N
19333,"19333","2013-12-09",\N,"HIV-1 Vif SOCS-box and Elongin BC solution structure",\N
19334,"19334","2013-08-26","2013-10-30","NMR structure of Temporin-1 Ta in lipopolysaccharide micelles: Mechanistic insight into inactivation by outer memebrane",\N
19335,"19335","2014-02-04",\N,"NMR assignments and relaxation of 5P12-RANTES-E66S",\N
19336,"19336","2014-02-04",\N,"NMR assignments of 5P12-RANTES-E66S in the presence of dodecylphosphocholine",\N
19337,"19337","2013-09-25",\N,"alpha synuclein in PBS",\N
19338,"19338","2013-09-25",\N,"alpha synuclein mutant A53T in PBS",\N
19340,"19340","2014-02-13",\N,"Untangling the Solution Structure of C-Terminal Domain of AciniformSpidroin",\N
19344,"19344","2013-09-25",\N,"alpha synuclein mutant S87N in PBS - human/mouse chimera",\N
19345,"19345","2013-09-25",\N,"alpha synuclein mutant A53T & S87N in PBS - human/mouse chimera",\N
19346,"19346","2013-09-25",\N,"mouse alpha synuclein",\N
19347,"19347","2013-09-25",\N,"mouse alpha synuclein T53A mutant- mouse/human chimera",\N
19348,"19348","2013-09-25",\N,"mouse alpha synuclein N87S mutant- mouse/human chimera",\N
19349,"19349","2013-09-25",\N,"mouse alpha synuclein T53A & N87S mutant- mouse/human chimera",\N
19350,"19350","2013-09-25",\N,"Acetylated alpha synuclein in PBS",\N
19351,"19351","2013-09-25",\N,"Acetylated alpha synuclein A53T familiar mutant in PBS",\N
19354,"19354","2014-02-13",\N,"Solution structure of Smoothened",\N
19356,"19356","2014-02-13","2014-06-05","Solution structure of the chimeric hydrophobin NChi2",\N
19357,"19357","2014-02-10",\N,"Backbone 1H, 13C, 15N chemical shift assignments for the Met66 prodomain region of BDNF",\N
19358,"19358","2014-02-10",\N,"Backbone 1H, 13C, 15N chemical shift assignments for the Val66 prodomain region of BDNF",\N
19361,"19361","2013-08-12",\N,"The Apo-structure of the Low Molecular Weight Protein-tyrosine Phosphatase A (MptpA) from Mycobacterium tuberculosis Allows for Better Target-specific Drug Development",\N
19362,"19362","2014-01-13",\N,"Solution Structure of the STIM1 CC1-CC2 homodimer.",\N
19363,"19363","2014-01-13",\N,"Solution structure of the STIM1 CC1-CC2 homodimer in complex with two Orai1 C-terminal domains.",\N
19364,"19364","2014-02-13",\N,"1HN, 13C, and 15N Chemical Shift Assignments for Nupr1",\N
19365,"19365","2013-09-30","2013-10-03","Solution structure of Lipid Transfer Protein from Lentil Lens Culinaris",\N
19366,"19366","2014-02-10","2014-05-06","NMR structure of region 2 of E. coli sigmaE",\N
19367,"19367","2014-02-10","2014-05-06","Solution structure of the complex formed by the region 2 of E. coli sigmaE and its cognate -10 non template element TGTCAAA",\N
19368,"19368","2013-11-26","2014-02-04","Structure of Pex14 in complex with Pex5 LVxEF motif",\N
19369,"19369","2014-02-13",\N,"calbindin D9k(P47M+C80) Apo form",\N
19370,"19370","2014-02-13",\N,"calbindin D9k(P47M+C80) calcium bound form",\N
19371,"19371","2014-02-13",\N,"calbindin D9k(P47M+C80) Magnesium bound form",\N
19377,"19377","2013-07-23",\N,"1H, 15N, 13C Backbone and 13Cbeta Chemical Shift Assignment of mouse Interleukin-10",\N
19379,"19379","2013-11-11","2014-02-04","NMR structures of the alpha7 nAChR transmembrane domain.",\N
19380,"19380","2014-02-13","2014-05-02","NMR structure of the RNA polymerase alpha subunit C-terminal domain from Helicobacter pylori",\N
19384,"19384","2013-08-14",\N,"mu-PIIIA-1",\N
19385,"19385","2013-08-14",\N,"mu-PIIIA-2",\N
19388,"19388","2013-08-28",\N,"The Apo-structure of the Low Molecular Weight Protein-tyrosine Phosphatase A (MptpA) from Mycobacterium tuberculosis Allows for Better Target-specific Drug Development",\N
19391,"19391","2013-12-09","2014-02-04","Solution structure of MBD3 methylcytosine binding domain while bound to hydroxymethylated DNA",\N
19392,"19392","2013-10-14",\N,"Human Bcl10 CARD",\N
19393,"19393","2014-02-13",\N,"Solid-state NMR sequential assignment of Osaka-Mutant Amyloid-beta (A 1-40 E22 ) fibrils",\N
19395,"19395","2013-10-08",\N,"Solution Structure of human holo-PRL-3 in complex with vanadate",\N
19396,"19396","2014-01-13","2014-02-04","Lasiocepsin",\N
19398,"19398","2013-09-10",\N,"Solution structure of the forkhead domain of Brugia malayi DAF-16a",\N
19399,"19399","2013-10-08","2013-12-06","NMR structure of EKLF(22-40)/Ubiquitin Complex",\N
19400,"19400","2013-10-08","2013-10-30","The structure of the Box CD enzyme reveals regulation of rRNA methylation",\N
19402,"19402","2013-09-16","2014-02-04","Structure of an antiparallel (2+2) G-quadruplex formed by human telomeric repeats in Na+ solution (with G22-to-BrG substitution)",\N
19403,"19403","2013-10-14",\N,"The Clip-segment of the von Willebrand domain 1 of the BMP modulator protein Crossveinless 2 is preformed",\N
19404,"19404","2013-11-26",\N,"Solution NMR Structure of DE NOVO DESIGNED Top7 Fold Protein Top7m13, Northeast Structural Genomics Consortium (NESG) Target OR33",\N
19406,"19406","2013-09-03",\N,"K11-linked Diubiquitin average solution structure at pH 6.8, 0 mM NaCl",\N
19407,"19407","2013-09-10",\N,"Conformation and dynamics of the periplasmic membrane-protein chaperone complexes OmpX Skp and tOmpA Skp",\N
19408,"19408","2013-09-10",\N,"Conformation and dynamics of the periplasmic membrane-protein chaperone complexes OmpX Skp and tOmpA Skp",\N
19409,"19409","2013-09-10",\N,"Conformation and dynamics of the periplasmic membrane-protein chaperone complexes OmpX Skp and tOmpA Skp",\N
19410,"19410","2013-09-10",\N,"Conformation and dynamics of the periplasmic membrane-protein chaperone complexes OmpX Skp and tOmpA Skp",\N
19411,"19411","2013-09-13",\N,"Conformation and dynamics of the periplasmic membrane-protein chaperone complexes OmpX Skp and tOmpA Skp",\N
19412,"19412","2013-09-03",\N,"K11-linked Diubiquitin average solution structure at pH 6.8, 150 mM NaCl",\N
19413,"19413","2013-12-09",\N,"KpDsbA",\N
19415,"19415","2014-02-13","2014-05-02","LMO4-LIM2 in complex with DEAF-1 (404-418)",\N
19416,"19416","2013-09-23","2014-02-04","NMR Structure of Rrp7 C-terminal Domain",\N
19419,"19419","2014-02-13","2014-09-30","1H, 13C, and 15N Chemical Shift Assignments of C-ala domain from Bizionia argentinensis",\N
19423,"19423","2013-08-26","2013-10-03","Solution structure of the Vav1 SH2 domain complexed with a Syk-derived singly phosphorylated peptide",\N
19424,"19424","2014-02-12",\N,"Backbone chemical shift assignments of delta exon 3 mouse RyR2 domain A",\N
19425,"19425","2013-09-10","2013-10-09","X-ray crystallography-solution NMR hybrid structure of mouse RyR2 domain A.",\N
19426,"19426","2014-02-12",\N,"1H, 13C, and 15N Chemical Shift Assignments for a peptide encompassing the first 61 residues of the Kv1.4 channel",\N
19427,"19427","2013-11-26","2014-02-04","The solution structure of the C-terminal domain of BldD from Streptomyces coelicolor",\N
19428,"19428","2014-02-12","2014-05-02","A bacteriophage transcription regulator inhibits bacterial transcription initiation by -factor displacement",\N
19429,"19429","2014-02-12","2014-05-02","A bacteriophage transcription regulator inhibits bacterial transcription initiation by -factor displacement",\N
19430,"19430","2013-10-28","2014-02-04","Structure of Salmonella MgtR",\N
19431,"19431","2013-10-21",\N,"NMR structure of hypothetical protein RUMGNA_01855 from Ruminococcus gnavus ATCC 29149",\N
19433,"19433","2013-09-03","2013-09-11","NMR structure of the protein YP_002937094.1 from Eubacterium rectale",\N
19435,"19435","2013-09-30","2014-02-04","Structural studies on dinuclear ruthenium(II) complexes that bind diastereoselectively to an anti-parallel folded human telomere sequence",\N
19436,"19436","2013-12-16","2013-12-19","Backbone 1H, 13C, and 15N Chemical Shift Assignments for murine norovirus NS1/2 D94E mutant",\N
19437,"19437","2013-09-23",\N,"Membrane induced structure of the mammalian tachykinin neuropeptide gamma",\N
19440,"19440","2014-01-23","2014-02-04","NMR structure of DNA duplex",\N
19441,"19441","2014-01-21",\N,"NMR structure of spermine modified DNA duplex",\N
19442,"19442","2013-09-19","2013-10-02","Backbone 1H, 13C, and 15N Chemical Shift Assignments for E7 protein from human Papillomavirus 16",\N
19443,"19443","2013-09-19","2014-05-06","1H, 13C and 15N Backbone Assignment of the EC-1 Domain of Human E-Cadherin",\N
19446,"19446","2013-09-19","2014-05-06","Single-stranded DNA binding protein from E. coli (SSB)",\N
19447,"19447","2014-02-03",\N,"DISTINCT UBIQUITIN BINDING MODES EXHIBITED BY SH3 DOMAINS: MOLECULAR DETERMINANTS AND FUNCTIONAL IMPLICATIONS",\N
19448,"19448","2013-10-14","2014-02-04","Structural studies on dinuclear ruthenium(II) complexes that bind diastereoselectively to an anti-parallel folded human telomere sequence",\N
19449,"19449","2013-10-08",\N,"NMR structure of a BolA-like hypothetical protein RP812 from RICKETTSIA PROWAZEKII, SEATTLE STRUCTURAL GENOMICS CENTER FOR INFECTIOUS DISEASE (SSGCID)",\N
19453,"19453","2013-11-11",\N,"NMR structure of the protein ZP_02042476.1 from Ruminococcus gnavus",\N
19454,"19454","2014-01-21","2014-04-29","Solid-state NMR structure of piscidin 1 in aligned 3:1 phosphatidylcholine/phosphoglycerol lipid bilayers",\N
19455,"19455","2014-01-21","2014-04-29","Solid-state NMR structure of piscidin 1 in aligned 1:1 phosphatidylethanolamine/phosphoglycerol lipid bilayers",\N
19456,"19456","2014-01-21","2014-04-29","Solid-state NMR structure of piscidin 3 in aligned 3:1 phosphatidylcholine/phosphoglycerol lipid bilayers",\N
19457,"19457","2014-01-21","2014-04-29","Solid-state NMR structure of piscidin 3 in aligned 1:1 phosphatidylethanolamine/phosphoglycerol lipid bilayers",\N
19458,"19458","2013-11-11","2014-02-04","CR1-2-3",\N
19459,"19459","2013-11-11","2014-02-04","CR1~1-2",\N
19461,"19461","2014-02-12",\N,"HlyII-C major cis form",\N
19462,"19462","2014-02-12",\N,"HlyII-C minor trans form",\N
19463,"19463","2014-02-12",\N,"p87m-BMRB",\N
19464,"19464","2014-02-12",\N,"NMR structure of the HicA toxin from Burkholderia pseudomallei",\N
19468,"19468","2013-09-23",\N,"Fragment based approach and binding behavior of LFampinB with Lipopolysaccharide:biophysical aspects",\N
19469,"19469","2013-09-23",\N,"Fragment based approach and binding behavior of LFampinB with Lipopolysaccharide: biophysical aspects",\N
19470,"19470","2013-09-23",\N,"Fragment based approach and binding behavior of LFampinB with Lipopolysaccharide:biophysical aspects",\N
19471,"19471","2013-09-23",\N,"Fragment based approach and binding behavior of LFampinB with Lipopolysaccharide: biophysical aspects",\N
19472,"19472","2013-09-19","2014-02-04","1H, 13C, and 15N Chemical Shift Assignments for Sp140 PHD finger trans conformer",\N
19473,"19473","2013-09-19","2014-02-04","1H, 13C, and 15N Chemical Shift Assignments for Sp140 PHD finger cis conformer",\N
19474,"19474","2013-12-23","2014-02-04","Structure of uninhibited ETV6 ETS domain",\N
19476,"19476","2014-03-03","2014-05-02","NMR SOLUTION STRUCTURE OF ALPHA CONOTOXIN LO1A FROM Conus longurionis",\N
19477,"19477","2014-02-12",\N,"Backbone 1H and 15N Chemical Shift Assignments for P130 Cas substrate domain",\N
19478,"19478","2013-10-04","2014-02-04","Backbone assignments for TNRC6B motif I (599-683)",\N
19480,"19480","2014-02-12","2014-04-29","The Solution Structure of the Regulatory Domain of Tyrosine Hydroxylase",\N
19481,"19481","2014-02-12","2014-04-29","The Solution Structure of the Regulatory Domain of Tyrosine Hydroxylase",\N
19482,"19482","2014-01-02","2014-04-29","The Solution Structure of the Regulatory Domain of Tyrosine Hydroxylase",\N
19483,"19483","2014-02-12",\N,"Solution structure of the WW domain of HYPB",\N
19485,"19485","2013-10-09","2014-02-04","Chemical Shift Assignments for SVIP (small VCP/p97-interacting protein)",\N
19486,"19486","2013-09-23",\N,"Solution NMR Structure of Zinc finger protein 423 from Homo sapiens, Northeast Structural Genomics Consortium (NESG) Target HR7298F",\N
19487,"19487","2014-02-12",\N,"Solution structure of the PP2WW mutant (KPP2WW) of HYPB",\N
19489,"19489","2013-10-18","2014-02-04","NMR SOLUTION STRUCTURE OF MSP-P56S DOMAIN/VAPB in DPC",\N
19490,"19490","2014-02-12",\N,"Human cytosolic dNT-1 nucleotidase",\N
19491,"19491","2014-02-12",\N,"1H, 13C, 15N chemical shift assignments of full-length apo human Galectin-3 (2-250).",\N
19495,"19495","2014-02-12",\N,"HN, NH, CA, CB and methyl group assignments of Filamin C two Ig-domain fragment FLNc4-5",\N
19496,"19496","2014-02-12",\N,"HN, NH, CA, CB and methyl group assignments of Filamin A three Ig-domain fragment FLNa3-5",\N
19501,"19501","2014-02-10","2014-04-24","A novel 4/7-conotoxin LvIA from Conus lividus that selectively blocks 32 vs. 6/323 nicotinic acetylcholine receptors",\N
19503,"19503","2014-01-13","2014-02-03","Circular Permutant of the WW Domain with Loop 1 Excised",\N
19506,"19506","2014-02-12",\N,"Human eukaryotic release factor eRF1",\N
19507,"19507","2013-11-11",\N,"Backbone assignment and Secondary Structure of Intrinsically Unstructured Culture Filtrate Antigen protein (CFP10) from Mycobacterium Tuberculosis",\N
19510,"19510","2013-10-08",\N,"NMR structure of the Paracoccus denitrificans Z-subunit determined in the presence of ADP",\N
19511,"19511","2013-09-30","2013-10-07","NMR Structure of the homeodomain transcription factor Gbx1 from Homo sapiens solved in the presence of the DNA sequence CGACTAATTAGTCG",\N
19512,"19512","2013-10-08","2014-04-24","HIV-1 gp41 clade B double alanine mutant Membrane Proximal External Region peptide in DPC micelle",\N
19513,"19513","2013-10-08","2014-04-24","HIV-1 gp41 clade C Membrane Proximal External Region peptide in DPC micelle",\N
19514,"19514","2013-10-08","2014-04-24","HIV-1 gp41 clade C Membrane Proximal External Region peptide in DPC micelle",\N
19515,"19515","2013-10-08","2014-04-24","HIV-1 gp41 clade C Membrane Proximal External Region peptide in DPC micelle",\N
19517,"19517","2014-02-12",\N,"Micelle-solubilized transmembrane domain of the hepatitis C virus glycoprotein E1",\N
19518,"19518","2014-01-29",\N,"Solution NMR assignment of the heavy chain complex of the human cardiac myosin regulatory light chain",\N
19523,"19523","2014-01-02","2014-05-02","N-terminal domain of Bilbo1 from Trypanosoma brucei",\N
19525,"19525","2013-09-30",\N,"Solution structure of the Nt. GR-RBP1 RRM domain",\N
19530,"19530","2014-02-12","2014-12-04","Resonance assignment of RQC domain of human Bloom syndrome protein",\N
19533,"19533","2013-11-04",\N,"Solution Structure of NusE (S10) from Thermotoga maritima",\N
19540,"19540","2013-11-04","2014-02-03","haddock model of MyT1 F4F5 - DNA complex",\N
19542,"19542","2014-01-02","2014-02-03","Mambalgin-2",\N
19544,"19544","2014-02-24","2014-05-02","Csr/Rsm protein-RNA recognition - A molecular affinity ruler: RsmZ(SL1)/RsmE(dimer) 2:1 complex",\N
19546,"19546","2014-02-24","2014-05-02","Csr/Rsm protein-RNA recognition - A molecular affinity ruler: RsmZ(SL2)/RsmE(dimer) 2:1 complex",\N
19547,"19547","2014-02-24","2014-05-02","Csr/Rsm protein-RNA recognition - A molecular affinity ruler: RsmZ(SL3)/RsmE(dimer) 2:1 complex",\N
19548,"19548","2014-02-24","2014-05-02","Csr/Rsm protein-RNA recognition - A molecular affinity ruler: RsmZ(SL4)/RsmE(dimer) 2:1 complex",\N
19549,"19549","2014-02-24","2014-05-02","Csr/Rsm protein-RNA recognition - A molecular affinity ruler: RsmZ(36-44)/RsmE(dimer) 2:1 complex",\N
19551,"19551","2014-02-12",\N,"1H, 13C, and 15N Chemical Shift Assignments for human FK506 binding Protein 25",\N
19555,"19555","2013-12-09",\N,"Solution structure of the C-terminally encoded peptide of the plant parasitic nematode Meloidogyne hapla - CEP11",\N
19556,"19556","2013-12-09",\N,"Solution structure of the C-terminally encoded peptide of the model plant host Medicago truncatula - CEP1",\N
19557,"19557","2013-11-26","2013-12-06","Solution structure of the circular g-domain analog from the wheat metallothionein Ec-1",\N
19558,"19558","2014-02-12",\N,"Backbone and stereospecific Methyl Ile(d1), Leu and Val chemical shift assignment of Crc",\N
19559,"19559","2014-02-12",\N,"Backbone resonance assignments of Bcl-2/xL",\N
19560,"19560","2013-11-11","2013-11-27","N-terminal and Middle domains of human Hsp90alpha",\N
19562,"19562","2014-02-12","2014-06-26","NMR solution structures of FRS2a PTB domain with neurotrophin receptor TrkB",\N
19563,"19563","2014-02-12",\N,"chemical shift assignments for human dihdyrofolate reductase bound to folate",\N
19564,"19564","2014-02-12",\N,"chemical shift assignments and 3Jcgn & 3Jcgc' scalar couplings for human dihdyrofolate reductase bound to THF",\N
19565,"19565","2014-02-12",\N,"chemical shift assignments and 3Jcgn & 3Jcgc' scalar couplings for human dihdyrofolate reductase bound to NADP+ and THF",\N
19566,"19566","2014-02-12",\N,"chemical shift assignments and 3Jcgn & 3Jcgc' scalar couplings for human dihdyrofolate reductase bound to NADPH",\N
19567,"19567","2014-02-12",\N,"chemical shift assignments and 3Jcgn & 3Jcgc' scalar couplings for human dihdyrofolate reductase bound to NADP+ and folate",\N
19568,"19568","2014-02-12","2014-04-24","assignment of the transmembrane domain of insulin receptor in detergent micelles",\N
19569,"19569","2014-02-12",\N,"NMR chemical shift assignments of mouse Vps28 C-terminal domain",\N
19573,"19573","2014-02-11","2014-06-05","STRUCTURE OF LASSO PEPTIDE XANTHOMONIN II",\N
19575,"19575","2014-02-11","2014-04-24","HIV-1 capsid protein in tubular assemblies",\N
19576,"19576","2014-02-11","2014-04-24","Backbone resonance assignment of FAPP1 PH domain in the presence of 10% (w/v) DMPC/DHPC (q=0.25), and in the presence of 10% (w/v) DMPC/DHPC (q=0.25) plus 8mM PI4P",\N
19577,"19577","2013-12-16",\N,"Non-reducible analogues of alpha-conotoxin Vc1.1: [2,8]-cis dicarba Vc1.1",\N
19578,"19578","2013-12-16",\N,"Non-reducible analogues of alpha-conotoxin Vc1.1: [2,8]-trans dicarba Vc1.1",\N
19586,"19586","2014-02-11","2014-04-24","Solution Structure of Calmodulin bound to the target peptide of Endothelial Nitrogen Oxide Synthase phosphorylated at Thr495",\N
19587,"19587","2013-12-16",\N,"Non-reducible analogues of alpha-conotoxin Vc1.1: [3,16]-trans dicarba Vc1.1",\N
19590,"19590","2014-02-11",\N,"Aliphatic 13C Chemical Shift Assignments For the Unfolded State of the Fyn SH3 Domain G48A Mutant",\N
19591,"19591","2014-02-11",\N,"Aliphatic 13C Chemical Shift Assignments For the Intermediate State of the FF Domain L24A Mutant",\N
19593,"19593","2014-02-11","2014-04-24","Truncated EGF-A",\N
19594,"19594","2014-01-21","2014-02-03","Solution structure of a G-quadruplex bound to the bisquinolinium compound Phen-DC3",\N
19595,"19595","2014-02-11",\N,"NMR solution structure of oxytocin",\N
19596,"19596","2014-02-11",\N,"C-terminal disordered region of the pancreatic duodenal homeobox protein 1",\N
19598,"19598","2014-02-11",\N,"1H, 13C, and 15N Chemical Shift Assignments for human EPRS WHEP domains",\N
19599,"19599","2014-02-11",\N,"Human EPRS R12 Repeats",\N
19600,"19600","2014-02-11",\N,"CEH37 Homeodomain",\N
19604,"19604","2014-02-10","2014-04-23","1H, 13C, and 15N chemical shift assignments for the complex of calmodulin with minimal binding domain from HIV-1 matrix protein",\N
19605,"19605","2013-12-23","2014-04-23","PonA2-PASTA",\N
19607,"19607","2014-02-10",\N,"The C-terminal domain of SRA1p has a fold more similar to PRP18 than to an RRM and does not directly bind to the SRA1 RNA STR7 region.",\N
19611,"19611","2014-01-21","2014-06-26","Enzymatic cyclisation of kalata B1 using sortase A",\N
19614,"19614","2014-02-03","2014-04-23","The basic-helix-loop-helix region of the transcriptional repressor HES-1 is preorganized to bind DNA",\N
19615,"19615","2014-02-11","2014-04-23","Ligand-dependent dynamics of the active-site lid in bacterial dimethylarginine dimethylaminohydrolase",\N
19616,"19616","2014-02-11","2014-04-23","Ligand-dependent dynamics of the active-site lid in bacterial dimethylarginine dimethylaminohydrolase",\N
19617,"19617","2013-12-09",\N,"Solution structure of the Big domain from Leptospira interrogans",\N
19619,"19619","2014-03-03","2014-04-30","Structure and NMR assignments of lantibiotic NAI-107 in DPC micelles",\N
19621,"19621","2014-02-11",\N,"1H, 13C and 15N chemical shift assignments for the cyclic-nucleotide binding homology domain of the KCNH channel from Zebrafish",\N
19624,"19624","2013-12-20",\N,"1H and 15N chemical shift assignments for circular sortase A",\N
19627,"19627","2013-12-02","2013-12-20","NMR strucutre of the hypothetical protein BACUNI_03114 from Bacteroides uniformis ATCC 8492",\N
19628,"19628","2014-03-03",\N,"NMR structure of the protein NP_419126.1 from CAULOBACTER CRESCENTUS",\N
19629,"19629","2014-02-11",\N,"1H, 15N, and 13C Chemical Shift Assignments of the Dark State of a Cyanobacterial GAF Domain (NpF2164-GAF3)",\N
19632,"19632","2013-12-20","2014-01-03","NMR structure of protein NP_254181.1 from Pseudomonas aeruginosa PA01",\N
19634,"19634","2013-12-23","2014-04-23","Solution structure of the CR4/5 domain of medaka telomerase RNA",\N
19642,"19642","2013-12-20",\N,"NMR structure of the first RRM domain of the protein RBM39 from homo sapiens",\N
19643,"19643","2014-02-04",\N,"NMR Solution State Structure of the PSD-95 PDZ1 - 5-HT2c Complex",\N
19644,"19644","2014-02-11",\N,"CD79a cytosolic domain native",\N
19645,"19645","2014-02-11",\N,"CD79a cytosolic domain denatured",\N
19648,"19648","2014-02-11",\N,"CD79a cytosolic domain phosphorylated",\N
19649,"19649","2014-02-11",\N,"CD79a cytosolic domain phosphorylated, denatured state",\N
19650,"19650","2014-02-11",\N,"CD79b cytosolic domain",\N
19651,"19651","2014-02-11",\N,"CD79b cytosolic domain denatured",\N
19653,"19653","2014-02-11","2014-08-29","RRM domain from C. elegans SUP-12",\N
19655,"19655","2014-02-11",\N,"CD79b cytosolic domain phosphorylated",\N
19656,"19656","2014-02-11",\N,"CD79b cytosolic domain phosphorylated, denatured state",\N
19658,"19658","2013-12-23",\N,"The solution NMR structure of maximin-4 in SDS micelles",\N
19660,"19660","2014-01-02","2014-06-05","Structure determination of the salamander courtship pheromone Plethodontid Modulating Factor",\N
19662,"19662","2014-01-10","2014-02-03","NMR structure of the I-V kissing-loop interaction of the Neurospora VS ribozyme",\N
19667,"19667","2014-01-27",\N,"Solution structure of the carboxyterminal domain of NusG from Mycobacterium tuberculosis",\N
19669,"19669","2014-01-13",\N,"Backbone 1H, 15N, and 13C resonance assignments of the N-terminal carbohydrate-binding domain of beta-glucan recognition protein 2 from Manduca sexta",\N
19682,"19682","2014-01-22","2014-04-10","Solution NMR Structure of PHD Type 1 Zinc Finger Domain 1 of Lysine-specific Demethylase Lid from Drosophila melanogaster, Northeast Structural Genomics Consortium (NESG) Target FR824J",\N
19683,"19683","2014-03-10","2014-03-25","NMR structure of the S-linked glycopeptide sublancin 168",\N
19684,"19684","2013-12-20",\N,"Solution NMR Structure of SH3 Domain 1 of Rho GTPase-activating Protein 10 from Homo sapiens, Northeast Structural Genomics Consortium (NESG) Target: HR9129A",\N
19687,"19687","2014-02-10",\N,"immune signalling subunit",\N
19688,"19688","2014-02-19",\N,"1H, 15N and 13C resonance assignments of the yeast Pih1 and Tah1 C-terminal domains complex",\N
19692,"19692","2014-01-21","2014-02-03","NMR Localization of Divalent Cations at the Active Site of the Neurospora VS Ribozyme Provides Insights Into RNA-Metal Ion Interactions",\N
19694,"19694","2014-01-13",\N,"Structure of FHL2 LIM adaptor and its Interaction with Ski",\N
19698,"19698","2014-01-27","2014-04-01","Solution NMR structure of a preQ1 Class II riboswitch from Streptococcus pneumoniae",\N
19703,"19703","2014-01-14",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments and structure of Iron-sulfur cluster binding protein from Ehrlichia chaffeensis",\N
19709,"19709","2014-01-23",\N,"Solution NMR structure of beta-adaptin appendage domain of human adaptor protein complex 4 subunit beta, Northeast Structural Genomics Consortium (NESG) Target HR8998C",\N
19723,"19723","2014-02-06",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments of the Cytoplasmic Tail of Ig-alpha (CD79a) in a Heterodimeric Construct",\N
19724,"19724","2014-02-06",\N,"Backbone 1H, 13C, and 15N Chemical Shift Assignments of the Cytoplasmic Tail of Ig-beta (CD79b) in a Heterodimeric Construct",\N
19725,"19725","2014-02-06",\N,"Backbone 1H and 15N Chemical Shift Assignments of a Double Y to E Mutant of the Cytoplasmic Tail of Ig-alpha (CD79a) in a Heterodimeric Construct",\N
19729,"19729","2014-01-21","2014-04-30","NMR STRUCTURE OF HEN EGG BETA-DEFENSIN GALLIN (CHICKEN OVO-DEFENSIN)",\N
19734,"19734","2014-01-22","2014-04-23","Complete chemical shift assignment of the ssDNA in the filamentous bacteriophage fd report on its conformation and on its interface with the capsid shell",\N
19737,"19737","2014-02-04","2014-04-23","Solution structure of a C terminal fragment of the neuronal isoform of the polypyrimidine tract binding protein (nPTB)",\N
19745,"19745","2014-03-03",\N,"Solution NMR structure of a mismatch DNA",\N
19749,"19749","2014-03-03",\N,"Solution NMR structure of N-terminal domain (SH2 domain) of human Inositol polyphosphate phosphatase-like protein 1 (INPPL1) (fragment 20-117), Northeast Structural Genomics Consortium Target HR9134A.","/ftp/pub/bmrb/timedomain/bmr19749"
19750,"19750","2014-02-17","2014-04-16","Solution NMR structure of gp41 ectodomain monomer on a DPC micelle",\N
19753,"19753","2014-02-24",\N,"Solution NMR Structure plectin repeat domain 6 (4403-4606) of Plectin from Homo sapiens, Northeast Structural Genomics Consortium (NESG) Target HR6354E",\N
19754,"19754","2014-02-05","2014-04-23","Chemical shifts assignments of diacylglycerol kinase (DAGK) by solid-state NMR",\N
19773,"19773","2014-03-14","2014-04-23","Backbone chemical shifts for the E81 deletion mutant from RAP80 tandem UIMs",\N
19774,"19774","2014-03-14","2014-04-23","Backbone chemical shifts for the tandem UIMs of wild-type RAP80.",\N
19789,"19789","2014-02-24","2014-04-23","N domain of cardiac troponin C bound to the switch fragment of fast skeletal troponin I at pH 6",\N
19791,"19791","2014-03-03","2014-04-23","Structural Characterization of a Complex Between the Acidic Transactivation Domain of EBNA2 and the Tfb1/p62 subunit of TFIIH.",\N
19792,"19792","2014-03-10",\N,"NMR structure of the RRM domain of RBMX from homo sapiens",\N
19807,"19807","2014-03-10",\N,"NMR structure of hypothetical protein ZP_02069618.1 from Bacteroides uniformis ATCC 8492.",\N
19816,"19816","2014-03-10",\N,"NMR structure of the C-domain of troponin C bound to the anchoring region of troponin I",\N
19817,"19817","2014-03-10",\N,"NMR structure of the dilated cardiomyopathy mutation G159D in troponin C bound to the anchoring region of troponin I",\N
19821,"19821","2014-03-10","2014-06-05","Stf76 from the Sulfolobus islandicus plasmid-virus pSSVx",\N
20001,"20001","2008-07-15","2012-06-28","A novel lectin-like peptide from Odorrana grahami",\N
20002,"20002","2008-06-30","2012-06-28","Solution structure of RgIA",\N
20003,"20003","2008-05-27","2012-06-28","NMR Structure of Leucine-Enkephalin in Water",\N
20004,"20004","2008-06-11","2012-06-28","NMR Solution Structure of Leucine-Enkephlain in DMPC+CHAPS (1:4) bicelles in 90% H2O/10% D2O of pH 6.6 at 298K",\N
20005,"20005","2008-06-11","2012-06-28","NMR Solution Structure of Leucine-Enkephlain in DMPC+CHAPS (1:4) bicelles in 90% H2O/10% D2O of pH 6.6 at 298K",\N
20007,"20007","2008-02-22","2012-06-28","Solution structure of conopressin-T",\N
20008,"20008","2008-02-22","2012-06-28","Solution structure of L7P Conopressin-T",\N
20009,"20009","2008-12-30","2012-06-28","NMR STRUCTURE OF THE MUTANT OF CHIGNOLIN, CLN025",\N
20010,"20010","2008-07-15","2012-06-28","Superimposed fifteen structures of 17-residue peptide corresponding to the segment within ice nucleation protein of X. campestris pv. campestris",\N
20011,"20011","2009-03-31","2012-06-28","NMR STRUCTURE OF THE MUTANT OF CHIGNOLIN, CLN025",\N
20012,"20012","2009-04-23","2012-05-23","Tertiary structure and lipid interactions of short recombinant antimicrobial peptide",\N
20013,"20013","2009-04-23","2012-05-23","Tertiary structure and lipid interactions of short recombinant antimicrobial peptide",\N
20014,"20014","2008-08-28","2009-06-05","STRUCTURE OF ANTIBACTERIAL PEPTIDE CAPISTRUIN: A 19-RESIDUE LARIAT PROTOKNOT WITH A THREADED 9-MEMBER SIDECHAIN TO-BACKBONE RING","/ftp/pub/bmrb/timedomain/bmr20014"
20015,"20015","2009-04-03",\N,"NMR structure of a V3 (SF2 isolate) peptide",\N
20016,"20016","2009-01-16",\N,"NMR structure of Temporin-SHa in micellar SDS",\N
20017,"20017","2009-01-16",\N,"NMR structure of Temporin-SHb in micellar SDS",\N
20018,"20018","2009-01-16",\N,"NMR structure of Temporin-SHc in micellar SDS",\N
20019,"20019","2009-04-03",\N,"NMR structure of a V3 (MN isolate) peptide",\N
20020,"20020","2009-04-03",\N,"NMR structure of a V3 (LAI isolate) peptide",\N
20022,"20022","2011-02-14",\N,"1H Chemical Shift Assignments for metastin analog, s5a",\N
20023,"20023","2009-03-02",\N,"Structure, dynamics and selectivity of the sodium channel blocker mu-conotoxin SIIIA",\N
20024,"20024","2008-07-15",\N,"NMR solution structure of mu-conotoxin TIIIA",\N
20025,"20025","2008-07-30",\N,"NMR solution structure of mu-conotoxin SIIIA",\N
20026,"20026","2008-09-10",\N,"Mutagenesis and nuclear magnetic resonance analyses of the fusion peptide of Helicoverpa armigera single nucleocapsid nucleopolyhedrovirus F protein",\N
20027,"20027","2009-04-03",\N,"Brome Mosaic Virus protein 1a Helix A bound to SDS micelle",\N
20028,"20028","2008-07-08","2011-02-14","Structures of 1-15 peptide fragment of Statherin",\N
20029,"20029","2009-02-04","2012-05-31","13C and 1H atom assignments and structure for Apelin 17 (Human form) at 35C",\N
20030,"20030","2009-02-04","2012-05-31","13C, 1H chemical shifts and structure of apelin 17(human form, major conformation) at 5C",\N
20031,"20031","2009-02-04","2012-05-31","13C, 1H chemical shifts and structure of Apelin 17 (Human form, minor conformation at 5C)",\N
20032,"20032","2009-04-04",\N,"Solution structure of Gelatinase Biosynthesis-Activating Pheromone (GBAP), a 11-residue peptide lactone, from the Gram-positive bacterium Enterococcus faecalis",\N
20033,"20033","2009-03-18",\N,"Solution structure of dicarba-ImI: an alpha-conotoxin with a non-reducible cystine analogue",\N
20034,"20034","2008-10-14","2011-02-14","Solution NMR Structure of 4F Associated With DMPC Disc",\N
20036,"20036","2009-03-06","2011-03-15","Cyclic Pseudotetrapeptide L-Phe-L-Trp-L-Lys-L-Thr",\N
20037,"20037","2009-03-06","2011-03-15","Cyclic Pseudotetrapeptide D-Phe-L-Trp-L-Lys-L-Thr",\N
20038,"20038","2009-03-06","2011-03-15","Cyclic Pseudotetrapeptide L-Phe-D-Trp-L-Lys-L-Thr",\N
20039,"20039","2009-03-06","2011-03-15","Cyclic Pseudotetrapeptide L-Phe-L-Trp-D-Lys-L-Thr",\N
20040,"20040","2009-03-06","2011-03-15","Cyclic Pseudotetrapeptide D-Phe-D-Trp-D-Lys-L-Thr",\N
20041,"20041","2009-03-06","2011-03-15","Cyclic Pseudotetrapeptide L-Phe-D-Trp-D-Lys-L-Thr",\N
20042,"20042","2009-03-06","2011-03-15","Cyclic Pseudotetrapeptide L-Phe-L-Trp-D-Lys-D-Thr",\N
20043,"20043","2009-03-06","2011-03-15","Cyclic Pseudotetrapeptide L-Phe-D-Trp-L-Lys-D-Thr",\N
20044,"20044","2009-10-12","2010-01-25","NMR structure of the Interleukin-8 C-terminal domain in solution with SDS micelles",\N
20045,"20045","2009-04-04",\N,"SOLUTION NMR STRUCTURE OF HUMAN IAPP-1-19",\N
20046,"20046","2009-04-04",\N,"SOLUTION NMR STRUCTURE OF RAT IAPP-1-19",\N
20047,"20047","2009-07-23","2009-09-09","INTERACTION OF THE DENGUE VIRUS FUSION PEPTIDE WITH MEMBRANES ASSESSED BY NMR: THE ESSENTIAL ROLE OF THE ENVELOPE PROTEIN TRP101 FOR MEMBRANE FUSION",\N
20048,"20048","2009-04-04","2009-05-19","NMR solution structure of an analgesic Mu-contoxin KIIIA",\N
20049,"20049","2009-04-04","2009-05-19","NMR solution structure of Mu-KIIIA[C1A,C9A]",\N
20050,"20050","2009-04-04","2011-02-14","NMR STRUCTURE OF DPAKKR, A CYCLIC PENTAPEPTIDE MIMIC OF BDNF",\N
20051,"20051","2011-06-02",\N,"Biological and structural study of Obestatin and its analogues Structural importance of Obestatin and its biology",\N
20052,"20052","2010-03-01",\N,"Solution NMR Structure of Insulin A-chain peptide",\N
20053,"20053","2010-03-01",\N,"Solution NMR structure of Insulin A-chain variant peptide",\N
20054,"20054","2010-09-02",\N,"Tetramer of KIA7W peptide",\N
20055,"20055","2010-09-02",\N,"Tetramer of KIA7H peptide",\N
20056,"20056","2009-02-06",\N,"LSEAL penta-peptide Calpain inhibitor",\N
20057,"20057","2009-06-29","2009-08-27","NMR structure of designed peptide, YI12WF in the presence of Lipopolysaccharide",\N
20058,"20058","2009-06-29","2009-08-27","Solution structure of designed peptide, YI12WW in the presence of Lipopolysaccharide",\N
20059,"20059","2009-06-29","2009-08-27","Solution structure of designed peptide, YI12WY in the presence of LPS bilayer",\N
20060,"20060","2009-06-29","2009-08-27","Solution structure of designed peptide, YI12FF in the presence of LPS bilayer",\N
20061,"20061","2009-06-29","2009-08-27","Solution structure of designed peptide GG8WF in the presence of LPS bilayer",\N
20062,"20062","2010-04-13","2010-10-06","3D NMR models of MBP83-99 peptide in DMSO",\N
20063,"20063","2008-12-09","2011-02-14","NMR STRUCTURE OF A MODEL PEPTIDE BOUND TO GROEL",\N
20064,"20064","2009-02-26","2011-03-15","Design, Synthesis, Biological Evaluation, and Structural Characterization of Potent Histone Deacetylase Inhibitors Based on Cyclic alpha/beta-tetrapeptide architectures",\N
20065,"20065","2009-02-26","2011-03-15","Design, Synthesis, Biological Evaluation, and Structural Characterization of Potent Histone Deacetylase Inhibitors Based on Cyclic alpha/beta-tetrapeptide architectures",\N
20066,"20066","2009-02-26","2011-03-15","Design, Synthesis, Biological Evaluation, and Structural Characterization of Potent Histone Deacetylase Inhibitors Based on Cyclic alpha/beta-tetrapeptide architectures",\N
20067,"20067","2009-02-26","2011-03-15","Design, Synthesis, Biological Evaluation, and Structural Characterization of Potent Histone Deacetylase Inhibitors Based on Cyclic alpha/beta-tetrapeptide architectures",\N
20068,"20068","2009-02-26","2011-03-15","Design, Synthesis, Biological Evaluation, and Structural Characterization of Potent Histone Deacetylase Inhibitors Based on Cyclic alpha/beta-tetrapeptide architectures",\N
20069,"20069","2009-02-26","2011-03-15","Design, Synthesis, Biological Evaluation, and Structural Characterization of Potent Histone Deacetylase Inhibitors Based on Cyclic alpha/beta-tetrapeptide architectures",\N
20070,"20070","2009-02-26","2011-02-22","Design, Synthesis, Biological Evaluation, and Structural Characterization of Potent Histone Deacetylase Inhibitors Based on Cyclic alpha/beta-tetrapeptide architectures",\N
20071,"20071","2009-03-09","2011-02-22","Probing the Bioactive Conformation of an Archetypal Natural Product HDAC Inhibitor Using Conformationally Homogeneous Triazole-Modified Cyclic Tetrapeptides",\N
20072,"20072","2009-03-09","2011-02-22","Probing the Bioactive Conformation of an Archetypal Natural Product HDAC Inhibitor Using Conformationally Homogeneous Triazole-Modified Cyclic Tetrapeptides",\N
20073,"20073","2009-03-09","2011-02-22","Probing the Bioactive Conformation of an Archetypal Natural Product HDAC Inhibitor Using Conformationally Homogeneous Triazole-Modified Cyclic Tetrapeptides",\N
20074,"20074","2009-02-10","2009-03-10","Protein Fibril",\N
20075,"20075","2010-03-01","2010-05-19","Solution structure of the N(1-21)MeuTXK-beta in presence of TFE",\N
20076,"20076","2009-03-12",\N,"NMR Solution Structure of a TC5b_D9E miniprotein",\N
20078,"20078","2010-03-01",\N,"Solution Structure of Antimicrobial Peptide Hedistin",\N
20079,"20079","2010-01-07",\N,"NMR solution structure of the loopregion Tyr67 - Leu77 of visual arrestin in complex with lightactivated rhodopsin",\N
20080,"20080","2010-03-01","2010-06-16","Structure and interactions in membranes of human and bovine Catestatin by solution and solid-state NMR spectroscopy",\N
20081,"20081","2009-06-11","2011-02-15","solution structures of bradykinin - penta-O-galloyl-D-glucopyranose complexe",\N
20082,"20082","2009-08-04","2009-09-02","Apelin17 bound to SDS micelles",\N
20084,"20084","2010-03-01","2011-02-10","DIRHODIUM PEPTIDE COMPLEX",\N
20085,"20085","2011-03-21","2011-05-19","Solution structure of SFT-L1",\N
20086,"20086","2011-06-03","2011-07-08","Helical Agonist of Nociceptin (NOP) Receptor",\N
20087,"20087","2011-06-03","2011-07-08","Novel Helix-Constrained Nociceptin Derivatives Are Potent Agonists and Antagonists of ERK Phosphorylation and Thermal Analgesia in Mice",\N
20088,"20088","2011-06-03","2011-07-08","Novel Helix-Constrained Nociceptin Derivatives Are Potent Agonists and Antagonists of ERK Phosphorylation and Thermal Analgesia in Mice",\N
20089,"20089","2011-06-03","2011-07-08","Novel Helix-Constrained Nociceptin Derivatives Are Potent Agonists and Antagonists of ERK Phosphorylation and Thermal Analgesia in Mice",\N
20090,"20090","2010-10-13","2011-03-17","KAAAD, single alpha helix turn",\N
20091,"20091","2010-10-13","2011-03-17","RSV_1nal",\N
20092,"20092","2010-10-13","2011-03-17","To be advised",\N
20093,"20093","2010-10-13",\N,"REV_HIV peptides",\N
20094,"20094","2010-10-26","2011-03-17","Effects of Peptoid Residue Substitutions on Structural Flexibility and Bacterial-Cell Selectivity of Piscidin 1",\N
20095,"20095","2010-10-27","2011-03-17","Effects of Peptoid Residue Substitutions on Structural Flexibility and Bacterial-Cell Selectivity of Piscidin 1",\N
20098,"20098","2010-10-27","2011-03-17","Effects of Peptoid Residue Substitutions on Structural Flexibility and Bacterial-Cell Selectivity of Piscidin 1",\N
20101,"20101","2009-10-08","2011-03-17","Lipid-induced Conformation of Substance P",\N
20102,"20102","2009-10-09","2010-05-20","C-Terminal helix of the SERCA2b Ca2+ pump (ATP2A2B)",\N
20103,"20103","2010-02-25","2011-03-17","Structural studies of antimicrobial peptide XT-7 and its Lysine4 analogue",\N
20104,"20104","2010-02-25","2011-03-17","structural studies of antimicrobial peptide XT-7 and its Lysine mutated peptide",\N
20105,"20105","2010-01-06","2010-03-01","BI-32169",\N
20107,"20107","2009-11-24","2010-02-01","NMR structure of conotoxin ImI analogue",\N
20108,"20108","2011-06-02","2012-06-28","Conformational Flexibility of SecA IRA1 Loop Region",\N
20109,"20109","2011-02-14",\N,"CHARACTERIZATION OF THE LIGAND-FREE CONSTITUTIVE ACTIVITY OF THE THROMBOXANE A2 RECEPTOR BY THE INTEGRATED APPROACHES OF NMR SPECTROSCOPY AND A RECOMBINANT RECEPTOR",\N
20110,"20110","2010-08-23","2011-02-22","Solution structure of PV1-VPgpU",\N
20111,"20111","2011-06-02","2012-06-28","Conformational Flexibility of SecA IRA1 Loop Region",\N
20112,"20112","2010-01-22","2011-02-14","CHARACTERIZATION OF THE LIGAND-FREE CONSTITUTIVE ACTIVITY OF THE THROMBOXANE A2 RECEPTOR BY THE INTEGRATED APPROACHES OF NMR SPECTROSCOPY AND A RECOMBINANT RECEPTOR",\N
20113,"20113","2010-05-19","2010-05-27","1H, 13C assignments and NMR structure of temporin-SHf",\N
20114,"20114","2012-08-03",\N,"alpha-conotoxin FI",\N
20115,"20115","2010-10-27","2011-03-17","Substance P 40 structures in water pH 5.5 298 K NMR DATA & STRUCTURES",\N
20116,"20116","2010-10-27","2011-03-17","Substance P in DMPC:CHAPS q=0.25 bicelles",\N
20117,"20117","2010-10-27","2011-03-17","Substance P 40 structures in water pH 5.5 298 K NMR DATA & STRUCTURES",\N
20118,"20118","2011-02-14",\N,"A 15-residue peptide corresponding to the C-terminal domain of the Gq protein alpha subunit (Gaq-Ct peptide) was synthesized and characterized using NMR spectroscopic studies.",\N
20119,"20119","2010-03-02","2012-06-28","Assembling NMR structures for the intracellular loops of the human thromboxane A2 receptor: Implication of the G protein-coupling pocket",\N
20121,"20121","2010-07-26","2011-02-23","Tubulysin conformation bound to tubulin",\N
20122,"20122","2010-08-16",\N,"Solution structure of CCAP-vil with one disulfide bond from Conus villepinii",\N
20123,"20123","2010-03-02",\N,"NS4A(1-22)",\N
20124,"20124","2010-12-13",\N,"Structure and lipid interactions of an anti-atherogenic Apolipoprotein J peptide using solution NMR",\N
20125,"20125","2010-11-05","2011-02-04","DPC micelle bound VK22",\N
20126,"20126","2011-04-15","2011-07-08","Alpha-conotoxin Vc1.2",\N
20127,"20127","2011-06-02",\N,"Nociceptin Agonist",\N
20128,"20128","2011-07-08",\N,"solution structure of conotoxin qc16a",\N
21000,"21000","2012-02-07",\N,"Lasso peptide based integrin inhibitor: Microcin J25 variant with RGD substitution of Gly12-Ile13-Gly14",\N
21001,"21001","2012-07-25","2012-09-14","NMR solution of a tridimensional peptidic structure in bilayer lipids: Example with neurotensin in Small Unilamellar Vesicle environment",\N
21002,"21002","2012-08-07",\N,"Solution NMR structure of TZ2C-BG",\N
21006,"21006","2011-10-27",\N,"alpha-conotoxin ImI cystathionine 2-4",\N
21007,"21007","2011-10-27",\N,"alpha-conotoxin ImI cystathionine 1-3",\N
21008,"21008","2011-07-11","2012-06-28","LPS bound structure of Temporin-1Tl",\N
21009,"21009","2012-08-07",\N,"The Binding Mechanism of a Peptidylic Cyclic Serine Protease Inhibitor - upain-1",\N
21010,"21010","2012-08-07",\N,"The Binding Mechanism of a Peptidylic Cyclic Serine Protease Inhibitor - extended upain",\N
21013,"21013","2012-06-01",\N,"DPC micelle bound RI23",\N
21014,"21014","2011-11-07",\N,"solution structure of conotoxin lt14a",\N
21015,"21015","2011-11-07",\N,"solution structure of conotoxin pu14a",\N
21018,"21018","2012-11-02","2013-09-25","Compstatin 10",\N
21019,"21019","2012-11-02",\N,"NMR structure, localization and vesicle fusion of Chikungunya Virus Fusion Peptide",\N
21022,"21022","2013-03-21",\N,"MDCSGCSRPG cyclic + copper(I) from acidic",\N
21023,"21023","2013-03-21",\N,"MDCSGCSRPG head-to-tail cyclic peptide + Cu(I) no metal constraint - high energy ensemble (B)",\N
21024,"21024","2013-03-22",\N,"MDCSGCSRPG cyclic peptide bound to Cu(I) from acidic conditions",\N
21025,"21025","2013-03-22",\N,"MDCSGCSRPG+Zn from acidic conditions",\N
21026,"21026","2013-03-22",\N,"MDCSGCSRPG + Zn from basic conditions",\N
21027,"21027","2013-03-22",\N,"MDCSGCSRPG + Zn from basic conditions - tridentate binding",\N
21028,"21028","2013-03-22",\N,"MDCSGCSRPG-Zn-water complex from acidic conditions",\N
21033,"21033","2013-09-26",\N,"Solution structure of Lewis x (Gal-beta1,4-[Fuc-alpha1,3]-GlcNAc-beta) attached to a protein",\N
21035,"21035","2013-12-10",\N,"AIP-III",\N
21036,"21036","2013-12-10",\N,"AIP-III_D4A",\N
21037,"21037","2013-12-10",\N,"AIP-III_DF5",\N
21038,"21038","2013-12-10",\N,"AIP-III_DL7",\N
21039,"21039","2013-12-10",\N,"AIP-III_F5A cyclic peptide",\N
21040,"21040","2013-12-10",\N,"AIP-III_L7A",\N
21041,"21041","2013-12-10",\N,"tAIP-III",\N
21042,"21042","2013-12-10",\N,"tAIP-III_D2A",\N
21045,"21045","2013-12-10",\N,"AIP-I",\N
21046,"21046","2013-12-10",\N,"AIP-II",\N
21047,"21047","2013-12-10",\N,"AIP-IV",\N