BMRB Entry 16980
Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR16980
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: RDC and RCSA refinement of an A-form RNA: Improvements in Major Groove Width PubMed: 20549304
Deposition date: 2010-06-07 Original release date: 2010-07-26
Authors: Tolbert, Blanton; Summers, Michael; Miyazaki, Yasuyuki; Barton, Shawn; Kinde, Benyam; Stark, Patrice; Singh, Rashmi; Bax, Ad; Case, David
Citation: Tolbert, Blanton; Miyazaki, Yasuyuki; Barton, Shawn; Kinde, Benyam; Starck, Patrice; Singh, Rashmi; Bax, Ad; Case, David; Summers, Michael. "Major groove width variations in RNA structures determined by NMR and impact of 13C residual chemical shift anisotropy and 1H-13C residual dipolar coupling on refinement." J. Biomol. NMR 47, 205-219 (2010).
Assembly members:
RNA_(5'-R(*CP*UP*AP*GP*UP*UP*AP*GP*CP*UP*AP*AP*CP*UP*AP*G)-3'), polymer, 29 residues, Formula weight is not available
Natural source: Common Name: Murine leukemia virus Taxonomy ID: 11786 Superkingdom: not available Kingdom: not available Genus/species: Gammaretrovirus not available
Experimental source: Production method: cell free synthesis
Entity Sequences (FASTA):
RNA_(5'-R(*CP*UP*AP*GP*UP*UP*AP*GP*CP*UP*AP*AP*CP*UP*AP*G)-3'): GCGGUACUAGUUAGCUAACU
AGCUUUGUA
- assigned_chemical_shifts
| Data type | Count |
| 1H chemical shifts | 77 |